ID: 1085001769

View in Genome Browser
Species Human (GRCh38)
Location 11:73043940-73043962
Sequence ATTGGTGAATGGCCTTCCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 117}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085001769_1085001774 -3 Left 1085001769 11:73043940-73043962 CCCTTGGAAGGCCATTCACCAAT 0: 1
1: 0
2: 0
3: 6
4: 117
Right 1085001774 11:73043960-73043982 AATTTTGGCAACAAACTATTAGG 0: 1
1: 0
2: 2
3: 22
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085001769 Original CRISPR ATTGGTGAATGGCCTTCCAA GGG (reversed) Intronic
902316593 1:15624709-15624731 ATTTGTGCTTAGCCTTCCAATGG + Intronic
906256689 1:44355789-44355811 ATTTGTGAAGGGCCGTCCTAAGG + Intergenic
911165133 1:94718181-94718203 ATTGCTTAATGGCCCTCAAAAGG + Intergenic
911666860 1:100563282-100563304 ATTGGTTTATGGCCTTGCTATGG + Intergenic
915616069 1:157039368-157039390 CTGGGTGAATGACCTTGCAAAGG - Intronic
918570975 1:185991849-185991871 ATTGCTAAATTGCTTTCCAAAGG + Intronic
1067675408 10:48371037-48371059 ATTTGTGAGTGGCTTTCCAGAGG + Intronic
1070432146 10:76351548-76351570 ATTGGTGAATGGGAAACCAAAGG - Intronic
1070905229 10:80066226-80066248 ATTTGTGAATGGCATTTCCAAGG - Intergenic
1072822457 10:98571442-98571464 ATCGTTGAATGGGCTTCAAAGGG + Intronic
1073117626 10:101100591-101100613 AGTGGGGAATGGCCTTCAGAAGG - Intronic
1074411643 10:113233947-113233969 AATGGTGAATGGAGTTCCCAAGG + Intergenic
1076279552 10:129234213-129234235 ATTGCAGAATGGACTTGCAAAGG + Intergenic
1079357347 11:19740683-19740705 ATTGCTGACTGGGCTACCAAAGG - Intronic
1081163949 11:39785904-39785926 ATTGGTCTATGGGCTGCCAAGGG + Intergenic
1083053203 11:59795234-59795256 CTTGATGCATGGCCTTCCATAGG - Intronic
1084441654 11:69177891-69177913 CATGGTGAATGGGCTTCCACTGG + Intergenic
1085001769 11:73043940-73043962 ATTGGTGAATGGCCTTCCAAGGG - Intronic
1085971078 11:81591179-81591201 ATAGGTGAATGCCCTCCCTATGG - Intergenic
1086957202 11:92945714-92945736 ATTGTTGACTGGGCTCCCAAAGG - Intergenic
1087930393 11:103970880-103970902 ATTGTAGAATGGCCTCACAATGG + Intronic
1088674792 11:112181653-112181675 ATTGGTGAATGATCCTCCAGTGG - Intronic
1088967562 11:114739174-114739196 ATTGGTAAATGGTCTTCCTGTGG - Intergenic
1091757566 12:3064732-3064754 ATTAGTGAATTGCCTGCTAAAGG - Intergenic
1096007654 12:48185271-48185293 CTGGGTGAATGGGGTTCCAAGGG + Exonic
1096610702 12:52799450-52799472 TTTGATGAATCGCCTTCCATGGG - Intergenic
1098021068 12:66157108-66157130 AATGGTGTATATCCTTCCAAAGG - Intronic
1098200811 12:68053502-68053524 ATTGCTGTATGGCCGTACAATGG - Intergenic
1100364007 12:93902633-93902655 ATTGGTAAATGACCTTCCTCTGG - Intergenic
1104133599 12:125917356-125917378 ATTAGTGAGTGCCCTTCAAAAGG + Intergenic
1110406900 13:75160836-75160858 GTTGGGGATTGCCCTTCCAACGG + Intergenic
1112391002 13:98984130-98984152 ATGAGTGAAGGACCTTCCAATGG - Intronic
1114260678 14:21034036-21034058 ACTTCTGGATGGCCTTCCAAGGG + Exonic
1119488382 14:75008136-75008158 TTTGGTGAATTGACTCCCAAAGG + Intronic
1119851073 14:77867098-77867120 ATGGGAGAATGGCACTCCAAGGG - Intronic
1126089734 15:45040898-45040920 TTTGGTGACTGGCCTTCCTGGGG - Intronic
1127923519 15:63515047-63515069 ATTTGTGTCTGGTCTTCCAAAGG + Intronic
1128673583 15:69593107-69593129 ATTGGTCAATGGCTAGCCAATGG + Intergenic
1130185377 15:81676096-81676118 ATTGGTGAATGGTATTAAAAAGG + Intergenic
1135059690 16:19260641-19260663 CTTGGTCAAGGGCATTCCAAAGG - Intronic
1140588901 16:76327664-76327686 ATTGATGGATGGCCTTCCCCTGG + Intronic
1143366876 17:6414316-6414338 ACTGGGGAATGGCCCTCCCAGGG - Intronic
1148988903 17:51648235-51648257 CTTGGTGAAGGGCATGCCAAGGG + Intronic
1149360732 17:55892850-55892872 ATTGCAAAGTGGCCTTCCAAAGG + Intergenic
1150166651 17:62950387-62950409 ATAGGGAATTGGCCTTCCAATGG - Intergenic
1150814879 17:68385287-68385309 AGTGGTGAATGACCTTCCTGAGG - Intronic
1151264713 17:72945836-72945858 ATTGGAAAATGTCCATCCAAGGG + Intronic
1156804709 18:41164125-41164147 ATTGATGACTGTCTTTCCAACGG + Intergenic
1156966302 18:43097849-43097871 AGTGATGGATGGTCTTCCAAAGG - Intronic
1157614291 18:48977638-48977660 ATGGGGGAAAGGCCTTCCAGTGG - Intergenic
1158518591 18:58151264-58151286 ATTTGAGAATGGCTCTCCAAGGG + Intronic
1160374226 18:78399022-78399044 AGTGGTGAATGGGCTTCCTTTGG - Intergenic
1163268981 19:16238253-16238275 ATTGGTGCATGGACTTCTCAGGG - Intronic
1163848759 19:19651920-19651942 GATGCTGAATGGGCTTCCAAGGG + Intronic
1166032143 19:40139781-40139803 ACTGGAGAATGCCCTTCCAAGGG - Intergenic
928267169 2:29821704-29821726 ATTGGTGAAATGCATTCCAGAGG - Intronic
931503464 2:62897493-62897515 ATTGTCAAAAGGCCTTCCAAAGG + Intronic
931647171 2:64434732-64434754 ATTGCTGAATGGCTTTTCAAAGG - Intergenic
937260043 2:120579519-120579541 ATTGGTGGCTGGCCAGCCAAAGG + Intergenic
938437359 2:131292598-131292620 GATGCTGAATGGCCTACCAATGG - Intronic
939516266 2:143172118-143172140 ATTGCTGAATGGGCTTTCCATGG - Intronic
941745506 2:169082391-169082413 ATTGCAGAATGGACATCCAAAGG - Intronic
943894504 2:193337327-193337349 AATGGTGAAAGAGCTTCCAATGG - Intergenic
945182496 2:207106268-207106290 AATGGAGAATGGGCTGCCAAAGG + Intronic
1172869985 20:38129895-38129917 GGTGGTCAATGGCTTTCCAAAGG + Exonic
1173291631 20:41719987-41720009 GTTGGAGACAGGCCTTCCAAAGG + Intergenic
1174610794 20:51796892-51796914 AGTGGTTTGTGGCCTTCCAAAGG - Intronic
1176381411 21:6115306-6115328 ATTAGTGAATGAACTTCAAAGGG + Intronic
1179742061 21:43422933-43422955 ATTAGTGAATGAACTTCAAAGGG - Intronic
1181622034 22:24097923-24097945 AAGGGTGAATGCCCTTCCCAGGG - Intronic
1182089286 22:27583286-27583308 AGTGGTGTCTGGCCCTCCAATGG + Intergenic
1182951661 22:34381810-34381832 ACTGGTCAATGTCCTTCCATTGG - Intergenic
1184182296 22:42838043-42838065 AATGGTTTATGGCCTTCCAAAGG + Intronic
1184893929 22:47396228-47396250 CTTGGTGAAGGGCCTCCCACTGG - Intergenic
952107084 3:30083419-30083441 ATTGGTGAGTGCCCTCCAAATGG + Intergenic
956056210 3:65301333-65301355 ACTGGTGGCTGGCCATCCAAGGG - Intergenic
957000768 3:74881932-74881954 ATTATTTTATGGCCTTCCAATGG - Intergenic
959593712 3:108106085-108106107 ACAGATGAATGGCCTTCCTAGGG - Intergenic
959781747 3:110242154-110242176 ACTGGTAAATGGCCTTCAAAGGG + Intergenic
962877425 3:139546314-139546336 ATTGCTGAATTTCCTTCCATAGG + Intergenic
964701834 3:159576017-159576039 ATTACTGAATGAACTTCCAAAGG - Intronic
966595454 3:181721237-181721259 TTTATTGAATGCCCTTCCAATGG + Intergenic
971838756 4:31803882-31803904 AAAGGTGAAACGCCTTCCAATGG + Intergenic
974092374 4:57325052-57325074 ATCTGTGAATGAGCTTCCAACGG - Intergenic
974101062 4:57417589-57417611 AATGGTTTGTGGCCTTCCAAAGG - Intergenic
976578026 4:86699039-86699061 ATTGGGGATTGGCCTTCAACTGG + Intronic
979919175 4:126477401-126477423 ACTGGTATATGACCTTCCAAGGG - Intergenic
981749660 4:148081852-148081874 ATTGGTGAGGGGCCTTCCCAGGG + Intronic
982922572 4:161293878-161293900 ATTGGCAAACGGTCTTCCAAAGG + Intergenic
985215637 4:187650530-187650552 ATTGGTCAAGGACTTTCCAAAGG - Intergenic
988422695 5:31025540-31025562 AATGGTAAATGGACTTCCCAAGG + Intergenic
993822281 5:92633284-92633306 ATGTGTGACTGGCCTGCCAAGGG + Intergenic
997766450 5:136508542-136508564 AGTAGTGAATGGCATTCTAATGG + Intergenic
1000415074 5:160975855-160975877 AGTGGGGAAAGGCTTTCCAAAGG - Intergenic
1003025337 6:2550126-2550148 AATCATGCATGGCCTTCCAAAGG + Intergenic
1003681368 6:8260687-8260709 CTTGGTTAATTCCCTTCCAAAGG + Intergenic
1004202057 6:13558040-13558062 AATGCTGAATGGCTTGCCAAGGG - Intergenic
1005256867 6:24012581-24012603 AATGGAGAAGGGCCTTTCAAAGG - Intergenic
1009484680 6:64205779-64205801 ATTTGTGAAAGGCTTTCAAAGGG + Intronic
1011203858 6:84870009-84870031 ATTGCTGTATGGCCATACAATGG - Intergenic
1014790377 6:125665723-125665745 ATTTGAGAATGGCCTCCCAAGGG + Intergenic
1015143306 6:129958918-129958940 ATTGGTCCATGGGCATCCAAGGG - Intergenic
1021062413 7:16130519-16130541 ATTGAGGAATGGATTTCCAAAGG + Intronic
1021493176 7:21243178-21243200 ATTGGGGAATAACCTTTCAATGG + Intergenic
1022027208 7:26459709-26459731 CTTGATGAATGGCTTTACAATGG - Intergenic
1024445552 7:49473959-49473981 ATTGATGAATGAGATTCCAAAGG + Intergenic
1029349208 7:100001084-100001106 ATTTATGAATTGCCTTGCAATGG + Intergenic
1029924991 7:104305968-104305990 ATTGGTGTATAGCATTCCATTGG - Intergenic
1030676111 7:112387518-112387540 ATTGCTAAATTGCCCTCCAAAGG + Intergenic
1033331752 7:140422538-140422560 AATGGTTTATGGCCCTCCAAAGG + Intronic
1033485755 7:141787508-141787530 ATTACAGAATGGCCTTCCGAAGG - Intronic
1037412998 8:18617626-18617648 CTTGGTGAAGGGGATTCCAAAGG + Intronic
1038112033 8:24510683-24510705 ATTTTTAAATGGCCTTCCATAGG + Intronic
1041311718 8:56524138-56524160 AATGGTGAATAGCTTTCCACAGG + Intergenic
1043255931 8:78136660-78136682 ATGGTTAAATGGCCTTCTAAAGG - Intergenic
1049210869 8:141385896-141385918 AGTGGGGAGTGGCCTTCCACCGG - Intergenic
1052473542 9:28930020-28930042 AGTGATGAATGGCCATTCAAAGG - Intergenic
1055929764 9:81547991-81548013 ATTGGTATAGGGCCTTGCAAGGG - Intergenic
1061257752 9:129462489-129462511 GTTGGTGAGTCGCCTTCCATGGG - Intergenic
1188790615 X:34404417-34404439 AGTGGTGAATAGCCTCCCAGTGG + Intergenic
1193148503 X:78101936-78101958 ATTGCTTAATGCCGTTCCAAAGG - Intronic
1193464372 X:81829736-81829758 ATTGGAGAATAGTCTTCAAATGG - Intergenic
1193994164 X:88344513-88344535 ACTGGTGTATGGCCTTCCGGGGG - Intergenic
1195506920 X:105668509-105668531 ATTGTTGATTGGGCTCCCAAAGG - Intronic