ID: 1085004577

View in Genome Browser
Species Human (GRCh38)
Location 11:73074557-73074579
Sequence TCTCTTTATGTCCTACTTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 1, 2: 1, 3: 28, 4: 178}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085004577 Original CRISPR TCTCTTTATGTCCTACTTAA GGG (reversed) Intronic
907364948 1:53950320-53950342 TCTCCTTATGTCCTACTCTTTGG - Intronic
909168451 1:72259693-72259715 TCTCATTATATCCTTCTAAAGGG + Intronic
913718061 1:121559131-121559153 TCTCCTTATGGTTTACTTAATGG + Intergenic
914435968 1:147659525-147659547 TCTCTTTCTTCCCTACTTTAGGG - Exonic
916065204 1:161131289-161131311 TCTCATTGTGTGCTAGTTAAGGG - Intronic
918163914 1:181926274-181926296 TTTCTGTCTCTCCTACTTAAAGG + Intergenic
919279658 1:195472427-195472449 TCTTTTGATGTACTGCTTAACGG + Intergenic
920089954 1:203445378-203445400 GCTCTTTATTTCCTCCTTTAAGG + Intergenic
1064592575 10:16909474-16909496 TTTCTTTATGCATTACTTAATGG - Intronic
1064867671 10:19900062-19900084 TTTTTCTATGTCCCACTTAAAGG + Intronic
1065266265 10:23979455-23979477 CCTCTTCATGTCTTTCTTAAGGG + Intronic
1066485749 10:35842978-35843000 TGTCTTTCTTTCCTACATAATGG + Intergenic
1068001324 10:51337579-51337601 TCCCTTCATGTCCTTTTTAATGG - Intronic
1068270177 10:54713025-54713047 TCTCTTTATGCCATAGGTAATGG + Intronic
1068418349 10:56755956-56755978 TCTCTTTGTGTCCTATTTGGAGG + Intergenic
1068732183 10:60371611-60371633 TCTTTTTATGTCCTTCTTATGGG + Intronic
1072152509 10:92695147-92695169 TCTGTTTATCTCCCACTTAATGG + Exonic
1072298658 10:94037943-94037965 TCCCTAGATGTCCTACATAATGG + Intronic
1074398475 10:113120513-113120535 CCTCCTAATGTCCTACTCAATGG - Intronic
1078490222 11:11761483-11761505 TCTCTTTATATCAAACTTTAAGG - Intergenic
1081776795 11:45681282-45681304 ACTCTTTATGTGCTACCTAAAGG - Intergenic
1082756626 11:57083141-57083163 TCTCTTTCTGTCCATCTCAAAGG - Intergenic
1083533747 11:63449420-63449442 TGTCTTTTTGTCCTAATGAAAGG - Intergenic
1084286108 11:68132019-68132041 TCTCTCTCTCCCCTACTTAATGG - Intergenic
1085004577 11:73074557-73074579 TCTCTTTATGTCCTACTTAAGGG - Intronic
1087739398 11:101870409-101870431 TCACTTTAAGTCCTATATAATGG + Intronic
1087957339 11:104304574-104304596 TCTCTTTTTTTCCTGCTTTAAGG + Intergenic
1093265185 12:16995221-16995243 TTTCTTTATGTCAAACATAAAGG - Intergenic
1093334499 12:17886066-17886088 TCTGTTTACGTCAAACTTAAAGG - Intergenic
1095401150 12:41815742-41815764 TCTCTCTATGTCCTCCTTTTTGG + Intergenic
1098433901 12:70449114-70449136 CTTCTTTATGCCCTACTGAAGGG + Intergenic
1099203875 12:79706150-79706172 TTTCTTTAGTTCCTACCTAATGG + Intergenic
1099496653 12:83355573-83355595 TCTCTTTTTTTCCTATTTAATGG + Intergenic
1100730773 12:97465339-97465361 TCTGTTTGTGTGCTACTTAATGG + Intergenic
1104235073 12:126926597-126926619 TCTATCTTTGTCCTACTTATTGG + Intergenic
1106932777 13:34684773-34684795 TCTCTTTATATGCTCCTGAATGG + Intergenic
1107031292 13:35856459-35856481 CATCTTTATGTCATACGTAAAGG + Intronic
1107144532 13:37044341-37044363 CCTCCTAATGTCCTTCTTAAGGG + Intronic
1108587952 13:51887646-51887668 TCATTTTCTGGCCTACTTAAAGG + Intergenic
1109556226 13:63979339-63979361 TCTCTTTCTGTCCCATTTAATGG + Intergenic
1109688632 13:65855093-65855115 ACTCTTTATCTCCAACTGAATGG - Intergenic
1109941566 13:69374027-69374049 TCCCTTTATGTACAACTTCAAGG + Intergenic
1110799342 13:79676739-79676761 TGTCTTTATCTCCTACTTTTGGG + Intergenic
1110943819 13:81388246-81388268 TCTCTTTATGTTCTACTTAAAGG - Intergenic
1112420779 13:99246655-99246677 TCTTTTTATGTACTAGTTAATGG - Intronic
1113221589 13:108110091-108110113 TCTGTTTAATTCCTGCTTAAGGG + Intergenic
1114307277 14:21435354-21435376 TCACTTCATCTCCTTCTTAAAGG + Intronic
1114517889 14:23311820-23311842 TCTCTTCATGACCTTGTTAAAGG + Intronic
1114919485 14:27308653-27308675 TATCTTTCTCCCCTACTTAATGG - Intergenic
1116133062 14:40884101-40884123 TCATTTTATGACCTACTTAAGGG + Intergenic
1116594833 14:46827768-46827790 AGGCTTTATGTCCTACTTTAAGG + Intergenic
1117048309 14:51835255-51835277 TCTCTTCATCTCCTACTTTCTGG - Intronic
1117121851 14:52576549-52576571 TCTCTTTCAGTACAACTTAATGG - Intronic
1118673215 14:68153649-68153671 TCTATTCATGTCCTTTTTAATGG + Intronic
1119088186 14:71755562-71755584 TCTCTTTGTGTTCTAATTCATGG + Intergenic
1119247321 14:73122929-73122951 TCTCTTTAAAATCTACTTAAAGG - Exonic
1119248708 14:73134030-73134052 TTTCTTTATGTCCTACTGTTAGG - Intergenic
1119934646 14:78580462-78580484 TCTCTTCATCTCCAACTCAAGGG + Intronic
1121195932 14:92071923-92071945 TCTCTTTATTTCCCTCTTTATGG + Intronic
1126160971 15:45613087-45613109 TCTCTTTAATTCCTACTTACAGG - Intronic
1126277104 15:46896290-46896312 TCACTTTAAGTCCTTCTCAATGG + Intergenic
1130961885 15:88665225-88665247 TCTCTTTACATCCTCTTTAAAGG - Intergenic
1135173623 16:20208882-20208904 ATTCTGTATGTCCTACTGAAGGG + Intergenic
1139096033 16:63705500-63705522 TCTCTGTATGTTCTGCTTAAGGG - Intergenic
1141338760 16:83182854-83182876 TCTTTTTATCACATACTTAAAGG + Intronic
1141397095 16:83714851-83714873 TATCTTTAATTCCTAATTAACGG + Intronic
1143291318 17:5832279-5832301 TCTCTCTCTGTCTTACTTAATGG - Intronic
1145088773 17:19968455-19968477 TCTTTTTATGTTCTAGTGAAAGG - Exonic
1146698686 17:34933738-34933760 TCTCTTTAAGTACTGCTTTAGGG - Intronic
1146973075 17:37088318-37088340 CCTCTTTCTGAACTACTTAAGGG - Intronic
1149091563 17:52789238-52789260 TCTCTTTATGTACTCTTGAAGGG + Intergenic
1155719184 18:28989742-28989764 TGTCTTTCTGTCCTCCTTACAGG + Intergenic
1155821640 18:30385432-30385454 TATCTATATGTCCTATTTATTGG - Intergenic
1155830517 18:30510688-30510710 TCACTTCATGCCCTACTTTAAGG + Intergenic
1156206595 18:34892887-34892909 TATCTTTATGTCCTATATACGGG - Intergenic
1156973398 18:43185552-43185574 TTTCTTGCTGTGCTACTTAAAGG - Intergenic
1157378340 18:47187586-47187608 TCTCTTTATTTCTAATTTAATGG - Intergenic
1157547667 18:48557919-48557941 ACCCTTTATGACCTCCTTAAAGG + Intronic
1158216908 18:55110079-55110101 TCTCTCTGTGGCCTACTCAAAGG + Intergenic
1158329722 18:56348322-56348344 TCTCTTTCTCTCCTAATGAAGGG - Intergenic
1158650075 18:59276225-59276247 GCTCTTTATGTCCTGCACAAAGG - Intronic
1158701555 18:59753244-59753266 TAACTTTCTGTCCTCCTTAAGGG + Intergenic
1160305109 18:77725792-77725814 GCTGTTTATGTCCTAATTGAAGG + Intergenic
1164300439 19:23957237-23957259 CTTCTTTATGCCCTACTGAAGGG + Intergenic
1164976486 19:32576665-32576687 GGTCTTTTTGTCCTACTTTATGG - Intergenic
1167729100 19:51240238-51240260 TTTCTTTATGTCCTGCTACAGGG + Intronic
925836256 2:7950126-7950148 TCTTTTTTTTTTCTACTTAATGG + Intergenic
925939620 2:8804236-8804258 ACTCTTTATGTCATACTTTTTGG - Intronic
925961954 2:9026026-9026048 TCTATTTACTTTCTACTTAAAGG - Intergenic
929801466 2:45108024-45108046 TCTCTGAATTTCCTACTTGAAGG + Intergenic
930133382 2:47876186-47876208 TCTCTTTTTGTGCTACTTTTTGG + Intronic
930597837 2:53410064-53410086 TCTCTTTTTTCCCCACTTAATGG - Intergenic
932116830 2:69058426-69058448 TCTCTGTCTGTCCTATCTAAAGG + Intronic
932698068 2:73973489-73973511 TCTCTCAAAGACCTACTTAAAGG + Intergenic
933139699 2:78778539-78778561 TCTCTTTCAGTCCTACTAATTGG + Intergenic
937442225 2:121926299-121926321 CCACTTCATGTCCTACTGAAGGG - Intergenic
937698097 2:124831393-124831415 TATCTTTCTTTCCTACTTACTGG + Intronic
937887098 2:126907416-126907438 TCTTTTTATCTCCAACTTAATGG + Intergenic
941159654 2:162022014-162022036 TCACTTTATTTCCCTCTTAAAGG + Intronic
942849508 2:180467220-180467242 TCTTTTTATGGTCTACTGAATGG - Intergenic
943784187 2:191858958-191858980 TATCTTTATGTCCTCCTAACAGG + Intergenic
944183343 2:196920928-196920950 TCTCTTAATGTCATCCTCAAAGG + Intronic
944220367 2:197298013-197298035 TCTTTCTATATCCTTCTTAACGG - Intronic
944733582 2:202539007-202539029 TCTTTTTATGTTCCAGTTAAAGG - Intronic
945015879 2:205515620-205515642 TCTATTCATGTCCTTTTTAATGG + Intronic
1170800282 20:19584730-19584752 CCTCTCAATGTCCTCCTTAAGGG - Intronic
1176926364 21:14754163-14754185 TCTCTTTATGGGCTACTTAGTGG + Intergenic
1177394484 21:20514531-20514553 TGACTTTATCTCCAACTTAAGGG - Intergenic
1177533870 21:22399022-22399044 TATCTTTCTCCCCTACTTAATGG - Intergenic
1177580703 21:23018817-23018839 CCTCATGAAGTCCTACTTAATGG - Intergenic
1180244504 21:46538004-46538026 TCTCTGTCTGTCCTACTTTATGG + Intronic
1181279934 22:21712338-21712360 TCTCTATATATCCTAGTTATTGG + Intronic
949580716 3:5384801-5384823 TGTCTTTCTGTTCTACTTATTGG + Intergenic
949691343 3:6643452-6643474 GCACTTTATGTCCAGCTTAACGG - Intergenic
951043257 3:18011484-18011506 TCTCTCTATTTCCTGCATAAAGG + Intronic
951494840 3:23315054-23315076 TCTCTTTACCTCCTCTTTAAGGG + Intronic
952733620 3:36665962-36665984 TCTCTATATGTAAGACTTAAAGG + Intergenic
952828288 3:37542180-37542202 TCTCCTTGTGTCATACTTCACGG - Intronic
953362890 3:42314787-42314809 TCTCTCTCTCTCCTACTTACTGG + Intergenic
954060897 3:48066335-48066357 TCTCTTTAACTTCTACTTGATGG + Intronic
958256822 3:91333993-91334015 ACTCTTTATCTCTCACTTAATGG + Intergenic
958909633 3:99979294-99979316 TCTCTTTATGGCCTTCTTTTGGG + Intronic
961352523 3:126313067-126313089 TCACTTTATGGCCTGTTTAAAGG - Intergenic
962292743 3:134150459-134150481 TGTCCTTATGTCCCTCTTAAAGG - Intronic
963742094 3:149090708-149090730 TCTCTCTAAGACCCACTTAAGGG - Intergenic
963960215 3:151301466-151301488 TCTCTCTATGTCCTGCTTATTGG - Intronic
964308250 3:155363249-155363271 TCTCTTAATGGCCTGCTTGATGG - Intergenic
964509315 3:157433215-157433237 TGTCCTTATGTCCTACTTTATGG + Intronic
965109815 3:164406498-164406520 CCACTTCATTTCCTACTTAAAGG + Intergenic
965374166 3:167901295-167901317 TTTCCTTGTGTCCTACTTTAAGG + Intergenic
965824121 3:172713566-172713588 TCTCTTAGTGTACTGCTTAAGGG - Intergenic
970335486 4:15036048-15036070 TCTCTTTATTTCTTACTTAAAGG - Intronic
970466671 4:16330425-16330447 TCATTTTATTTTCTACTTAAAGG + Intergenic
970674807 4:18436852-18436874 TCACTTAATCTCCTACTAAAAGG - Intergenic
971100997 4:23466296-23466318 TCTGTGTATGACCTACTTTATGG + Intergenic
971239628 4:24876475-24876497 TCTCTTTATATCTTAATTCAGGG + Intronic
972657317 4:41076968-41076990 TATCTTTTTGTTCTACTTTAGGG - Intronic
974874401 4:67685627-67685649 TCCCATTAGGTCCTACGTAACGG - Intronic
975198592 4:71556778-71556800 TCTAGTGATTTCCTACTTAAAGG - Intronic
976103974 4:81596788-81596810 TCATTTTATGTCCTCCTTTAAGG - Intronic
977333081 4:95662519-95662541 TCTCTTTATGTCCTCCCACATGG + Intergenic
977919258 4:102625527-102625549 TCTCTTTATTTCCTTCTTTAAGG + Intergenic
979250672 4:118563921-118563943 TCTCTTCCTGTTCTGCTTAATGG + Intergenic
980830288 4:138123311-138123333 TCTCTTTCTGTCTTTCTTAGTGG + Intergenic
981772460 4:148325863-148325885 TGTGTGTATCTCCTACTTAATGG - Intronic
982680907 4:158428321-158428343 TCTCATTATGTTTTATTTAAGGG - Intronic
983103422 4:163654917-163654939 TCTTTTTATGTACTTCTTACTGG + Intronic
985328897 4:188804833-188804855 TTTCTTTTTTTCCTCCTTAAAGG - Intergenic
986163944 5:5257191-5257213 TTTCTTTATGTATTACTTAAGGG - Intronic
991272214 5:64797284-64797306 TTTCTTAATGACCTACTTTAAGG - Intronic
994984665 5:106917611-106917633 TCTCTGTATGTCAGACTTAATGG - Intergenic
997860914 5:137415073-137415095 TATTTCTAAGTCCTACTTAAAGG + Intronic
999352675 5:150890606-150890628 TCTCTTTAAGAACTACTTTACGG + Intronic
999466185 5:151807904-151807926 TTTCTTTTTGTGCTACTTAAAGG + Exonic
1000512244 5:162197851-162197873 TCTCTTTATATCCTATTATATGG - Intergenic
1000579666 5:163020118-163020140 TCACTTTATATCCTATTTCAAGG - Intergenic
1000677172 5:164136091-164136113 TCTCTTTATGTCTTTTTTTATGG - Intergenic
1000853265 5:166366934-166366956 TGTCTTTGTGTCCTACACAAAGG + Intergenic
1001208871 5:169791531-169791553 TCTATTTAAGGCCAACTTAAGGG + Intronic
1004164642 6:13245480-13245502 TCTGTTCATGTCCTTTTTAATGG + Intronic
1004678711 6:17870878-17870900 TCACTTTATGTGCTGATTAATGG - Intronic
1004966206 6:20854538-20854560 TCTCTTTCTGTCCTCCTTACTGG - Intronic
1005405402 6:25482075-25482097 TTTCTTTCTGTCCTACCTACAGG - Intronic
1008914091 6:56767948-56767970 TCTCTTTATTTCATACCTAATGG - Intronic
1010267152 6:73879902-73879924 TCTGTTTTTGTATTACTTAAAGG + Intergenic
1010571790 6:77482340-77482362 TCTCTTTATGTCCTATGAAGAGG + Intergenic
1011385168 6:86788662-86788684 TTCTTTTATGTCCTACTTCAGGG + Intergenic
1012846882 6:104401164-104401186 CCTCTTTATGTCTCCCTTAATGG + Intergenic
1014022943 6:116611569-116611591 CCTCTCTATGTGCTACTTAGAGG - Intergenic
1014424190 6:121283910-121283932 TCTCTTTATTTTCTTTTTAAAGG - Exonic
1016216447 6:141609136-141609158 TTTCTTTCTGTCCTTCTGAATGG - Intergenic
1016467195 6:144337338-144337360 TCTCTTTACCTCCTCATTAAGGG + Intronic
1016847444 6:148582398-148582420 TCTGTTTATGTCCTTTTTAATGG + Intergenic
1017612227 6:156200588-156200610 TCTTTTTATGTCCTCCTTTTAGG - Intergenic
1018282094 6:162198062-162198084 TCTCTTCATTTCCTACCTGAGGG - Intronic
1020721546 7:11751377-11751399 CTTCTTTATGCCCTACTGAATGG + Intronic
1020841625 7:13225015-13225037 CCTCTTTGTGTCTTCCTTAAAGG - Intergenic
1021235187 7:18134746-18134768 TCTCTTTATTTGCTACATTAGGG + Intronic
1021531046 7:21645576-21645598 TCTGTATATATCCTCCTTAATGG - Intronic
1022230388 7:28408362-28408384 TCTCTTTGAATCCTACTCAAAGG + Intronic
1022683829 7:32576181-32576203 CCTTTTTATGACCTACTTAAGGG - Intronic
1023682528 7:42702179-42702201 TAGCTTTATGGCCTACTTATTGG - Intergenic
1024734063 7:52284600-52284622 TGTATTAATTTCCTACTTAATGG - Intergenic
1029861673 7:103579183-103579205 CTTCTCTATGTCCTTCTTAATGG - Intronic
1031041047 7:116838777-116838799 TCTCCCTATGTCCTAGATAAAGG + Intronic
1031554092 7:123150193-123150215 TCTCTATACGTCCCTCTTAATGG + Intronic
1034016371 7:147591428-147591450 TAGCTTTATGTCCTCTTTAAAGG + Intronic
1036049731 8:5183202-5183224 TCCTTTTATGTCCTGCTTCAGGG - Intergenic
1038218773 8:25587775-25587797 TCTCTTTATTGCCCACTGAAGGG - Intergenic
1038356750 8:26836331-26836353 TCTGTTTATGTCTCAGTTAATGG + Intronic
1038973277 8:32662171-32662193 TCTGTTTATGTATTTCTTAAGGG - Intronic
1039582195 8:38675908-38675930 TCTCTTTTTGTTCTACTTTCTGG - Intergenic
1039913289 8:41841792-41841814 TCTCTCTATTTCCTCCTCAAAGG + Intronic
1043302320 8:78749461-78749483 TCTCTTTCTCTCCAACTTTAGGG - Intronic
1047844483 8:128791145-128791167 TTTTTTTAAATCCTACTTAAGGG + Intergenic
1050716130 9:8528450-8528472 TCTCTTTCTCTGTTACTTAATGG - Intronic
1055178688 9:73354678-73354700 CCTCTTTATTTCCTACTTTATGG + Intergenic
1057772488 9:97981406-97981428 TCTCTTTATGGCCAACTGGAGGG - Intergenic
1059409394 9:114122663-114122685 TCTCTTTCTGTCATACACAAGGG - Intergenic
1061463003 9:130755221-130755243 TCTTCTCATGTCCTACTTAAGGG - Intronic
1188284626 X:28312789-28312811 TCTCTTTTTTTCCGAGTTAAAGG - Intergenic
1190799733 X:53776510-53776532 TTTCTTTATATCCTACTAATAGG + Intergenic
1193903887 X:87219231-87219253 TCTGTTTATTTCCTACTTCATGG - Intergenic
1194532672 X:95070449-95070471 TCTCTTTATTTCCTCTTTAAGGG - Intergenic
1197243313 X:124143386-124143408 CATCTTTCTCTCCTACTTAATGG + Intronic
1197591613 X:128417452-128417474 TCTCTGTATGTCAGACATAATGG + Intergenic
1197634798 X:128902873-128902895 CCTCTTTATGTTCAAATTAAGGG + Intergenic
1198977324 X:142351417-142351439 TCTTTTTGTGTCCTACTGAGAGG + Intergenic
1199045980 X:143173514-143173536 TTTCTTTCTTTCATACTTAATGG - Intergenic