ID: 1085009637

View in Genome Browser
Species Human (GRCh38)
Location 11:73129371-73129393
Sequence CTGTAAGTATGGACGAAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 77}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085009637 Original CRISPR CTGTAAGTATGGACGAAGCT TGG (reversed) Intronic
900896061 1:5483756-5483778 ATGTAAGTAAGGACCAAGGTAGG - Intergenic
905780888 1:40708151-40708173 TTTAAAGTATGGAGGAAGCTGGG + Intronic
911033856 1:93517693-93517715 CAGTAAGGATGAACTAAGCTAGG - Intronic
913023445 1:114810200-114810222 CTGGAGATATGGACGGAGCTGGG + Intergenic
913445628 1:118947710-118947732 CTGCAAGTATGGATTAAGCATGG - Intronic
920836823 1:209518853-209518875 CTGAAAGTATAGAAGCAGCTTGG + Intergenic
1064659885 10:17596135-17596157 TTGTCAGTATTGAAGAAGCTTGG + Intronic
1065172848 10:23049218-23049240 CTGTAATTATGTACGAGTCTAGG - Intergenic
1069270711 10:66523940-66523962 CTGTAGGTAAGGACCAACCTGGG - Intronic
1074540220 10:114358980-114359002 CTGTATGTATATACGAATCTAGG - Intronic
1074707110 10:116143133-116143155 TTTTAAGTAGGGACAAAGCTGGG - Intronic
1078776159 11:14395372-14395394 CTCTAAGAATGGGCAAAGCTAGG - Intergenic
1079978928 11:27128533-27128555 CAGTGACTATGGAGGAAGCTGGG - Intergenic
1082037164 11:47654298-47654320 CTTTAAATATGGAAGAAGCCTGG + Intergenic
1082875027 11:57979167-57979189 CTGTAAGTAAGGAAGAAGTGGGG + Intergenic
1083061449 11:59877028-59877050 CTGGAAATATGGACGGAGCTTGG - Intergenic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1085009637 11:73129371-73129393 CTGTAAGTATGGACGAAGCTTGG - Intronic
1086167976 11:83801531-83801553 CTGTAAGACTGGAGGAAACTTGG - Intronic
1090475328 11:127015006-127015028 CTGTTAGTAAGGATGAAGCTGGG - Intergenic
1106446110 13:29832816-29832838 CTGTAAGTATAGAACATGCTGGG - Intronic
1108943614 13:55991464-55991486 CTGTTAGTATATACCAAGCTTGG - Intergenic
1116455009 14:45109946-45109968 CTGTAAGGAAGGACGAAGAGAGG - Intronic
1125135183 15:36333047-36333069 CTGTAAATATAGATGAAACTTGG - Intergenic
1125330587 15:38578356-38578378 CTGCAAGTATGGATCAAGATTGG + Intergenic
1128447884 15:67780837-67780859 CTGGATGTATGGACAGAGCTAGG + Intronic
1130566227 15:84998231-84998253 CTGCAAGTATTGGTGAAGCTGGG + Intronic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1137290654 16:47049948-47049970 CTGTAAGTCAGGACTCAGCTGGG + Intergenic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1141632619 16:85296761-85296783 CTGTAAGAATGGAAGGAGTTAGG - Intergenic
1146713628 17:35064711-35064733 CTTAAAGGATGAACGAAGCTGGG - Intronic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1151512160 17:74567451-74567473 GTGAGAGTATGGAGGAAGCTGGG + Intergenic
1154203549 18:12317954-12317976 CTATAAATATTGAGGAAGCTGGG + Intronic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1162285450 19:9735557-9735579 CTGTAAGGCAGGACGACGCTGGG + Intergenic
925030522 2:647238-647260 CTGTAGGTCTGGACGGGGCTGGG + Intergenic
928200410 2:29244352-29244374 GTGTGAGTGTGGACGGAGCTTGG + Intronic
932481707 2:72043771-72043793 CTATAAGTATTGAGCAAGCTAGG - Intergenic
935628458 2:105191383-105191405 CTCTAATTATGGAAGAATCTGGG + Intergenic
946737004 2:222764038-222764060 CTGTATGTATGGACTCAGCATGG - Intergenic
1169055260 20:2615590-2615612 CTGAAAATATGAACCAAGCTGGG + Intronic
1173201275 20:40957053-40957075 CTCTAAGTATGGACGATGGGGGG + Intergenic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1183701934 22:39456071-39456093 CAGCAAGGATGGATGAAGCTGGG + Intergenic
966560239 3:181311384-181311406 CTCTGAGGATGGACTAAGCTTGG + Intergenic
966936854 3:184716259-184716281 CTGTAAGGATGGGCAAAGCAAGG - Intergenic
972111745 4:35570322-35570344 CTGTAAGTAGGGAGGGAGTTGGG - Intergenic
973931546 4:55797840-55797862 CTGAAAGTAGGGACAAAACTAGG + Intergenic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
979009246 4:115345719-115345741 CTATAAGCATGGTTGAAGCTGGG + Intergenic
988150260 5:27368270-27368292 CTGTAAATACGGAGGGAGCTTGG + Intergenic
989153354 5:38321345-38321367 CTGTAAATACAGACGAAGCTTGG + Intronic
993100294 5:83530284-83530306 CTATAAATATGCAAGAAGCTAGG - Intronic
994207389 5:97050640-97050662 CTGTATTTAAGGAGGAAGCTGGG + Intergenic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
1000195142 5:158949897-158949919 CTGGAAGTATGGATTGAGCTAGG - Intronic
1001724457 5:173885392-173885414 CTGGAAGTATGGAAGAAGGAAGG - Intergenic
1002948141 6:1782129-1782151 CTGTGAGTCTGGACTAAACTGGG - Intronic
1005639180 6:27778524-27778546 CTGTAAGTATGGAAGGAGGAGGG - Intergenic
1006870613 6:37247770-37247792 CTGTAAGTGTTGAAGGAGCTTGG + Intronic
1008441117 6:51532719-51532741 CTGGAAGTATGGAAGAAGGGAGG - Intergenic
1016081127 6:139857959-139857981 CAGAAAGTAAGGACAAAGCTAGG + Intergenic
1019632068 7:2054798-2054820 CTTTAAGTATGAACAAAGCAAGG + Intronic
1020668382 7:11074910-11074932 CTGAAAATATGGAAGCAGCTTGG - Intronic
1021052526 7:16006013-16006035 TTGTAAGTTGGGACGAAACTTGG - Intergenic
1024932767 7:54680910-54680932 CTATTACTATGGAAGAAGCTTGG + Intergenic
1027435934 7:78164337-78164359 ATGTATGTATGGACAGAGCTTGG + Intronic
1037220490 8:16513434-16513456 CTGTATGTATGGAAGAGACTAGG - Intronic
1038657330 8:29465761-29465783 CTGTAAATATAGATGAAGCTTGG - Intergenic
1047099281 8:121658272-121658294 CTGTAAGTATGGTGATAGCTTGG + Intergenic
1050450552 9:5776855-5776877 ATGTAAGTATAGAGGAACCTAGG + Intronic
1058488481 9:105467870-105467892 CTGAAGGTCTGGACGAAGTTGGG + Intronic
1060389507 9:123267261-123267283 CAGGAAGTATGGAAGAAGGTGGG - Intronic
1061128553 9:128692041-128692063 TTGTTAGAATGGAGGAAGCTTGG + Intronic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1187724760 X:22190896-22190918 CTGTATGTAAGAAAGAAGCTTGG + Intronic
1188242124 X:27806103-27806125 GTGTGAGTATAGACGAAGCCAGG + Intergenic
1190048932 X:47134786-47134808 CATTTAGTATGGAGGAAGCTGGG + Intergenic
1192587834 X:72333872-72333894 CTGTAAGTATAGCCAGAGCTAGG + Intronic