ID: 1085010506

View in Genome Browser
Species Human (GRCh38)
Location 11:73137784-73137806
Sequence ACGTCCCGAGTGACCAGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 87}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085010506 Original CRISPR ACGTCCCGAGTGACCAGAGC AGG Intronic
901101710 1:6724213-6724235 ACGTCCCACGTGACTGGAGCAGG + Intergenic
901987766 1:13089755-13089777 GCTTCTGGAGTGACCAGAGCAGG - Intergenic
901994046 1:13137012-13137034 GCTTCTGGAGTGACCAGAGCAGG + Intergenic
903384493 1:22917506-22917528 ACATCCCTAGTGACAGGAGCAGG - Intergenic
904470315 1:30731973-30731995 TCTTCCCCAGTGTCCAGAGCAGG + Intergenic
905061419 1:35142874-35142896 GCCTCCGGAGTGACCAGAGCAGG + Intergenic
909724649 1:78819659-78819681 ACGTCCCATATGGCCAGAGCAGG - Intergenic
912547079 1:110458486-110458508 AGGTCCCAAGTCACCACAGCAGG - Intergenic
915938717 1:160104714-160104736 ACATGCCGAGTGACAAGAGAAGG + Intergenic
923095578 1:230772885-230772907 ACTTCCCAAGGGACCAGAGCTGG - Intronic
1067133240 10:43585268-43585290 GCTTCCGGAGTGACCACAGCAGG + Intergenic
1069559026 10:69416684-69416706 ACTTCCTGAGTGACCTGGGCTGG - Exonic
1074143889 10:110699977-110699999 ACGTCCCGGGTGGACAGAGCAGG + Intronic
1076669635 10:132112349-132112371 ACGAGCCGAGTGCCCAGGGCAGG - Intronic
1082960992 11:58918766-58918788 GCTTCCAGAGTGACTAGAGCAGG + Intronic
1084390363 11:68871674-68871696 GCCTCCAGAGTGACTAGAGCAGG - Intergenic
1084430241 11:69106856-69106878 ACCTGCTGAGTGACCAGGGCAGG + Intergenic
1085010506 11:73137784-73137806 ACGTCCCGAGTGACCAGAGCAGG + Intronic
1085572868 11:77574348-77574370 GCCTCCGGAGTGACCAGAACAGG - Intronic
1090306600 11:125696648-125696670 ACGTGCTGAGTGGGCAGAGCAGG - Intergenic
1106914720 13:34500135-34500157 ACAGCAGGAGTGACCAGAGCTGG - Intergenic
1107955673 13:45508845-45508867 AATTCCCAGGTGACCAGAGCGGG - Intronic
1108196236 13:47998442-47998464 ATGTCTAGAGTGTCCAGAGCAGG + Intronic
1112008905 13:95277680-95277702 AAGCCCCCAGTGACAAGAGCAGG + Intronic
1112367496 13:98767831-98767853 GCTTCCAGAGTGACCAGAGCAGG - Intergenic
1114574136 14:23696994-23697016 GCCTCTGGAGTGACCAGAGCAGG - Intergenic
1118951388 14:70439439-70439461 GCTTCTGGAGTGACCAGAGCAGG + Intergenic
1125400747 15:39300073-39300095 ATGTCCCATGTGACCCGAGCAGG - Intergenic
1128061963 15:64740982-64741004 ACCTCCCCGGTGACCAGACCTGG + Exonic
1128600652 15:68992877-68992899 GCTTTCGGAGTGACCAGAGCAGG + Intronic
1128976239 15:72155876-72155898 GCCTTCCGAGTGGCCAGAGCTGG + Intergenic
1129714189 15:77837410-77837432 GAGTCCAGTGTGACCAGAGCTGG - Intergenic
1134809532 16:17155536-17155558 CCCTCCCAAGTGACCAGAGCTGG - Intronic
1139473197 16:67189160-67189182 AGGACCTGAGTGGCCAGAGCAGG - Exonic
1141259488 16:82439840-82439862 ACCCCCCTAGTGCCCAGAGCTGG - Intergenic
1148446253 17:47739368-47739390 GCCTCCCGAGTCACCCGAGCGGG - Intronic
1151363146 17:73600536-73600558 AGGGGCTGAGTGACCAGAGCAGG - Intronic
1152672104 17:81614780-81614802 GGGTCCCAAGTGACCAGAGATGG + Intronic
1157093354 18:44662165-44662187 ACTTCCCTAGTAACCAGAGTAGG + Intergenic
1160331278 18:77993962-77993984 AGGTCTAGAGTGACCAGAGAAGG + Intergenic
1160408858 18:78661160-78661182 ACGTCGCGGGTGACGAGAGAAGG + Intergenic
1160464987 18:79069123-79069145 ACGTCACGAGTGGCTAAAGCTGG - Intergenic
1163236098 19:16031531-16031553 AGGTCCCCACTGACCAGACCAGG - Intergenic
1163953795 19:20615196-20615218 GCCTCTGGAGTGACCAGAGCAGG - Intronic
1164033596 19:21433819-21433841 GCTTCCAGAATGACCAGAGCAGG + Intronic
1164142573 19:22486311-22486333 GCTTCCGAAGTGACCAGAGCAGG + Intronic
1164148598 19:22529186-22529208 GCCTCCGGAGTGACCAGGGCAGG - Intronic
1165279261 19:34782705-34782727 TCTTCCCTAGTGACCTGAGCTGG - Intergenic
1166745743 19:45141067-45141089 ACGTGCTGAGTGACCAGGACAGG - Intronic
1167999802 19:53436020-53436042 GCCTCCAGAGTGACCAGAGCAGG + Intronic
1168004236 19:53473397-53473419 GCCTCCAGAGTGACCAGAGCAGG + Intronic
925429210 2:3776446-3776468 AGGTCCCGTGTGACGAGAACTGG - Intronic
926231848 2:11010324-11010346 ACATCCTGAGAGACCAGAGGGGG + Intergenic
931756409 2:65378590-65378612 ACCTCACTAGTGACCAGAACAGG + Intronic
933978769 2:87533607-87533629 ACAGCCAGAGTGACCAGAACTGG + Intergenic
936142377 2:109951435-109951457 ACGTCCCAGGTGGACAGAGCAGG - Intergenic
936179067 2:110249394-110249416 ACGTCCCAGGTGGACAGAGCAGG - Intergenic
936202311 2:110420038-110420060 ACGTCCCAGGTGGACAGAGCAGG + Intronic
936315061 2:111417199-111417221 ACAGCCAGAGTGACCAGAACTGG - Intergenic
947418663 2:229922306-229922328 AGGTCCCGGGTGACCCGAGGGGG - Intronic
1171951019 20:31422389-31422411 ACTTTCTCAGTGACCAGAGCTGG - Intergenic
1172883638 20:38217372-38217394 ACGTGCAGAGTTCCCAGAGCTGG - Exonic
1175986174 20:62765140-62765162 ACCTCCAGAGTGACAGGAGCGGG - Intergenic
1176121624 20:63456725-63456747 ACGTGCGGATTGGCCAGAGCTGG + Intronic
1178140737 21:29680686-29680708 ACGTCCCATGTGGACAGAGCAGG - Intronic
1179086823 21:38225723-38225745 GCTTCTGGAGTGACCAGAGCAGG + Intronic
1183616714 22:38950231-38950253 TCGTCCAGGGTGACCAGGGCCGG - Intergenic
949887390 3:8707068-8707090 AAGGCCCCAGAGACCAGAGCAGG - Intronic
961438031 3:126932742-126932764 ATGTGCCCAGTGACCAGATCGGG + Intronic
966887875 3:184386728-184386750 AGGTGCAGAGTGAGCAGAGCGGG - Exonic
969647242 4:8438909-8438931 GCCTCCGGAGTGACCAGAGCAGG - Intronic
971297326 4:25408360-25408382 ACTTCCCAAATGACCAAAGCAGG - Intronic
972859491 4:43150064-43150086 ACGTCTCACATGACCAGAGCAGG + Intergenic
979058031 4:116018946-116018968 GCTTCCAGAGTTACCAGAGCAGG - Intergenic
997354421 5:133253295-133253317 AGGCCCCGAGTGAGCAGGGCAGG + Intronic
998407800 5:141883642-141883664 AGCTCCCGAGCCACCAGAGCTGG - Intergenic
999028978 5:148268842-148268864 ACATCCAAAGTGACAAGAGCAGG + Exonic
1002311124 5:178314432-178314454 ACCACCCCAGTGACCAGAGCTGG + Intronic
1004174454 6:13327892-13327914 ACGTCCCCAGTGAGCAGGGGAGG + Intronic
1004503311 6:16227755-16227777 GCCTCCGGAGTGAGCAGAGCAGG + Intergenic
1006037773 6:31227315-31227337 GCCTCTGGAGTGACCAGAGCAGG + Intergenic
1008583346 6:52926068-52926090 GCCTCCAGAGTGACCAGAGCAGG - Intergenic
1011299977 6:85863760-85863782 GCCTCCGGAGTGACCAGAGCAGG + Intergenic
1018855386 6:167670666-167670688 ACGTCCCCAGTGACCACAGGAGG - Intergenic
1025823542 7:64993250-64993272 GCTTCCGGAGTGACCAGAGCAGG + Exonic
1026827408 7:73593286-73593308 AGGGCCAGAGTGACCACAGCAGG - Exonic
1033365065 7:140666710-140666732 GCTTCCGGAGTGACCAGAGCAGG - Intronic
1033899166 7:146115681-146115703 ACATCCCGACTGACTGGAGCAGG - Intergenic
1034275624 7:149822598-149822620 GCGTCCCGAGGGGCCAGGGCAGG + Intergenic
1035436966 7:158866503-158866525 AGGACACGAGTGACCAGAGAGGG - Intronic
1041008753 8:53521221-53521243 GCCTCCAGAGTAACCAGAGCAGG + Intergenic
1041527368 8:58822483-58822505 ACAGCAGGAGTGACCAGAGCCGG + Intronic
1047459659 8:125050543-125050565 AGGTACCCAGTGACCAGAGTGGG - Exonic
1048208070 8:132431444-132431466 ACCTCCCTAGAGACCAGAGCTGG - Intronic
1057800896 9:98191224-98191246 AGGTCCGGAGTGAGGAGAGCCGG - Intronic
1061794602 9:133078649-133078671 GCCTCACGAGTGACCAGAGCAGG + Intronic
1062547730 9:137071109-137071131 CTGTCCCGAGGGACCAGAGGAGG - Intergenic
1062595968 9:137299415-137299437 ACCTCCAGCGTGCCCAGAGCTGG - Intergenic
1062690402 9:137838454-137838476 TCGGCCCGAGTGAACACAGCGGG - Intronic
1194090813 X:89580751-89580773 GCTTCCGGACTGACCAGAGCAGG + Intergenic
1198469416 X:136932367-136932389 GCCTCTGGAGTGACCAGAGCAGG + Intergenic
1198793937 X:140375950-140375972 ACGTCTTATGTGACCAGAGCAGG + Intergenic
1200443465 Y:3236811-3236833 GCTTCCGGACTGACCAGAGCAGG + Intergenic
1202047616 Y:20750426-20750448 ACGTCCCCAGTGCCTAGAACAGG - Intergenic