ID: 1085010921

View in Genome Browser
Species Human (GRCh38)
Location 11:73141536-73141558
Sequence GCATTCTCGGGGCTGCACCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 76}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085010921_1085010926 -10 Left 1085010921 11:73141536-73141558 CCTCGGTGCAGCCCCGAGAATGC 0: 1
1: 0
2: 1
3: 2
4: 76
Right 1085010926 11:73141549-73141571 CCGAGAATGCACTTTGCAGCGGG 0: 1
1: 0
2: 1
3: 6
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085010921 Original CRISPR GCATTCTCGGGGCTGCACCG AGG (reversed) Intronic