ID: 1085010921 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:73141536-73141558 |
| Sequence | GCATTCTCGGGGCTGCACCG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 80 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 2, 4: 76} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1085010921_1085010926 | -10 | Left | 1085010921 | 11:73141536-73141558 | CCTCGGTGCAGCCCCGAGAATGC | 0: 1 1: 0 2: 1 3: 2 4: 76 |
||
| Right | 1085010926 | 11:73141549-73141571 | CCGAGAATGCACTTTGCAGCGGG | 0: 1 1: 0 2: 1 3: 6 4: 75 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1085010921 | Original CRISPR | GCATTCTCGGGGCTGCACCG AGG (reversed) | Intronic | ||