ID: 1085011011

View in Genome Browser
Species Human (GRCh38)
Location 11:73141920-73141942
Sequence AAGGACCAGGAGGAGGAGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4494
Summary {0: 1, 1: 2, 2: 101, 3: 931, 4: 3459}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085011002_1085011011 -4 Left 1085011002 11:73141901-73141923 CCCCGACGGCAGCGTTAGCAAGG 0: 1
1: 0
2: 0
3: 2
4: 15
Right 1085011011 11:73141920-73141942 AAGGACCAGGAGGAGGAGGAGGG 0: 1
1: 2
2: 101
3: 931
4: 3459
1085011001_1085011011 -1 Left 1085011001 11:73141898-73141920 CCTCCCCGACGGCAGCGTTAGCA 0: 1
1: 0
2: 0
3: 2
4: 28
Right 1085011011 11:73141920-73141942 AAGGACCAGGAGGAGGAGGAGGG 0: 1
1: 2
2: 101
3: 931
4: 3459
1085011004_1085011011 -5 Left 1085011004 11:73141902-73141924 CCCGACGGCAGCGTTAGCAAGGA 0: 1
1: 0
2: 0
3: 3
4: 46
Right 1085011011 11:73141920-73141942 AAGGACCAGGAGGAGGAGGAGGG 0: 1
1: 2
2: 101
3: 931
4: 3459
1085011005_1085011011 -6 Left 1085011005 11:73141903-73141925 CCGACGGCAGCGTTAGCAAGGAC 0: 1
1: 0
2: 0
3: 2
4: 64
Right 1085011011 11:73141920-73141942 AAGGACCAGGAGGAGGAGGAGGG 0: 1
1: 2
2: 101
3: 931
4: 3459

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085011011 Original CRISPR AAGGACCAGGAGGAGGAGGA GGG Exonic
Too many off-targets to display for this crispr