ID: 1085011013

View in Genome Browser
Species Human (GRCh38)
Location 11:73141925-73141947
Sequence TCCGGCCCTCCTCCTCCTCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 758
Summary {0: 1, 1: 0, 2: 7, 3: 71, 4: 679}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085011013_1085011018 -10 Left 1085011013 11:73141925-73141947 CCAGGAGGAGGAGGAGGGCCGGA 0: 1
1: 0
2: 7
3: 71
4: 679
Right 1085011018 11:73141938-73141960 GAGGGCCGGAGAGGAGGGGACGG 0: 1
1: 0
2: 26
3: 489
4: 2851
1085011013_1085011022 18 Left 1085011013 11:73141925-73141947 CCAGGAGGAGGAGGAGGGCCGGA 0: 1
1: 0
2: 7
3: 71
4: 679
Right 1085011022 11:73141966-73141988 CGAGCGCGCGCGTGTGTGAAAGG 0: 1
1: 0
2: 2
3: 19
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085011013 Original CRISPR TCCGGCCCTCCTCCTCCTCC TGG (reversed) Exonic
900100525 1:960314-960336 CCCCGCCATCCTCCTCCTCTGGG - Intergenic
900100565 1:960423-960445 CCCCGCCATCCTCCTCCTCCGGG - Intergenic
900297665 1:1960119-1960141 TCCTGGCCTCCTCCCCATCCCGG + Intronic
900405803 1:2492513-2492535 TGAGCCCCTCCTCCTCCTGCAGG - Intronic
900656499 1:3761343-3761365 TCAGGGCCTCCCTCTCCTCCTGG - Exonic
900658634 1:3772395-3772417 CCCGGCCCCCCTGCACCTCCTGG + Intergenic
900792436 1:4689398-4689420 CCTGGCCCTCCGCCTCCTCGTGG - Intronic
901203487 1:7480486-7480508 TCCAGCTTTCCTTCTCCTCCAGG + Intronic
901525905 1:9823532-9823554 TCCGGCCCTACTCCCGCACCCGG + Intronic
901754427 1:11432739-11432761 TCCTGGCCTCCTCCCACTCCTGG + Intergenic
902225686 1:14995100-14995122 TCCAGCTCCCCTCTTCCTCCAGG - Intronic
902330119 1:15727188-15727210 TCGGCCCCTCTCCCTCCTCCTGG - Exonic
902732136 1:18376644-18376666 TCCCAGACTCCTCCTCCTCCTGG + Intronic
902840396 1:19070530-19070552 TCCTGCCCGGCTCCTGCTCCGGG - Intergenic
903230802 1:21921295-21921317 TCCTGCACTCCTCCTCTCCCAGG - Intronic
903340436 1:22651044-22651066 TCCAGGCCTCCTCCTAATCCAGG + Intergenic
903625216 1:24725434-24725456 TCCGGCTGCCCTCCTCCTGCAGG - Intergenic
903829187 1:26164605-26164627 CCTGACCCTCCTCCTCGTCCCGG - Intergenic
904014578 1:27409829-27409851 CCCCCTCCTCCTCCTCCTCCGGG - Exonic
904052427 1:27647773-27647795 TCCTGCCCTCCTCCTTCTCCCGG - Intergenic
904379089 1:30099410-30099432 TCTTGACCACCTCCTCCTCCTGG + Intergenic
904463214 1:30692672-30692694 TCCTCCCATTCTCCTCCTCCAGG - Intergenic
904642110 1:31938529-31938551 TCCCCCGCTCCTCCTCCTCGTGG + Intronic
904674436 1:32190075-32190097 TGCGCTTCTCCTCCTCCTCCCGG - Exonic
904844139 1:33396162-33396184 TCAGCCCCTGCTTCTCCTCCAGG + Intronic
905353405 1:37363261-37363283 TCCCATCCCCCTCCTCCTCCAGG + Intergenic
905365331 1:37448211-37448233 TCCCAACCTGCTCCTCCTCCAGG + Intergenic
906044436 1:42817115-42817137 TCCTGCCCTCTTCCCTCTCCTGG + Exonic
908323874 1:63004562-63004584 TCCAGCCCTCATCCTCCAACAGG - Intergenic
908838235 1:68250116-68250138 TCCAGCGATCCTCCTGCTCCAGG + Intergenic
909515330 1:76501032-76501054 TCCAGTCTTCCTCCTCCTCCTGG - Intronic
910200019 1:84690151-84690173 TACCTCCCACCTCCTCCTCCAGG + Intronic
914713464 1:150235396-150235418 CCCGGCACTCCTCCTCCTGGGGG - Intronic
914950629 1:152110648-152110670 GGAGGCCGTCCTCCTCCTCCTGG + Exonic
915034542 1:152910952-152910974 GCTGCCCCTCCTCCTCCTCCAGG - Exonic
915279556 1:154813402-154813424 CCCGGGCCGCCTCCTCTTCCTGG + Intronic
915299091 1:154941851-154941873 TCTGGCCCTGTGCCTCCTCCAGG - Intergenic
915339193 1:155167062-155167084 TCAGGCCTACCGCCTCCTCCGGG + Intergenic
915471518 1:156128556-156128578 GTCTGCCCTCTTCCTCCTCCTGG + Intronic
915590215 1:156866425-156866447 TCCCCTCCTCCTCCTCCTTCCGG - Intronic
915661535 1:157409537-157409559 TCCGGCCCTCTGCCTGCACCTGG + Intergenic
916071275 1:161171527-161171549 TCCAGCCCTGCTCCTACTCTAGG + Exonic
918092299 1:181308109-181308131 TGCATCCCTCCTGCTCCTCCTGG + Intergenic
918236626 1:182586626-182586648 TCCAGCCCCCTTCCTCTTCCTGG + Exonic
918569304 1:185969818-185969840 GCTTCCCCTCCTCCTCCTCCAGG - Intronic
919991468 1:202710564-202710586 GCCCGCCCTCCGCCTCCTCCGGG - Intergenic
920032413 1:203045361-203045383 CCCGGCCCGTATCCTCCTCCAGG - Intronic
920048550 1:203149483-203149505 GCCTGTCCTCCTCCTCCTCTGGG - Intronic
920091010 1:203453285-203453307 TTCCTGCCTCCTCCTCCTCCTGG + Intergenic
920210819 1:204327053-204327075 CCATCCCCTCCTCCTCCTCCTGG + Intronic
920250358 1:204618771-204618793 TCCGGACCTCCAGCGCCTCCCGG - Exonic
920886996 1:209938559-209938581 TCCGGGCCGCCGCCTCCTGCCGG + Intronic
921300690 1:213749045-213749067 ACAGTCCCTCCTCCTCTTCCTGG + Intergenic
921390161 1:214607763-214607785 TCCAGCCCTCCTAGTCATCCAGG - Intronic
921930170 1:220748456-220748478 TAAGGGCCTCCTCGTCCTCCCGG + Exonic
922803363 1:228373910-228373932 ACTGGCCCTCTTCCTCCTGCAGG + Exonic
923296147 1:232596876-232596898 TCCCGGCCTCCTCCTGCTCAAGG + Intergenic
923537652 1:234865309-234865331 TACTCACCTCCTCCTCCTCCTGG - Intergenic
924482649 1:244451396-244451418 GCCAGCCCACCTCTTCCTCCAGG + Intronic
924864470 1:247962388-247962410 TTCAGCCCTTCTCCTTCTCCTGG - Intronic
1062768201 10:81041-81063 CCCAGCCTCCCTCCTCCTCCAGG + Intergenic
1062860793 10:807652-807674 TGCGGCCCTCCAGCTCCACCAGG + Exonic
1063666404 10:8063228-8063250 TCCCTCCCTCCCCCTCTTCCAGG + Intronic
1063680320 10:8181088-8181110 TTCTGCCCTCCTGGTCCTCCTGG - Intergenic
1065099585 10:22320784-22320806 CCCGGCCGCCCGCCTCCTCCCGG - Intronic
1065308905 10:24395417-24395439 TCCTGCCCTTCTCCTGCCCCAGG + Intronic
1065926330 10:30436435-30436457 TCAGACACTCCTCCACCTCCCGG + Intronic
1066323534 10:34329596-34329618 CCAGGCCCACCTCTTCCTCCCGG - Intronic
1067247642 10:44559710-44559732 CCTGGCCCCCCTTCTCCTCCTGG + Intergenic
1067286085 10:44908562-44908584 GCCAGACCTCCCCCTCCTCCGGG + Intergenic
1067453685 10:46398048-46398070 TCAGCCCCTACTCCTCTTCCCGG + Intergenic
1067581766 10:47450839-47450861 TCCTGGCCTGCTCCTCCTCATGG - Intergenic
1067583543 10:47461698-47461720 TCAGCCCCTACTCCTCTTCCCGG - Intronic
1067633546 10:47987046-47987068 TCAGCCCCTACTCCTCTTCCCGG - Intergenic
1067661317 10:48238080-48238102 TCCGGCCCGCCTGCTGGTCCTGG + Exonic
1068968549 10:62938442-62938464 TCCTGTCCTCCTTCTCCTCACGG + Intergenic
1069281867 10:66664647-66664669 TCCGTCTCTCCTACTCTTCCTGG + Intronic
1069617324 10:69814319-69814341 CATGTCCCTCCTCCTCCTCCTGG - Intronic
1069655248 10:70083081-70083103 TCCAGCTCTCCCCCTCCTGCAGG - Intronic
1069743356 10:70699605-70699627 TCCAGCCCACCCCCTCCTTCTGG - Intronic
1069833850 10:71296556-71296578 TCCTGACCCCCTCCTCCTGCAGG + Exonic
1069874139 10:71551384-71551406 CCCCTCCCTCCTTCTCCTCCTGG - Intronic
1070032706 10:72692500-72692522 GTCGCCCCTCCTCCTCCTCTCGG - Intronic
1070314259 10:75295297-75295319 TCCCGCCCTCCTCCTCCTGGCGG + Intergenic
1070570395 10:77636704-77636726 TCGGGCCATGCTCCTCCCCCGGG + Intronic
1070798502 10:79231012-79231034 TCCGGTCCTGTGCCTCCTCCTGG + Intronic
1070964782 10:80523201-80523223 CCCGGCCTTCATCCCCCTCCTGG - Exonic
1071512089 10:86268384-86268406 CCCTGCCATCCTCTTCCTCCAGG - Intronic
1071598675 10:86945476-86945498 GCCAGCCCTTCTCCTCTTCCAGG - Exonic
1071816877 10:89241150-89241172 CCCTTCCCTCCTCTTCCTCCTGG - Intronic
1071995988 10:91149960-91149982 TGCTGCCCTCCTCCTCTTGCAGG - Intergenic
1072438231 10:95432509-95432531 TCCGGGCCTCGTCTTCCTACAGG - Exonic
1072619037 10:97067804-97067826 ACAGCCCCACCTCCTCCTCCTGG + Intronic
1072750470 10:97975062-97975084 GCCGGCCCTCCACCGCCACCCGG - Intronic
1073082963 10:100871454-100871476 TCCGGCCCTCATCCAACTCCTGG + Intergenic
1073332121 10:102677112-102677134 GACCTCCCTCCTCCTCCTCCTGG - Intronic
1073540956 10:104315868-104315890 GCCGAGCCACCTCCTCCTCCAGG + Exonic
1074111141 10:110423506-110423528 TCCTGCCCTCCTCCCTCCCCAGG - Intergenic
1075440238 10:122474463-122474485 TCAGGCCCTCCTCCTGCACCAGG + Intronic
1075662460 10:124207520-124207542 CCCGGCTCCCCTCCTCCCCCAGG - Intergenic
1075722465 10:124595291-124595313 GCAGTCCCTCCTCCTCCCCCTGG - Intronic
1076127102 10:127983870-127983892 TCCGGGGCTCCTCCACCTCCCGG + Intronic
1076485284 10:130811648-130811670 TCCGGGCAGCTTCCTCCTCCTGG + Intergenic
1076507560 10:130987920-130987942 TGGAGCCCTCCTTCTCCTCCAGG + Intergenic
1076526444 10:131115349-131115371 TCCTGCCCTCCTCCTGCTCTTGG - Intronic
1076530362 10:131140754-131140776 TCCGGCTCTCCATCTCGTCCTGG - Intronic
1076721940 10:132396775-132396797 CCGGGCCCCCCTCCCCCTCCGGG - Intergenic
1076812788 10:132897992-132898014 TCCCGTCCTCCTCCTCCCACTGG + Intronic
1076891771 10:133288230-133288252 TCCGGAGCTCCTCCTCCGCGAGG + Exonic
1076903322 10:133350468-133350490 CCGGGCCCACCTCCTCCACCTGG - Intronic
1076915974 10:133423363-133423385 CCCCGTCCTCCTCGTCCTCCAGG + Exonic
1076936111 10:133568229-133568251 CCCAGTCCTCCTCGTCCTCCAGG + Intronic
1076948046 10:133665202-133665224 TCCGCCCCGCCCCCTCCACCGGG + Intergenic
1076949036 10:133668512-133668534 TCCGCCCCGCCCCCTCCACCGGG + Intronic
1076950020 10:133671811-133671833 TCCGCCCCGCCCCCTCCACCGGG + Intergenic
1076951004 10:133675110-133675132 TCCGCCCCGCCCCCTCCACCGGG + Intergenic
1076951994 10:133678420-133678442 TCCGCCCCGCCCCCTCCACCGGG + Intergenic
1076952983 10:133681730-133681752 TCCGCCCCGCCCCCTCCACCGGG + Intergenic
1076953967 10:133685029-133685051 TCCGCCCCGCCCCCTCCACCGGG + Intergenic
1076954951 10:133741381-133741403 TCCGCCCCGCCCCCTCCACCGGG + Intergenic
1076955940 10:133744691-133744713 TCCGCCCCGCCCCCTCCACCGGG + Intergenic
1076956930 10:133748001-133748023 TCCGCCCCGCCCCCTCCACCGGG + Intergenic
1076957917 10:133751310-133751332 TCCGCCCCGCCCCCTCCACCGGG + Intergenic
1076958902 10:133754609-133754631 TCCGCCCCGCCCCCTCCACCGGG + Intergenic
1076959891 10:133757919-133757941 TCCGCCCCGCCCCCTCCACCGGG + Intergenic
1076960875 10:133761218-133761240 TCCGCCCCGCCCCCTCCACCGGG + Intergenic
1077253736 11:1571761-1571783 CCGGGGCCGCCTCCTCCTCCCGG + Intronic
1077307269 11:1873963-1873985 GCCGGCCTCCCTCCTCCGCCGGG - Intronic
1077307733 11:1875539-1875561 TCAAGGCCTCCTCCTGCTCCGGG + Intronic
1077317690 11:1926714-1926736 GCCGGCGCTCCCCCGCCTCCAGG + Intronic
1077407973 11:2391114-2391136 GATGGCCCTCCTCCTCCTCCTGG - Intronic
1077546027 11:3170402-3170424 TGAGGCCCTGCTCCTCCTCTTGG - Intergenic
1078346781 11:10556842-10556864 TCCTCCCCACTTCCTCCTCCTGG + Intergenic
1080456854 11:32426876-32426898 CCCGCCCCTCCTCCACCTGCGGG + Intronic
1081611360 11:44565306-44565328 TCCCGCCTACCTCGTCCTCCCGG - Intronic
1082816932 11:57515232-57515254 TCCGACTCTTCTCTTCCTCCCGG - Intronic
1083244556 11:61416291-61416313 GGGGTCCCTCCTCCTCCTCCTGG - Exonic
1083310404 11:61780871-61780893 TCCTGCCCTCCTGCCTCTCCAGG + Intronic
1083327054 11:61878251-61878273 TCCAGGCCACCTCCTTCTCCCGG + Intronic
1083667851 11:64285296-64285318 CCCGGCCCTCCTCCCGCGCCCGG - Intronic
1083890209 11:65592206-65592228 CCAGGCGCTCGTCCTCCTCCAGG - Exonic
1083940726 11:65894094-65894116 GGCGGCGCTCCTCTTCCTCCGGG + Exonic
1084165434 11:67373028-67373050 GCCCGCCCTCCTACCCCTCCCGG + Intronic
1084179254 11:67438396-67438418 TGCGGCCCAGCTGCTCCTCCAGG + Exonic
1084429133 11:69101678-69101700 GCAGGAGCTCCTCCTCCTCCTGG + Intergenic
1084680427 11:70663330-70663352 CCCGTCCCTCCTCCTCCCCAGGG - Intronic
1084715915 11:70873280-70873302 ACCTGCCCTCCTCTTCCTCATGG - Intronic
1085011013 11:73141925-73141947 TCCGGCCCTCCTCCTCCTCCTGG - Exonic
1085310042 11:75510754-75510776 CTCCCCCCTCCTCCTCCTCCGGG + Intronic
1085561076 11:77473575-77473597 TCGGCTCCTCCTCCTCCTCCCGG + Exonic
1085641284 11:78194671-78194693 TTCTGCCCTTCTCCTCCACCTGG - Intronic
1088065234 11:105709686-105709708 TGCCTCCCACCTCCTCCTCCTGG - Intronic
1088802943 11:113323382-113323404 TCCTGCATTCATCCTCCTCCTGG - Exonic
1089083652 11:115798606-115798628 CCCCGTCCTCCTCCTCTTCCTGG + Intergenic
1089216478 11:116837407-116837429 CCAGGCCCTTCTTCTCCTCCAGG - Exonic
1089566935 11:119376563-119376585 CCCTGCCCAGCTCCTCCTCCTGG + Intronic
1089789704 11:120933884-120933906 TCAGGCCTGCCTCCTCCACCTGG - Intronic
1090357719 11:126151019-126151041 TCTGGTCCTCAGCCTCCTCCTGG - Intergenic
1090901589 11:131037139-131037161 TCTGGCTTTCATCCTCCTCCAGG - Intergenic
1090967804 11:131613908-131613930 TCCTGGCTTCCTCCTACTCCCGG + Intronic
1091406781 12:214185-214207 TCAGTCCCTCCTGCTGCTCCTGG - Intronic
1091596691 12:1883248-1883270 TCAGGCCCTGCTGCTCCTTCCGG - Intronic
1091675600 12:2486807-2486829 ACCTGCCCTCCTCCCCCACCTGG - Intronic
1092519545 12:9253803-9253825 ACCGGCCCTTCTTCTACTCCAGG + Intergenic
1092615547 12:10212923-10212945 TCTGGCTCTCCTCTACCTCCAGG + Exonic
1094603210 12:31928776-31928798 TCAGGCGATTCTCCTCCTCCTGG + Intergenic
1094662494 12:32483802-32483824 TCCAGCCATCATCCTCATCCAGG - Intronic
1095938818 12:47712548-47712570 CCAGACCCTCCTTCTCCTCCAGG + Exonic
1096154203 12:49332858-49332880 GCCGGGTCTCCTCCTCTTCCCGG + Exonic
1096491452 12:52015172-52015194 GCTGGCTCTCCTCCTCCTCCAGG - Exonic
1096515994 12:52155544-52155566 TCCTGCATTCCTCCTCCTCTTGG - Intergenic
1096784364 12:54008771-54008793 TCCTCCCCTCCCCTTCCTCCAGG + Intronic
1097404177 12:59168693-59168715 TCCTGCCCTCTTGTTCCTCCTGG + Intergenic
1098435445 12:70463911-70463933 TCCGGCCCTGCTGCTGCTGCTGG - Intergenic
1099469228 12:83026051-83026073 TCCATCCCTTCTCCTCTTCCCGG + Intronic
1102136901 12:110583046-110583068 CCCGGCCCCCCGCCTCCTCGGGG - Exonic
1102453094 12:113056064-113056086 GCCTGCCCTTCTCTTCCTCCAGG + Intergenic
1102546829 12:113663427-113663449 TCCGGCACCCCTTCTCCTTCAGG + Intergenic
1102867036 12:116382777-116382799 ACCTGCCCTGCTGCTCCTCCTGG + Intergenic
1103322424 12:120099870-120099892 TGTGGTCCCCCTCCTCCTCCGGG - Intronic
1103363612 12:120368160-120368182 TCACCCCCTCCTCCTGCTCCCGG - Intronic
1103562791 12:121800854-121800876 GCGGGCCCGCCTCCTGCTCCGGG + Intronic
1104019888 12:124985054-124985076 TCCTGGCCTCTTCCTGCTCCTGG - Intronic
1104090728 12:125514877-125514899 TCTCCTCCTCCTCCTCCTCCTGG + Intronic
1104759240 12:131287153-131287175 GCCGCCCCACCTCCTGCTCCTGG + Intergenic
1104811174 12:131621174-131621196 TCCCCGCCGCCTCCTCCTCCAGG - Intergenic
1104980591 12:132571620-132571642 GCCGGCCCCCCACCTCCTCCTGG - Intronic
1104992306 12:132632707-132632729 GCTGGCCCCCCTCCTCCTCACGG + Exonic
1105475990 13:20728582-20728604 TAGAGCTCTCCTCCTCCTCCAGG - Intergenic
1105942139 13:25157042-25157064 TCCGGCCCTCTTCCCCATTCTGG + Intergenic
1106683445 13:32031588-32031610 TCGGCCGCTCCTCCTCCTCCGGG - Exonic
1110069545 13:71156716-71156738 ACAGCTCCTCCTCCTCCTCCTGG + Intergenic
1112051072 13:95644284-95644306 GCCGGCCCTCCTGCCTCTCCAGG - Intronic
1112328883 13:98462140-98462162 GCCCACCCTCCTCCTCCTCCCGG + Intronic
1113083435 13:106541176-106541198 TGAGGCTCTCCTCCCCCTCCAGG - Intergenic
1113416914 13:110136073-110136095 TCCTCCCATCCTACTCCTCCCGG + Intergenic
1113762424 13:112858968-112858990 GCAGGCCCTCCTCATCCTCAGGG - Intronic
1113802139 13:113092178-113092200 CCCGGCCCACCTTCTCCACCAGG - Intronic
1113869154 13:113547479-113547501 GCCGGCCCTGCTCCTCATCTCGG + Intronic
1114529431 14:23386596-23386618 TCTTGCCCTCCTCGTGCTCCAGG + Exonic
1114534834 14:23416285-23416307 TCTTGCCCTCCTCGTGCTCCAGG + Exonic
1114551140 14:23533461-23533483 CCAGGCCCTCCTCCCCCACCAGG - Exonic
1114656164 14:24316772-24316794 CACGCCCCTGCTCCTCCTCCAGG - Exonic
1115852009 14:37596159-37596181 TCGGGCCGTCCTCCCCCTGCCGG + Intronic
1116950147 14:50872064-50872086 GCCCGCCCTCCTCCTCCGCGCGG - Intronic
1116999318 14:51356050-51356072 TCTGTCCCTCGTCCTTCTCCTGG - Intergenic
1117790104 14:59331362-59331384 GGTGGCCCTCCTCCTCCCCCAGG + Exonic
1117957059 14:61130968-61130990 TCCCTCCTCCCTCCTCCTCCAGG + Intergenic
1118704082 14:68463857-68463879 TCCTGCTCTCCTCCTCACCCAGG - Intronic
1118797198 14:69153601-69153623 TCCGGCCCTCCTTCCTCTGCTGG + Intergenic
1119401488 14:74365566-74365588 GCCTGCACTTCTCCTCCTCCTGG - Intergenic
1119712372 14:76831404-76831426 GCCAACCCTCCACCTCCTCCAGG - Intronic
1121404123 14:93708600-93708622 CCAGAGCCTCCTCCTCCTCCAGG - Intergenic
1122719721 14:103715448-103715470 TCCCGCCGTCCTGCTCCTCTCGG + Intronic
1122736759 14:103847763-103847785 TCCGCCCCTCCCCCGCCGCCGGG - Intergenic
1122847155 14:104506291-104506313 TCCTGCCTCCCTGCTCCTCCTGG + Intronic
1122954037 14:105061598-105061620 TCAGGCCCTGCTCTTCCTCGGGG + Intronic
1123028467 14:105439578-105439600 AGCGTCCCTTCTCCTCCTCCTGG + Intronic
1123722010 15:23068415-23068437 ACCCGCCCTCCTCGGCCTCCGGG + Intergenic
1124006356 15:25798369-25798391 TCCAGCCCTCCCCCTGCCCCAGG + Intronic
1124363261 15:29054154-29054176 TGATGCCCTCCTCCTCCTCAGGG - Exonic
1124665276 15:31586865-31586887 CTGGGTCCTCCTCCTCCTCCTGG + Intronic
1124882459 15:33655076-33655098 TCTGCACCTCCTCCTCTTCCTGG + Intronic
1124959172 15:34382212-34382234 TCAGGTCCGCCTTCTCCTCCAGG + Exonic
1124975798 15:34528433-34528455 TCAGGTCCGCCTTCTCCTCCAGG + Exonic
1127260608 15:57323968-57323990 TCTCTCCCTCCTCCTCCTCCAGG - Intergenic
1127417592 15:58771998-58772020 CCGCGCCCTCCTCCTCCTCAGGG - Exonic
1127670176 15:61187488-61187510 GCCACCCCTCCTCCTCCTCTTGG - Intronic
1128067733 15:64775223-64775245 ACAGACCCACCTCCTCCTCCAGG + Exonic
1128109675 15:65068334-65068356 CCAGCCCCGCCTCCTCCTCCAGG + Intronic
1128286121 15:66438560-66438582 TCAAGCCTTCCTCCTCCTTCAGG + Intronic
1128374512 15:67065685-67065707 CCCCGCCACCCTCCTCCTCCCGG - Intronic
1128737871 15:70063498-70063520 TCCAGCCCTCCTTCCCTTCCTGG - Intronic
1128794050 15:70451960-70451982 CCTGGCCCTCCACCTCCTCTTGG + Intergenic
1129476243 15:75786168-75786190 TCCTGCCCACCTTCTCCTTCGGG - Intergenic
1129522714 15:76195984-76196006 TGCCTCCCTCCTCCTCCTCCTGG - Intronic
1129716410 15:77853916-77853938 TCCAGCTCTTCTCCTCTTCCTGG + Intergenic
1129754447 15:78088634-78088656 TCCTGCTCTCCTTCTCCACCTGG - Intronic
1129801049 15:78414663-78414685 TCCTGGTCTTCTCCTCCTCCAGG + Intergenic
1130033905 15:80341012-80341034 CCCAGCCCTCCTCCCCATCCAGG + Intergenic
1130283856 15:82539953-82539975 TCGGGCCTTCCTCGGCCTCCGGG - Intronic
1130453455 15:84080288-84080310 ACCAGCCCTGCTCCTTCTCCCGG - Intergenic
1130821622 15:87502141-87502163 TCTCACCCTCCACCTCCTCCAGG + Intergenic
1131170631 15:90175443-90175465 TCAGCCCCTCCCCTTCCTCCAGG - Intronic
1131406821 15:92171866-92171888 CCTGGCCCTCTTCCTCTTCCTGG + Intronic
1131560138 15:93432533-93432555 TTGCGCCCTCCGCCTCCTCCCGG + Intergenic
1131652077 15:94410994-94411016 TCCAGCTCTCTTCCTCCTCCTGG - Intronic
1132055690 15:98649029-98649051 CCCCCTCCTCCTCCTCCTCCTGG - Exonic
1132184582 15:99792213-99792235 TCAGGTCCACCTTCTCCTCCAGG - Intergenic
1132419504 15:101652930-101652952 TCGGGCCATCCTGCTTCTCCAGG - Intergenic
1132432397 15:101772443-101772465 TCAGGTCCGCCTTCTCCTCCAGG + Intergenic
1132640843 16:977649-977671 CCCGGCCCTCCTCCTGCGGCAGG - Intronic
1132698404 16:1212071-1212093 GCCGCGCCTCCTCCGCCTCCTGG - Exonic
1132728816 16:1350698-1350720 TCCGTCCCTTATGCTCCTCCTGG + Intronic
1132872462 16:2121971-2121993 TCCAGCCCTGCTCCTCCCACCGG + Intronic
1133134466 16:3700240-3700262 TCACCCCATCCTCCTCCTCCCGG + Intronic
1133376218 16:5289342-5289364 ATGGGCCCTCCTCCTCCTCCTGG - Intergenic
1134005812 16:10818392-10818414 CGCATCCCTCCTCCTCCTCCCGG + Intronic
1134628722 16:15741510-15741532 CCCTGTCTTCCTCCTCCTCCAGG + Exonic
1134932111 16:18216529-18216551 GCCTGCCTCCCTCCTCCTCCGGG - Intergenic
1135500429 16:22991256-22991278 TCCAGCTCCCCACCTCCTCCTGG - Intergenic
1135772965 16:25231305-25231327 TCCTTCCCTCCCCCTGCTCCTGG - Intergenic
1136221875 16:28834484-28834506 TCCTCTCCTCCTCCTCTTCCAGG + Exonic
1136417313 16:30112090-30112112 CCCCGTCCTCTTCCTCCTCCAGG - Intronic
1136510755 16:30737111-30737133 CCGGCCCCTCCTCCTCCTCTTGG - Exonic
1136707184 16:32200614-32200636 TCCAGCCCTCCTAATCATCCAGG + Intergenic
1136760726 16:32728803-32728825 TCCAGCCCTCCTAATCATCCAGG - Intergenic
1136807377 16:33141583-33141605 TCCAGCCCTCCTAATCATCCAGG + Intergenic
1137603881 16:49774403-49774425 TCCTGCCCACCTCCCCCTCCTGG - Intronic
1137783068 16:51114081-51114103 TGCGGCCCCCTTCCTTCTCCCGG - Intergenic
1137847453 16:51704741-51704763 TCCGTCTCTCCTGCTCCACCAGG + Intergenic
1137977198 16:53041953-53041975 CCCATCCCTCCTGCTCCTCCAGG + Intergenic
1138567009 16:57840950-57840972 TCTGGCGATCCTCCTCCACCAGG + Intronic
1139650932 16:68361734-68361756 TGCGGCCCTCCTCACTCTCCAGG + Exonic
1139775224 16:69312410-69312432 TTCTGCCCTCCTCCACCTCCAGG - Intronic
1139845067 16:69915000-69915022 GCCTTCCCTTCTCCTCCTCCTGG - Intronic
1139957314 16:70699264-70699286 TACTGCCCCACTCCTCCTCCTGG + Intronic
1140192318 16:72828591-72828613 TCCTGTCCTCCCCCTCCCCCAGG - Intronic
1140850329 16:78929586-78929608 TCCCGCCCTCCTTGTCCACCAGG - Intronic
1140885133 16:79236324-79236346 TCCCTCCCTCTCCCTCCTCCAGG + Intergenic
1140964342 16:79950231-79950253 TCCTCCCCTCCTGCTCCTTCTGG - Intergenic
1141021071 16:80496988-80497010 TCCAGCCTCTCTCCTCCTCCAGG - Intergenic
1141057130 16:80828806-80828828 TCCGGCCCACGTGCTTCTCCTGG + Intergenic
1141121591 16:81362753-81362775 CCCGGCTCTCCTCCCCTTCCTGG + Intronic
1141665862 16:85464798-85464820 TCCAGCCGGCATCCTCCTCCCGG - Intergenic
1141690562 16:85594108-85594130 GCTGGTCCCCCTCCTCCTCCAGG - Intergenic
1141941276 16:87277821-87277843 ACCGCCTGTCCTCCTCCTCCAGG + Intronic
1142003122 16:87675388-87675410 TCCAGCCTTCCTCTTGCTCCTGG + Intronic
1142206432 16:88785217-88785239 TCCCGCCCTCCTCCGCCCGCGGG + Intergenic
1142228768 16:88889676-88889698 TGAAGCACTCCTCCTCCTCCAGG + Intronic
1142305609 16:89283073-89283095 CCCGTCCTTCCTCCTTCTCCTGG + Exonic
1203062878 16_KI270728v1_random:989117-989139 TCCAGCCCTCCTAATCATCCAGG - Intergenic
1142480164 17:214132-214154 TCAGGCCCTCCTCCTAACCCAGG + Intronic
1142505111 17:358150-358172 TCTGGACCTCCTCATCCTCCTGG + Intronic
1142686721 17:1581389-1581411 TCCGGCCCTCCCTGGCCTCCTGG - Intronic
1142697221 17:1640227-1640249 TCCTGCCCTCCTCGCCCTCTGGG - Intronic
1143091198 17:4450021-4450043 TCCTTCTCTCCTCCTCCTCCTGG + Intronic
1143374936 17:6461858-6461880 TCCCTCCCTCCTCCTCCTCCAGG + Intronic
1143526509 17:7476160-7476182 TCCAGCCCTCCTCCCCCTGAGGG + Intronic
1144343662 17:14331548-14331570 CCGAGCCCTCCTCCTCTTCCAGG - Intronic
1144759769 17:17700702-17700724 TCCGGCCCCTCTCGTCCTCGGGG + Intronic
1145105198 17:20109699-20109721 TCTCTCCCTCCACCTCCTCCTGG + Intronic
1145261265 17:21356067-21356089 TCCAGCCTTCCTCAGCCTCCAGG - Intergenic
1145264837 17:21374738-21374760 TCCTGGTTTCCTCCTCCTCCTGG - Intergenic
1146061072 17:29607720-29607742 TCCACTCCTCCTCCTCCTCCAGG + Exonic
1146594482 17:34157109-34157131 CCCTCCTCTCCTCCTCCTCCAGG + Intronic
1146646320 17:34579533-34579555 GCCCGCCCTCCTCCTCCGTCCGG - Intergenic
1146905496 17:36615255-36615277 TCTGGCCCTTCTCCCCCTTCGGG + Intergenic
1147139553 17:38453698-38453720 TCCGCGCCTCCTGCGCCTCCCGG - Intronic
1147560946 17:41508634-41508656 TCCGGCCCCTCTCCCCTTCCCGG - Intergenic
1147919582 17:43907580-43907602 TCCGGACCTCCGCCCCCTCGCGG - Intronic
1148463523 17:47851277-47851299 TCCCGCCCACCCCCTCCTCGCGG - Intronic
1148471511 17:47896455-47896477 GCCAGCCCCGCTCCTCCTCCGGG - Intronic
1148793586 17:50186894-50186916 CCCGGCCCTCCTGGACCTCCTGG - Exonic
1148861704 17:50607952-50607974 GCCGGGCCTCCTCTTCCTCCTGG - Exonic
1148995825 17:51708769-51708791 TCCGATCCTCATCCTTCTCCTGG + Intronic
1149621775 17:58050647-58050669 TCCAGCCCTCCTCCGCCTCCAGG - Intergenic
1151341969 17:73477344-73477366 TCCGGCCCTGCTGCTCCTCCAGG - Intronic
1151352382 17:73539449-73539471 TCTGGCCCTCCCTCTCCTGCTGG - Intronic
1151386542 17:73758543-73758565 TCCCTCCCTCCTCCTTCCCCAGG - Intergenic
1151745368 17:76009001-76009023 GCCGGCCCACCTCCTCATCCAGG + Exonic
1151745623 17:76010252-76010274 GCTTGCCCTCCTCCTCCACCTGG + Exonic
1151746522 17:76014576-76014598 TCTGGGCCTCGTCCTCCTGCAGG - Exonic
1151763328 17:76119751-76119773 CTCGCCCCTCCTCCTCCTCCTGG - Intronic
1151800155 17:76374475-76374497 TCCAACACTCCACCTCCTCCTGG - Intronic
1151884262 17:76914334-76914356 TCCTGCGCTCTTTCTCCTCCCGG - Intronic
1152000345 17:77641360-77641382 TTCTGCCCTGCTCATCCTCCTGG - Intergenic
1152007867 17:77693876-77693898 ACCCACCCTCCTCCTTCTCCAGG - Intergenic
1152089962 17:78240799-78240821 GCAGGGCCTCCTCTTCCTCCTGG + Exonic
1152103455 17:78315843-78315865 CCTGCTCCTCCTCCTCCTCCTGG + Intergenic
1152186199 17:78857696-78857718 TCCTGCCCAGCTCCTCCACCCGG + Intronic
1152238250 17:79149447-79149469 TCCAGCCCTGCTCCTCCCCCAGG - Intronic
1152365442 17:79853623-79853645 TCAGGGCATCCTCCACCTCCTGG + Intergenic
1152379563 17:79935308-79935330 TCCGGAGCTGCTCTTCCTCCTGG + Exonic
1152423331 17:80205541-80205563 TCCAGGCCTCATACTCCTCCTGG - Exonic
1152524310 17:80878953-80878975 CCCGTCCCTCCTCCTTCCCCAGG + Intronic
1152750410 17:82060023-82060045 TGCCACCCTCCTCTTCCTCCAGG + Exonic
1152755452 17:82085214-82085236 TCAGGCCCTGCCCCACCTCCAGG - Intronic
1152759152 17:82099091-82099113 TTCGGCCCTGCGCCTCGTCCGGG - Intergenic
1152782099 17:82231168-82231190 TCCTTCCCTCCCCCTCCCCCGGG + Intronic
1152961090 18:80538-80560 CCCAGCCTCCCTCCTCCTCCAGG + Intergenic
1152965797 18:112317-112339 TCCGCCCCGCCCCCTCCACCGGG - Intergenic
1153285100 18:3449789-3449811 TCCTTCCCTCCTCCACCCCCGGG - Intronic
1153764860 18:8365745-8365767 CTCTGCCCTCCTCCTTCTCCGGG + Intronic
1153929528 18:9866400-9866422 TCCAGCCCTCTGCCACCTCCTGG - Intergenic
1153929574 18:9866579-9866601 TCCAGCTCTCCACCACCTCCTGG - Intergenic
1154173144 18:12064897-12064919 TCCGTCCGTACTCCACCTCCAGG - Intergenic
1154230443 18:12551914-12551936 GCCACCCCTCCTCCACCTCCTGG + Intronic
1155096216 18:22559206-22559228 ACCAGCCCTCCTCCACCGCCGGG - Intergenic
1155519691 18:26656445-26656467 TCCAGCCCTCCTCCCCCTTTTGG - Intronic
1156350412 18:36297606-36297628 TCCGGCTCCTCCCCTCCTCCGGG - Intergenic
1157208331 18:45719468-45719490 GCCGTCCCACCTCCTCTTCCCGG + Intergenic
1157246364 18:46058429-46058451 TCAGCGCCACCTCCTCCTCCCGG + Intronic
1157338358 18:46757112-46757134 TCCGCCCCTCCCCCTCCCCACGG - Exonic
1157384074 18:47247538-47247560 TCCGGCCCACCTCCTCCTGCCGG - Intronic
1157567439 18:48689103-48689125 TGTGGCAGTCCTCCTCCTCCAGG - Intronic
1158137694 18:54224505-54224527 TCTCCCCCTCCTCCTGCTCCGGG + Exonic
1158893729 18:61894743-61894765 CCCGGCCCTGCCCCTCCTCCCGG - Intergenic
1160202035 18:76803964-76803986 CCCAGCCCGCCTCCTCTTCCAGG - Intronic
1160493128 18:79354609-79354631 TCCGGCCCAGCTCCACTTCCAGG + Intronic
1160971090 19:1768070-1768092 GCCAGCCCTGCACCTCCTCCAGG - Intronic
1160972298 19:1775046-1775068 TCCCCTCCTCCTCATCCTCCGGG + Intronic
1161175658 19:2841103-2841125 CCCCGCCCGCGTCCTCCTCCGGG - Intergenic
1161266653 19:3367385-3367407 GCCGGGCCTCCCGCTCCTCCCGG - Intronic
1161337348 19:3721711-3721733 CCTGCCCCTCTTCCTCCTCCAGG - Intronic
1161435097 19:4258367-4258389 TCCGCCGCTCCTCCTCCGACAGG - Exonic
1161469105 19:4447579-4447601 TCCGGTACTTCTCCTCCTCGGGG + Exonic
1161992213 19:7690396-7690418 CCCAGCCCACCTGCTCCTCCGGG + Exonic
1162019779 19:7863112-7863134 TCCGGCCCCGCTCCTGCCCCGGG - Intronic
1162058688 19:8081367-8081389 TCCTGCCATCCTCCTCCAGCAGG + Exonic
1162301426 19:9847293-9847315 CCCTGGCCTCCTCCGCCTCCTGG + Intronic
1162464449 19:10831667-10831689 TCCTCTCCTCCTCCTCCTCCTGG + Exonic
1163528364 19:17835053-17835075 CCCCTCCCTCCTCCACCTCCAGG + Intronic
1163641603 19:18465454-18465476 TCCGCGTCTCCTCCTCCGCCTGG + Exonic
1163674264 19:18647524-18647546 TCCTCCTCTCTTCCTCCTCCAGG - Intronic
1165722625 19:38090526-38090548 TCTGCCCTGCCTCCTCCTCCAGG - Intronic
1165741866 19:38209691-38209713 CTCCGCCCTCCTCCTCCTCGAGG + Intergenic
1166067880 19:40370702-40370724 TACTGCCCTCCCCCTGCTCCTGG + Intronic
1166217002 19:41342299-41342321 TCCTTCCTTCCTCTTCCTCCAGG - Intronic
1166523563 19:43497186-43497208 CCCGATCCTCCTCCTCCTGCCGG + Exonic
1166783640 19:45354967-45354989 TATCCCCCTCCTCCTCCTCCCGG + Intronic
1166812417 19:45522381-45522403 CCAGGACCTCCCCCTCCTCCAGG + Exonic
1167240235 19:48339089-48339111 TCCTGCCCTGCCCCTCCTCTGGG - Intronic
1167308228 19:48720947-48720969 CCCGCCCCTCATCCTCCCCCTGG - Exonic
1167441844 19:49513329-49513351 CCCGGCCCGCCCCTTCCTCCCGG - Intronic
1167486839 19:49767620-49767642 TCCGGCATTCCACTTCCTCCAGG - Intronic
1167596444 19:50430805-50430827 TTCCTTCCTCCTCCTCCTCCTGG - Exonic
1167688322 19:50969829-50969851 TTCGGCACTCCACATCCTCCTGG + Intergenic
1167699570 19:51034553-51034575 TCCTGCCCTCTCCCTGCTCCGGG + Intronic
1167701182 19:51046989-51047011 TCCCTCCCTCCTCCCCCTTCTGG - Intergenic
1168048323 19:53810056-53810078 CCCCGCCCTCCCCCTCGTCCAGG + Exonic
1168164017 19:54534186-54534208 TTCCTCCCTCCTCCTCCACCTGG - Intronic
1168231146 19:55032396-55032418 CCCAGCCCTGCTCCTCTTCCAGG - Exonic
1168316365 19:55486461-55486483 GCCGGCCCTGCTCCTCCTGGCGG + Exonic
1168322166 19:55517202-55517224 TCTGTCTTTCCTCCTCCTCCAGG + Exonic
1168344511 19:55643784-55643806 CCCAGCCCCCTTCCTCCTCCCGG - Intronic
1168411286 19:56141643-56141665 CCCGCCCCTCCCCCTCCCCCAGG - Intronic
1168471298 19:56643053-56643075 TCCTCCCCTCCTCCACCCCCGGG - Intergenic
925219769 2:2129176-2129198 TCCCGACCACCTTCTCCTCCAGG - Intronic
925237719 2:2293756-2293778 ACCGGCCCCCTCCCTCCTCCCGG + Intronic
926037469 2:9646692-9646714 TCCGGCTCTCCTGGTCCTCTGGG + Intergenic
926058322 2:9789682-9789704 TCAGGCCCTCCTGGGCCTCCAGG + Intergenic
926718230 2:15941097-15941119 TCCCCCCCTCTTCTTCCTCCAGG - Intronic
926735942 2:16073462-16073484 CCTGGCCTTCCTTCTCCTCCGGG - Intergenic
926801751 2:16665647-16665669 CCCTGCCATCCTTCTCCTCCCGG - Intronic
928105592 2:28468726-28468748 TCCCTCCCTCCTCCCCCGCCTGG - Intronic
928129242 2:28637733-28637755 TCTTGCTCTCCTCCTTCTCCTGG + Intronic
928158045 2:28894611-28894633 TCCGCCTCACTTCCTCCTCCAGG + Intergenic
928512004 2:32010754-32010776 CCCCGCCCCGCTCCTCCTCCCGG + Intronic
929492277 2:42407601-42407623 CCCAGGCCTCCTGCTCCTCCAGG + Intronic
929545837 2:42854824-42854846 TCCTGTCCTCTTCCTTCTCCCGG - Intergenic
930163958 2:48185213-48185235 TCCTGCCTTGCTCCTCCTCAAGG + Intergenic
930728860 2:54709078-54709100 ACGGGCCCAGCTCCTCCTCCAGG - Intergenic
931442393 2:62299446-62299468 TCCCCTCCTCCTCCTCCTCCTGG - Intergenic
932334560 2:70922646-70922668 TCCCGGCCTGCCCCTCCTCCCGG - Intronic
932345958 2:70995129-70995151 TCCGGCCCTGGACCACCTCCAGG - Exonic
932406730 2:71517976-71517998 GGCAGCCCTCCTCCTCATCCTGG + Intronic
932407870 2:71525902-71525924 TCCCGCTCTCCCCCACCTCCCGG - Intronic
932583422 2:73007412-73007434 TCCCTCCCTCCTCATCCTTCAGG + Intronic
933613761 2:84462988-84463010 TCCTGCCTTCCTCCTCCCTCTGG - Intergenic
933747919 2:85584399-85584421 CCCGCCCCTGCTCTTCCTCCGGG + Exonic
934059957 2:88284276-88284298 TCGGCCCCTCCGCCTCCGCCTGG + Intergenic
935217914 2:100988970-100988992 CCAGGCCCCCCTGCTCCTCCAGG + Intronic
935351475 2:102154902-102154924 CCCTCCCCTCCACCTCCTCCAGG + Intronic
936033115 2:109087783-109087805 TCCTGCTCTCCCACTCCTCCAGG - Intergenic
937042888 2:118835250-118835272 TCCACCCCTCCCCCTCTTCCTGG + Intergenic
937132595 2:119524453-119524475 GCCGGCGCGCCTCCTCCACCCGG + Exonic
937266049 2:120615221-120615243 CCCTGCCCTCCTCTTCCTGCAGG + Intergenic
938128467 2:128691068-128691090 TCTTGCCCTCCTCCACATCCAGG + Intergenic
938289970 2:130143888-130143910 GCGGGCCCTCCTCCTGCTCGGGG + Intronic
938302667 2:130228205-130228227 CCTAGCCCTCCTCCTCCTCTGGG + Intergenic
938302682 2:130228244-130228266 CCTAGCCCTCCTCCTCCTCCGGG + Intergenic
938302717 2:130228346-130228368 CCTCGCCTTCCTCCTCCTCCAGG + Intergenic
938453924 2:131445805-131445827 CCTCGCCCTCCTCCTCCCCCGGG - Intergenic
938453952 2:131445876-131445898 CCTCGCCTTCCTCCTCCTCCAGG - Intergenic
938453986 2:131445978-131446000 CCTAGCCCTCCTCCTCCTCCGGG - Intergenic
938454001 2:131446017-131446039 CCTAGCCCTCCTCCTCCTCCGGG - Intergenic
938540630 2:132281197-132281219 AGCGGCCCTCCTACTCCTCCCGG + Intergenic
938736685 2:134192044-134192066 TCGCGCCTTCCTCTTCCTCCTGG + Intronic
938935260 2:136121921-136121943 TCCTGCCATCCACCTCCTCCTGG - Intergenic
942027324 2:171922900-171922922 TCAGATCCTCCTCCTCTTCCAGG + Intronic
943342113 2:186694023-186694045 CCCGGGCCTCTTCCTCCTGCCGG + Exonic
943924068 2:193748527-193748549 TCCTGCCATGCTTCTCCTCCTGG + Intergenic
944141821 2:196464965-196464987 TTCGGCTCACCTCCACCTCCTGG - Intronic
946248057 2:218398436-218398458 CTCGGCCCTCCTCCTGCTCCTGG - Intronic
946310914 2:218882179-218882201 TCTGGACCTCCGCCTCCCCCCGG + Exonic
948225455 2:236306179-236306201 GCCAGCGCTCCTCCTCCTCACGG + Intergenic
948245202 2:236476899-236476921 ACCGGCCCTCCACCTCCAACAGG + Intronic
948384997 2:237575701-237575723 TGCGGCCTTCCTCCTCCTGCAGG + Intronic
948566664 2:238891615-238891637 TCAGGACCTCGGCCTCCTCCTGG - Intronic
948694895 2:239728287-239728309 TCCAGCTCTCCTCCTCCTCGCGG + Intergenic
948809181 2:240466236-240466258 CCTGCCCCTCCTCCTCTTCCTGG + Exonic
948883558 2:240872131-240872153 TCTCACCCTCCTCCACCTCCAGG - Intronic
1169340965 20:4795844-4795866 CCCCTCCATCCTCCTCCTCCTGG - Exonic
1169427803 20:5510034-5510056 TCGGGTCCTGCTGCTCCTCCTGG - Intergenic
1171227152 20:23451380-23451402 TCCTCACCTCCTCCTCCCCCTGG + Intronic
1171869546 20:30514200-30514222 AGCGGCCCTCCTACTCCTCCCGG + Intergenic
1172366703 20:34355634-34355656 TCCTGCCCTCCTCCTCTCCTAGG + Intergenic
1172398001 20:34623271-34623293 CCAGGATCTCCTCCTCCTCCTGG - Intronic
1172481478 20:35274381-35274403 TCCGCCGCTCCACCTCCTTCTGG - Exonic
1172519997 20:35560186-35560208 GCCGGAACTCCGCCTCCTCCAGG + Intergenic
1172764850 20:37345990-37346012 TTCCTCCTTCCTCCTCCTCCCGG + Intronic
1173162712 20:40664291-40664313 CCCCTCCCTCCTCCTCCTCTGGG + Intergenic
1173971341 20:47154727-47154749 TTGGGACTTCCTCCTCCTCCTGG - Intronic
1174507831 20:51028176-51028198 TCCTGCCCTGCTCCTAGTCCAGG + Intergenic
1174534029 20:51237083-51237105 TCAGGTCCTCCTCCACCTCCAGG - Intergenic
1175278403 20:57787413-57787435 TCCAGCCTTCCTCCTCCCCCAGG + Intergenic
1175725580 20:61316100-61316122 TCACGTCCTCCTCTTCCTCCTGG + Intronic
1175808664 20:61845657-61845679 TCAGTCCCTGCTCCTCCTCATGG + Intronic
1175888629 20:62306211-62306233 TCCGGCAATGCTCCTCATCCTGG - Exonic
1175916121 20:62426884-62426906 CCCGGCCCACCTCCACCTCCGGG - Intronic
1176161727 20:63652040-63652062 TTCCTCCCTCCGCCTCCTCCTGG - Intronic
1176296643 21:5076668-5076690 CCCAGCGCCCCTCCTCCTCCTGG - Intergenic
1176348389 21:5770907-5770929 CCCGGCCAGCCGCCTCCTCCGGG - Intergenic
1176355203 21:5891491-5891513 CCCGGCCAGCCGCCTCCTCCGGG - Intergenic
1176496438 21:7553548-7553570 CCCGGCCAGCCGCCTCCTCCGGG + Intergenic
1176542710 21:8168977-8168999 CCCGGCCAGCCGCCTCCTCCGGG - Intergenic
1176547907 21:8209325-8209347 TCGGGCCGTCCGCCTCCTCGCGG + Intergenic
1176555803 21:8253538-8253560 TCGGGCCGTCCGCCTCCTCGCGG + Intergenic
1176561661 21:8352022-8352044 CCCGGCCAGCCGCCTCCTCCGGG - Intergenic
1176566840 21:8392358-8392380 TCGGGCCGTCCGCCTCCTCGCGG + Intergenic
1176574740 21:8436572-8436594 TCGGGCCGTCCGCCTCCTCGCGG + Intergenic
1176611354 21:8987865-8987887 TCGGGCCGTCCGCCTCCTCGCGG + Intergenic
1176857561 21:13984783-13984805 GCCTGCCCTCCTACTGCTCCAGG - Intergenic
1178403811 21:32308807-32308829 CCCAGCCCTAGTCCTCCTCCTGG - Intronic
1179080556 21:38166709-38166731 CCAGACCCTCCTCCTCCTGCAGG - Intronic
1179234096 21:39529659-39529681 TCAGTCCCTCCACCTCCTCCAGG - Intergenic
1179785700 21:43728546-43728568 GCTGATCCTCCTCCTCCTCCGGG - Intronic
1179860406 21:44185453-44185475 CCCAGCGCCCCTCCTCCTCCTGG + Intergenic
1179906001 21:44423720-44423742 TCGGACCCACCTGCTCCTCCAGG - Exonic
1179930487 21:44568204-44568226 CCCACCCCTCCTCCTGCTCCTGG + Intronic
1180228894 21:46414558-46414580 GCCGCCCACCCTCCTCCTCCTGG + Intronic
1180228908 21:46414597-46414619 CCTGCTCCTCCTCCTCCTCCTGG + Intronic
1180228926 21:46414666-46414688 CCTGCTCCTCCTCCTCCTCCTGG + Intronic
1180837486 22:18937492-18937514 TCCTCCCGTCCTCCACCTCCAGG - Intergenic
1180844927 22:18975758-18975780 TCAGGCCCCTCACCTCCTCCTGG + Intergenic
1180915075 22:19480093-19480115 CCCGGCCCTCCCCTGCCTCCCGG - Intronic
1181121312 22:20669909-20669931 TCCAGCCCTCCTAGTCATCCAGG - Intergenic
1181311193 22:21945877-21945899 GCTCGCCCTCCACCTCCTCCTGG + Exonic
1181334268 22:22116934-22116956 TCCAGCCCTCCTAGTCATCCAGG - Intergenic
1181437399 22:22918711-22918733 TGGGTCCCTCCTCCTCCCCCGGG + Intergenic
1181604270 22:23970935-23970957 TCTGCCCCTCCTCCTCCCCAGGG - Intronic
1182148199 22:28010503-28010525 TCCTGCCCTCCACCTCTTCCTGG + Intronic
1182150097 22:28021732-28021754 TCCCGCCCTCCTGCTCCTCTGGG + Intronic
1182315142 22:29440974-29440996 TAAGGCCCCCCTCTTCCTCCTGG + Intronic
1182353858 22:29713391-29713413 TCCTGCTCTCCTGCTACTCCTGG - Intergenic
1183040497 22:35174253-35174275 TCCTGGCCTCCACCTGCTCCTGG - Intergenic
1183073557 22:35412538-35412560 GACGGAACTCCTCCTCCTCCTGG - Exonic
1183083205 22:35470341-35470363 TCCGTCTCTCCTCTTCATCCTGG - Intergenic
1183278926 22:36922037-36922059 TCCTGGCCTCTGCCTCCTCCAGG - Exonic
1183294616 22:37022259-37022281 TCTGGACTTCCTCCTACTCCAGG + Intronic
1183628220 22:39017706-39017728 CCCTGCACTCCTCCTGCTCCTGG + Intronic
1183684991 22:39356606-39356628 TCCTCCCTCCCTCCTCCTCCTGG - Intronic
1184119038 22:42438447-42438469 TCCATCCTTCCTCCTCCTCCCGG + Intergenic
1184265602 22:43344146-43344168 GCCCGCCCTGCCCCTCCTCCTGG - Intergenic
1184341691 22:43889668-43889690 CCAGGCCCTCCCCCTGCTCCTGG - Intronic
1184388257 22:44188337-44188359 TCAGGGCCTCCTCCTGGTCCCGG + Intronic
1184487959 22:44792516-44792538 CCCTGCCCTCCTGCTCCTCCAGG + Intronic
1184547789 22:45183906-45183928 CCCCGTCTTCCTCCTCCTCCGGG - Intronic
1184682726 22:46080557-46080579 ACCTGCCCTCCTCCCCCACCCGG + Intronic
1184770622 22:46594684-46594706 TCCGGCCCTCCTAGCCCCCCAGG - Intronic
1184814844 22:46861654-46861676 AGCCGCCCTCCTCCCCCTCCTGG - Intronic
1184965080 22:47965658-47965680 CCCGGCCCTCTTCCCCTTCCCGG - Intergenic
1184987729 22:48146751-48146773 CCAGATCCTCCTCCTCCTCCTGG - Intergenic
1185042170 22:48510670-48510692 TGAAGGCCTCCTCCTCCTCCAGG + Intronic
1185264740 22:49894995-49895017 CCTGCCCCTCCTCCTCCTCCTGG - Intergenic
1185330599 22:50250560-50250582 TCCCGCCCCCCTGCTCCTGCTGG - Intronic
1203247577 22_KI270733v1_random:85220-85242 CCCGGCCAGCCGCCTCCTCCGGG - Intergenic
1203252788 22_KI270733v1_random:125623-125645 TCGGGCCGTCCGCCTCCTCGCGG + Intergenic
1203260844 22_KI270733v1_random:170709-170731 TCGGGCCGTCCGCCTCCTCGCGG + Intergenic
1203287579 22_KI270734v1_random:162791-162813 TCCTCCCGTCCTCCACCTCCAGG - Intergenic
949980883 3:9501079-9501101 TCCCAGCCTCTTCCTCCTCCTGG - Exonic
950069836 3:10142974-10142996 TCCTGCTCTCTTCCTTCTCCGGG - Intronic
950570326 3:13795938-13795960 TCCTGCCCTGCTCCTCTTCAGGG - Intergenic
951543940 3:23806930-23806952 CCCTGCCCTCCTTCGCCTCCCGG + Intronic
951569245 3:24044647-24044669 GCCTGCCCTGCTCCTGCTCCAGG - Intergenic
951987667 3:28638801-28638823 AACTGGCCTCCTCCTCCTCCAGG - Intergenic
952577907 3:34796950-34796972 GCTGGCCCTCCCCCTCCTTCAGG + Intergenic
952867273 3:37862235-37862257 ACCGGCCCTCGTCCTCCTTGGGG - Exonic
953137085 3:40190369-40190391 TCGGGCTCTTCTCCACCTCCTGG - Exonic
954596515 3:51829939-51829961 TCAGTCCCTCCTCATTCTCCTGG - Intronic
956401088 3:68880845-68880867 TCCAGCCCTGCTTTTCCTCCAGG - Exonic
961453968 3:127015299-127015321 GCCGGCCCTGCTCCTTCTCCTGG + Exonic
961512052 3:127409227-127409249 TTCCACCATCCTCCTCCTCCCGG + Intergenic
962411335 3:135143944-135143966 TGCAGCCTGCCTCCTCCTCCAGG + Intronic
962933498 3:140058896-140058918 CAGGGCCCTCCCCCTCCTCCTGG - Intronic
963040078 3:141064017-141064039 CCCTGCCCTCCTCTTCCCCCAGG + Intronic
963044050 3:141089484-141089506 TAGGCCCCTCCTTCTCCTCCAGG - Intronic
964417552 3:156463447-156463469 CACTGCCCTCCACCTCCTCCAGG + Intronic
964735410 3:159912126-159912148 TCCAGCCCTGCTACTCATCCTGG + Intergenic
965733041 3:171792549-171792571 ACAGGCCCTCTTCCTTCTCCTGG - Intronic
966711988 3:182980639-182980661 TCCGTCCCTCCGCCTCCCCGAGG - Exonic
967266870 3:187699015-187699037 TCCACCCCTCCTTCTCCTCCCGG - Intronic
967824873 3:193869907-193869929 GCCGGCCCTCCTCGTCTTCCTGG - Intergenic
967930592 3:194687660-194687682 CACGGTTCTCCTCCTCCTCCGGG - Exonic
968081264 3:195848148-195848170 TCCCTCCCTCCTCCACATCCAGG - Intergenic
968661357 4:1800072-1800094 CCCTGGCCTCCTCCTGCTCCTGG - Intronic
968706593 4:2081210-2081232 TCCCGCCCTCTTGCTCCTGCAGG + Intronic
968729132 4:2261574-2261596 GCCTGCGCGCCTCCTCCTCCAGG + Intronic
968975001 4:3817453-3817475 TCCAGACCTCCTTCTCTTCCTGG - Intergenic
969003307 4:3999982-4000004 TCACTGCCTCCTCCTCCTCCTGG - Intergenic
969327351 4:6451727-6451749 TCCTTCCACCCTCCTCCTCCCGG + Intronic
969370158 4:6726930-6726952 TCCTTCTCTCCTCCTCCCCCAGG - Intergenic
969379388 4:6783608-6783630 TGCGGCCCTCCTCCCCCGCCCGG - Intronic
969563774 4:7965723-7965745 CCCGGCCAGCCTCCTGCTCCGGG + Intronic
969580043 4:8059424-8059446 TCCGGTCATCCTCATCTTCCTGG - Intronic
969689873 4:8698535-8698557 CCCTGCCCTCCTCTGCCTCCTGG - Intergenic
969819299 4:9708154-9708176 TCCTGCTCTCCTCCTTCTTCTGG - Intergenic
971279883 4:25234214-25234236 CCCCATCCTCCTCCTCCTCCGGG - Exonic
972050586 4:34727775-34727797 GCCAGCCACCCTCCTCCTCCAGG - Intergenic
973223171 4:47752064-47752086 TCCGGCTCTCCCTCACCTCCCGG + Intronic
973754755 4:54064153-54064175 TCCCGCCCTCGCCCTCCTCCGGG + Intronic
973981856 4:56314441-56314463 TTCGCTCCTCCTCCGCCTCCAGG - Exonic
975890058 4:79016959-79016981 CCAGGCTCTCCTCCTGCTCCAGG - Intergenic
977176891 4:93829211-93829233 CCCGGCCGTCCACCTCGTCCCGG - Exonic
978106431 4:104907201-104907223 TCCGGTTCTACTCCTCTTCCGGG + Intergenic
978126980 4:105146656-105146678 GCCGGCTCTCCTCCTCCGCCCGG - Exonic
978552528 4:109942762-109942784 TCTGGCCCTCCTCCTCCAATAGG - Intronic
978589040 4:110304156-110304178 TCCTTCCCTCCTCCTGCTCAAGG - Intergenic
978885311 4:113761283-113761305 GCCGATCCTCCTCCTCCTGCGGG + Intronic
980063381 4:128155691-128155713 GGCGGCGCTCCTCTTCCTCCGGG - Intronic
981523987 4:145693683-145693705 TCCGGCCAGCCGCCCCCTCCGGG - Intronic
981643575 4:146973053-146973075 TCCAGCCCTTCTCCCCTTCCTGG + Intergenic
982117801 4:152112486-152112508 TCCTGCCCTCCAGCTCCTCAGGG + Intergenic
982860335 4:160440788-160440810 TCCTGCCCGCCTCAGCCTCCGGG + Intergenic
984581143 4:181511423-181511445 TCCTTCTGTCCTCCTCCTCCAGG - Intergenic
984699203 4:182807643-182807665 TCCGGGCCTCCTGGTCATCCCGG - Intergenic
984850085 4:184145049-184145071 TCACCTCCTCCTCCTCCTCCTGG - Intronic
985027990 4:185758430-185758452 TAGGGTTCTCCTCCTCCTCCTGG + Intronic
985451502 4:190066009-190066031 TCCGCCCCGCCCCCTCCACCGGG + Intergenic
985452492 4:190069302-190069324 TCCGCCCCGCCCCCTCCACCGGG + Intergenic
985453477 4:190072599-190072621 TCCGCCCCGCCCCCTCCACCGGG + Intronic
985454467 4:190075892-190075914 TCCGCCCCGCCCCCTCCACCGGG + Intronic
985455455 4:190079185-190079207 TCCGCCCCGCCCCCTCCACCGGG + Intronic
985456440 4:190082479-190082501 TCCGCCCCGCCCCCTCCACCGGG + Intronic
985457427 4:190085779-190085801 TCCGCCCCGCCCCCTCCACCGGG + Intergenic
985458414 4:190089072-190089094 TCCGCCCCGCCCCCTCCACCGGG + Intronic
985459403 4:190092372-190092394 TCCGCCCCGCCCCCTCCACCGGG + Intronic
985463655 4:190175141-190175163 TCCGCCCCGCCCCCTCCACCGGG + Exonic
985702333 5:1381112-1381134 ACCCGCCGCCCTCCTCCTCCTGG + Intergenic
985763629 5:1764979-1765001 GGAGCCCCTCCTCCTCCTCCTGG + Intergenic
985843268 5:2325634-2325656 TCCCGCCCTCCCCATCGTCCTGG - Intergenic
986415276 5:7521999-7522021 TATGGCCTTCCTCCTCTTCCTGG - Intronic
986669832 5:10132888-10132910 TCCTGCCCTTCTCCTTCTCCTGG + Intergenic
987047833 5:14124186-14124208 TTCTGCCCTTCTCTTCCTCCAGG - Intergenic
988298842 5:29396065-29396087 GCTACCCCTCCTCCTCCTCCAGG + Intergenic
989110495 5:37902387-37902409 TCTGCCCTTCCTCCTCCTCTGGG + Intergenic
990345032 5:54863472-54863494 TCTGCCACTCCTCCACCTCCTGG + Intergenic
991950211 5:71939799-71939821 TCCAGTCCTCCTCATCCTCCAGG + Intergenic
993210972 5:84951009-84951031 TCCAGCCCATCTCCTCTTCCTGG - Intergenic
994072670 5:95620247-95620269 TCGGTGCCTCCTCTTCCTCCGGG + Exonic
994986663 5:106941879-106941901 TCCTTCCCTACTCCACCTCCTGG + Intergenic
996184927 5:120464052-120464074 TCCTGCCCGCCCCCTCCTCTTGG - Intergenic
996404916 5:123095176-123095198 CCCGGCCCTCCTCCTCTACCCGG - Intronic
997579044 5:135005834-135005856 TCCTCCCTGCCTCCTCCTCCTGG + Intronic
997681094 5:135751227-135751249 TCAGGCCCTCCTCCTTCTCCTGG + Intergenic
997768058 5:136524929-136524951 TCCAGCTCTTCTCCTCCTCATGG + Intergenic
998093318 5:139383223-139383245 TCCGGCCCTCGAGGTCCTCCTGG + Exonic
998364289 5:141618851-141618873 TCCGGCCCTTCTTCTTGTCCCGG + Exonic
998379987 5:141717491-141717513 TCTCCCCCTCCTCCTCCTTCAGG - Intergenic
999079280 5:148827569-148827591 TCCGCCCATCCTGCTCCACCTGG - Exonic
999096027 5:148978979-148979001 TCCCTGCCTCCTCCTCATCCAGG - Intronic
999514336 5:152285848-152285870 TCCTGCCCCCTTCCTTCTCCTGG - Intergenic
1000086263 5:157889968-157889990 GCCAGCCCTCTTCCTCCACCAGG - Intergenic
1002044846 5:176536191-176536213 TCCGGCCCTCAGCGGCCTCCAGG - Intronic
1002055880 5:176597660-176597682 CCAAGCCGTCCTCCTCCTCCAGG - Exonic
1002184487 5:177447664-177447686 TGCATCCCTCCTCCTCCTCACGG + Intronic
1002449370 5:179310216-179310238 GACGGCCCTCCTCCCCCACCAGG + Intronic
1002617922 5:180467095-180467117 TCAGCCCTGCCTCCTCCTCCAGG - Intergenic
1002636497 5:180611461-180611483 TGCAGACCTCCTCTTCCTCCTGG + Exonic
1002644319 5:180645700-180645722 TGGCGCCCTGCTCCTCCTCCGGG + Intronic
1002711870 5:181200000-181200022 GCCGACCCTCCTGCTCCACCAGG + Exonic
1003188145 6:3850282-3850304 GCCGGTTCTCCTCCTCCTCGCGG - Exonic
1003926626 6:10882958-10882980 TTCCGCCCCCCACCTCCTCCAGG - Intronic
1004274614 6:14224704-14224726 TCCGGCCTTCCTTCTTCTGCGGG + Intergenic
1004395699 6:15245256-15245278 GCCGGCCCTCCTCCGCCCCCCGG - Intergenic
1004924499 6:20403773-20403795 GCCGGCCCCCCACCTCCCCCCGG + Intronic
1005993794 6:30919908-30919930 TCCCACCTTCCTCTTCCTCCTGG - Intronic
1006296710 6:33173076-33173098 ACCGGCCCCCCTGGTCCTCCAGG - Exonic
1006396129 6:33788775-33788797 TCCGGCCCTCCGCGGCTTCCTGG - Exonic
1006845672 6:37059789-37059811 CCTGTCTCTCCTCCTCCTCCAGG - Intergenic
1008367530 6:50699719-50699741 TCAGACCCTCCTCCTTCCCCTGG + Intergenic
1008552552 6:52646961-52646983 TCCTGCCTTCCACTTCCTCCAGG + Intergenic
1010044126 6:71420619-71420641 TTCTCCCCTCCTCCTCCTGCCGG - Intergenic
1012382765 6:98640102-98640124 TGTGGGCTTCCTCCTCCTCCTGG + Intergenic
1012739569 6:102998805-102998827 TCCTGCCCTCTTCCTTTTCCAGG - Intergenic
1012983065 6:105850264-105850286 TGCGGCCCTGCCCTTCCTCCTGG - Intergenic
1016806772 6:148219626-148219648 TCTGGCCTTCCTCCTCCTTCTGG + Intergenic
1017748673 6:157469806-157469828 TCCGGCTCTGCTCCACTTCCGGG - Intronic
1017816095 6:158017750-158017772 TCGGGACCTGCTCCTCCTGCAGG + Intronic
1017913310 6:158813541-158813563 TCCACCCCTCCTCCTCCACGAGG - Intronic
1018854518 6:167666116-167666138 TTCGGCCCCAATCCTCCTCCTGG - Intergenic
1019062471 6:169266154-169266176 TCCTCCCCTCCCTCTCCTCCTGG - Intergenic
1019159774 6:170062279-170062301 TCCAGCCATCCTCCTCCCACAGG + Intergenic
1019341825 7:512107-512129 CCCAGCCCGCCTGCTCCTCCTGG - Intronic
1019547538 7:1585750-1585772 CACGGCCCTCTTCCTGCTCCGGG - Intergenic
1019708647 7:2508344-2508366 CCCGACCCGCCTCCTCCTTCCGG + Intergenic
1019780675 7:2938008-2938030 CCAGGTCCTCCTTCTCCTCCAGG + Exonic
1020116744 7:5480339-5480361 TTCTGCCGTCCTCCACCTCCAGG - Intronic
1020212129 7:6165286-6165308 TCCACTCCTCCTTCTCCTCCGGG + Exonic
1020679482 7:11219384-11219406 TGCGGCCCTGCTTCTGCTCCTGG - Intergenic
1023019786 7:36001167-36001189 TCCCTCCCCCCTCCTCCCCCTGG + Intergenic
1023879320 7:44309396-44309418 CCCAGCCCTCCTGCTCCTGCTGG - Intronic
1024995185 7:55268760-55268782 TCTGGCCCTCCTGCCTCTCCTGG - Intergenic
1025181822 7:56827294-56827316 TCGGGCCCAGCTCTTCCTCCTGG - Intergenic
1025739205 7:64182655-64182677 CCCTGCCCACATCCTCCTCCGGG + Intronic
1025769923 7:64495074-64495096 CCCGCCCCTCCTCCTTCCCCTGG + Intergenic
1025977283 7:66378988-66379010 TCAGGCCCAGCTCTTCCTCCTGG - Intronic
1026598594 7:71754468-71754490 TCCCCTCCTCCCCCTCCTCCCGG + Intergenic
1026833266 7:73622916-73622938 GCCGGCACTCCTCCTCCTAAGGG - Intronic
1028163824 7:87515320-87515342 TCTGGCCCTTCTTCACCTCCAGG + Exonic
1028754814 7:94422963-94422985 TCTGGCCCTCCTGGTCCCCCTGG + Exonic
1029207729 7:98879170-98879192 GCCGGGCCTGCTCCTACTCCTGG - Intronic
1029419903 7:100467114-100467136 TCAGCACCTCCACCTCCTCCCGG + Exonic
1029690420 7:102177653-102177675 TCCCCACCTCCTCCTCCTCCAGG + Intronic
1032214702 7:129948979-129949001 TCCTCCCCTCCTCCTTTTCCGGG + Intronic
1032391263 7:131556683-131556705 CCCGCCCCTCCCCCTCCCCCAGG + Intronic
1032423738 7:131803533-131803555 TCTGGCCCTCCTCCTTCTCCTGG - Intergenic
1033336587 7:140458485-140458507 TCCAGCCTTCCTCCAGCTCCTGG - Intronic
1033842387 7:145390108-145390130 TCCAGCTCTACTCCTCCCCCAGG - Intergenic
1034307927 7:150060953-150060975 TTCTGCCCTCCCCTTCCTCCTGG - Intergenic
1034400296 7:150857447-150857469 TCCGGCTGCGCTCCTCCTCCGGG + Exonic
1034556451 7:151853221-151853243 GCAGCCCCTCCTCCTCCTCCAGG - Intronic
1034798926 7:154039716-154039738 TTCTGCCCTCCCCTTCCTCCTGG + Intronic
1034997556 7:155587684-155587706 TCCAGGCCTCCTCCTGCCCCTGG + Intergenic
1035242201 7:157539620-157539642 ACCGGCCCTGCCCCTCTTCCCGG - Exonic
1035264643 7:157684448-157684470 CCCGCCCCTCCTCCCTCTCCCGG - Intronic
1035414794 7:158673830-158673852 TCAGTCCCTCTTCTTCCTCCTGG - Intronic
1035474949 7:159136706-159136728 TCGGGGCCTCCTCCTTTTCCTGG - Intronic
1035553028 8:544694-544716 GCAGGCCGTCCTCCTCCTCGGGG + Exonic
1035660096 8:1341075-1341097 TCCCACCCTCCTCCTCCCACAGG - Intergenic
1036130945 8:6109441-6109463 GCAGTCTCTCCTCCTCCTCCAGG - Intergenic
1036821355 8:11942501-11942523 TCCCTGCCTGCTCCTCCTCCTGG - Intergenic
1037967340 8:23145071-23145093 TCGGGACCTCCTCCACCACCTGG + Exonic
1038271512 8:26079541-26079563 ACTGCCCCTCCTCATCCTCCTGG + Intergenic
1039825688 8:41172314-41172336 TCCTGACCTCCTGATCCTCCTGG + Intergenic
1040548729 8:48422322-48422344 CAGGTCCCTCCTCCTCCTCCTGG - Intergenic
1041317086 8:56575305-56575327 TCCAGCCTTCCTCCCCTTCCTGG + Intergenic
1042200931 8:66278883-66278905 TCCAGCCCTCTTTCTCCACCTGG + Intergenic
1042529487 8:69800345-69800367 TCTTCTCCTCCTCCTCCTCCTGG - Intronic
1044340540 8:91041273-91041295 TCAGTCCCTCCTCCTCCTTAGGG - Intergenic
1047259195 8:123241074-123241096 GCCGTCCCTCCTCCTCCACGGGG - Intronic
1048073017 8:131040903-131040925 TCCGCCCCTGCTCCCCATCCCGG - Exonic
1048963413 8:139598096-139598118 TCTGGCTATCCTCATCCTCCTGG - Intergenic
1049198045 8:141326105-141326127 TCCGCCCCTCCTTGTCCCCCCGG - Intergenic
1049367294 8:142246521-142246543 TCCAGGCTGCCTCCTCCTCCAGG - Intronic
1049433893 8:142577444-142577466 TCAGGCCCTCCCCGTCCTGCAGG + Intergenic
1049451789 8:142665944-142665966 TCCGGCTCTCGCCCTTCTCCAGG + Exonic
1049989731 9:979246-979268 GCCCTCACTCCTCCTCCTCCTGG - Intronic
1054820613 9:69516994-69517016 CCCCGCGCTCCTCTTCCTCCTGG + Exonic
1055955915 9:81773435-81773457 TCACCCCATCCTCCTCCTCCCGG + Intergenic
1056564243 9:87758713-87758735 TCCGGCCAGCCTCCCCGTCCGGG - Intergenic
1057141278 9:92728113-92728135 CCTGGCTCTCCTCCTCCTGCTGG + Intronic
1057444864 9:95106731-95106753 TGCTGCTCTCCTCCTCCTCATGG - Intronic
1057497365 9:95571827-95571849 CCCTCTCCTCCTCCTCCTCCTGG - Intergenic
1057593099 9:96390973-96390995 TCCTCCCCTCCTCTTTCTCCTGG - Intronic
1058852629 9:109027465-109027487 TCCAGACCTTTTCCTCCTCCTGG + Intronic
1060401061 9:123349874-123349896 TCTGGGCCACCTCCTCCTTCAGG - Intergenic
1061386888 9:130295673-130295695 TGAGGCCCTCGTCCTCCTGCAGG - Intronic
1061540976 9:131277694-131277716 CCCGGCCCCCACCCTCCTCCCGG + Intergenic
1061670816 9:132187159-132187181 ACCGCCCCTGCTCCTCCCCCAGG - Intronic
1061924302 9:133798415-133798437 TCCTGCCCACCGCCTCCTCCTGG + Intronic
1062022448 9:134326011-134326033 CCCGGCTCTCCGCCTCCTCCGGG + Intronic
1062141985 9:134964331-134964353 TCCATCCCTCCTCCTCCACTGGG - Intergenic
1062190793 9:135246894-135246916 TCCCCTCCTCCTCCTCCTCCCGG - Intergenic
1062230656 9:135479943-135479965 CCCGGCCCGCCGCCTCCCCCGGG + Exonic
1062253977 9:135612512-135612534 TCCATCCCTCTTCCTCCTTCTGG - Intergenic
1062394563 9:136347608-136347630 TCCGTCCCGCCGCCTCCTCAGGG + Intronic
1062535146 9:137018160-137018182 TCCGGGCCTGCTCCTCACCCTGG + Exonic
1062546259 9:137064956-137064978 CCCTGCCCCCGTCCTCCTCCGGG - Exonic
1062574380 9:137199672-137199694 TCCGGGGCTCCTCCTCCTGAGGG - Exonic
1203463983 Un_GL000220v1:68455-68477 CCCGGCCAGCCGCCTCCTCCGGG - Intergenic
1203469191 Un_GL000220v1:108774-108796 TCGGGCCGTCCGCCTCCTCGCGG + Intergenic
1203477012 Un_GL000220v1:152746-152768 TCGGGCCGTCCGCCTCCTCGCGG + Intergenic
1186192303 X:7077448-7077470 TCCTTCCCTCCTCCTCCCCAGGG - Exonic
1187126311 X:16457590-16457612 TCCTTTCCTCCTCCTCCTCTTGG - Intergenic
1187447687 X:19373182-19373204 TTCCGGCCCCCTCCTCCTCCTGG - Intronic
1189607726 X:42697737-42697759 TCCTGCCCTTCCCCTTCTCCAGG - Intergenic
1190136585 X:47804472-47804494 CCTCCCCCTCCTCCTCCTCCGGG + Intergenic
1190338130 X:49275317-49275339 TCTGGCCCTTCTCTTTCTCCTGG + Intronic
1190727426 X:53198770-53198792 TCCGCCCATCCTCCACCTCCAGG + Exonic
1190780475 X:53589783-53589805 TCCGTTCCTCTTCCTCCTTCCGG + Exonic
1191213091 X:57909676-57909698 CCAGGCCCTCCGCCTCCTCCTGG + Exonic
1192369090 X:70498660-70498682 TCAAGCCTTCCTCCTCCTCCAGG - Intronic
1193620680 X:83749942-83749964 CCTCGTCCTCCTCCTCCTCCTGG + Intergenic
1195011016 X:100732103-100732125 GCCGGCCCTTCTCACCCTCCCGG + Intronic
1197281771 X:124545255-124545277 TAATGCCCTTCTCCTCCTCCTGG - Intronic
1197641853 X:128976062-128976084 GCCTGCCCTGCTCCTGCTCCTGG + Intergenic
1197724513 X:129767765-129767787 TCTGTCCCTGCCCCTCCTCCAGG + Intronic
1199600686 X:149539788-149539810 CCCCGCCCTGCTCCTCCTCCAGG + Intergenic
1199649857 X:149940002-149940024 CCTCGCCCTGCTCCTCCTCCAGG - Intergenic
1199767934 X:150954107-150954129 TCCTGGCCTCCTCCTCCATCTGG - Intergenic
1199977135 X:152900706-152900728 TCAGCCCCTCCTCCTCTTCCCGG - Intergenic
1200149076 X:153942721-153942743 TCAGGCCCTCCACCTTCCCCAGG + Intronic
1200216511 X:154370505-154370527 CCCGGGCCTCCTCCTCCTCGGGG + Intronic
1200253215 X:154564736-154564758 TCCCTCCCTCTTCCTCCACCCGG + Exonic
1200264552 X:154639679-154639701 TCCCTCCCTCTTCCTCCACCCGG - Intergenic
1201291008 Y:12420994-12421016 GCCGCCCCTCCTCCCCGTCCCGG + Intergenic