ID: 1085016976

View in Genome Browser
Species Human (GRCh38)
Location 11:73180302-73180324
Sequence TTGGGAAAGTTGGGAGATAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085016976_1085016987 11 Left 1085016976 11:73180302-73180324 CCTATATCTCCCAACTTTCCCAA No data
Right 1085016987 11:73180336-73180358 CAGCTATTTTGGGGAGTTTGGGG No data
1085016976_1085016982 0 Left 1085016976 11:73180302-73180324 CCTATATCTCCCAACTTTCCCAA No data
Right 1085016982 11:73180325-73180347 AATGGATTTTACAGCTATTTTGG No data
1085016976_1085016985 9 Left 1085016976 11:73180302-73180324 CCTATATCTCCCAACTTTCCCAA No data
Right 1085016985 11:73180334-73180356 TACAGCTATTTTGGGGAGTTTGG No data
1085016976_1085016988 12 Left 1085016976 11:73180302-73180324 CCTATATCTCCCAACTTTCCCAA No data
Right 1085016988 11:73180337-73180359 AGCTATTTTGGGGAGTTTGGGGG No data
1085016976_1085016984 2 Left 1085016976 11:73180302-73180324 CCTATATCTCCCAACTTTCCCAA No data
Right 1085016984 11:73180327-73180349 TGGATTTTACAGCTATTTTGGGG No data
1085016976_1085016986 10 Left 1085016976 11:73180302-73180324 CCTATATCTCCCAACTTTCCCAA No data
Right 1085016986 11:73180335-73180357 ACAGCTATTTTGGGGAGTTTGGG No data
1085016976_1085016983 1 Left 1085016976 11:73180302-73180324 CCTATATCTCCCAACTTTCCCAA No data
Right 1085016983 11:73180326-73180348 ATGGATTTTACAGCTATTTTGGG No data
1085016976_1085016991 25 Left 1085016976 11:73180302-73180324 CCTATATCTCCCAACTTTCCCAA No data
Right 1085016991 11:73180350-73180372 AGTTTGGGGGAGTATGGAGGAGG No data
1085016976_1085016989 19 Left 1085016976 11:73180302-73180324 CCTATATCTCCCAACTTTCCCAA No data
Right 1085016989 11:73180344-73180366 TTGGGGAGTTTGGGGGAGTATGG No data
1085016976_1085016990 22 Left 1085016976 11:73180302-73180324 CCTATATCTCCCAACTTTCCCAA No data
Right 1085016990 11:73180347-73180369 GGGAGTTTGGGGGAGTATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085016976 Original CRISPR TTGGGAAAGTTGGGAGATAT AGG (reversed) Intergenic
No off target data available for this crispr