ID: 1085016980

View in Genome Browser
Species Human (GRCh38)
Location 11:73180320-73180342
Sequence ATAGCTGTAAAATCCATTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085016980_1085016991 7 Left 1085016980 11:73180320-73180342 CCCAAAATGGATTTTACAGCTAT No data
Right 1085016991 11:73180350-73180372 AGTTTGGGGGAGTATGGAGGAGG No data
1085016980_1085016990 4 Left 1085016980 11:73180320-73180342 CCCAAAATGGATTTTACAGCTAT No data
Right 1085016990 11:73180347-73180369 GGGAGTTTGGGGGAGTATGGAGG No data
1085016980_1085016985 -9 Left 1085016980 11:73180320-73180342 CCCAAAATGGATTTTACAGCTAT No data
Right 1085016985 11:73180334-73180356 TACAGCTATTTTGGGGAGTTTGG No data
1085016980_1085016986 -8 Left 1085016980 11:73180320-73180342 CCCAAAATGGATTTTACAGCTAT No data
Right 1085016986 11:73180335-73180357 ACAGCTATTTTGGGGAGTTTGGG No data
1085016980_1085016989 1 Left 1085016980 11:73180320-73180342 CCCAAAATGGATTTTACAGCTAT No data
Right 1085016989 11:73180344-73180366 TTGGGGAGTTTGGGGGAGTATGG No data
1085016980_1085016988 -6 Left 1085016980 11:73180320-73180342 CCCAAAATGGATTTTACAGCTAT No data
Right 1085016988 11:73180337-73180359 AGCTATTTTGGGGAGTTTGGGGG No data
1085016980_1085016987 -7 Left 1085016980 11:73180320-73180342 CCCAAAATGGATTTTACAGCTAT No data
Right 1085016987 11:73180336-73180358 CAGCTATTTTGGGGAGTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085016980 Original CRISPR ATAGCTGTAAAATCCATTTT GGG (reversed) Intergenic
No off target data available for this crispr