ID: 1085016991

View in Genome Browser
Species Human (GRCh38)
Location 11:73180350-73180372
Sequence AGTTTGGGGGAGTATGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085016980_1085016991 7 Left 1085016980 11:73180320-73180342 CCCAAAATGGATTTTACAGCTAT No data
Right 1085016991 11:73180350-73180372 AGTTTGGGGGAGTATGGAGGAGG No data
1085016976_1085016991 25 Left 1085016976 11:73180302-73180324 CCTATATCTCCCAACTTTCCCAA No data
Right 1085016991 11:73180350-73180372 AGTTTGGGGGAGTATGGAGGAGG No data
1085016978_1085016991 16 Left 1085016978 11:73180311-73180333 CCCAACTTTCCCAAAATGGATTT No data
Right 1085016991 11:73180350-73180372 AGTTTGGGGGAGTATGGAGGAGG No data
1085016979_1085016991 15 Left 1085016979 11:73180312-73180334 CCAACTTTCCCAAAATGGATTTT No data
Right 1085016991 11:73180350-73180372 AGTTTGGGGGAGTATGGAGGAGG No data
1085016981_1085016991 6 Left 1085016981 11:73180321-73180343 CCAAAATGGATTTTACAGCTATT No data
Right 1085016991 11:73180350-73180372 AGTTTGGGGGAGTATGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085016991 Original CRISPR AGTTTGGGGGAGTATGGAGG AGG Intergenic
No off target data available for this crispr