ID: 1085021491

View in Genome Browser
Species Human (GRCh38)
Location 11:73213008-73213030
Sequence CTGTGGGCATGGAGGAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085021482_1085021491 23 Left 1085021482 11:73212962-73212984 CCCAACATGTGTAGATTAACAGG No data
Right 1085021491 11:73213008-73213030 CTGTGGGCATGGAGGAAAGCTGG No data
1085021484_1085021491 22 Left 1085021484 11:73212963-73212985 CCAACATGTGTAGATTAACAGGT No data
Right 1085021491 11:73213008-73213030 CTGTGGGCATGGAGGAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085021491 Original CRISPR CTGTGGGCATGGAGGAAAGC TGG Intergenic
No off target data available for this crispr