ID: 1085021807

View in Genome Browser
Species Human (GRCh38)
Location 11:73214729-73214751
Sequence GTAGAGAAACAGGTTCAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085021807_1085021811 21 Left 1085021807 11:73214729-73214751 CCTTTCTGAACCTGTTTCTCTAC No data
Right 1085021811 11:73214773-73214795 ATGCCTATCTCACAGGGTTCTGG No data
1085021807_1085021809 14 Left 1085021807 11:73214729-73214751 CCTTTCTGAACCTGTTTCTCTAC No data
Right 1085021809 11:73214766-73214788 TAAAATAATGCCTATCTCACAGG No data
1085021807_1085021810 15 Left 1085021807 11:73214729-73214751 CCTTTCTGAACCTGTTTCTCTAC No data
Right 1085021810 11:73214767-73214789 AAAATAATGCCTATCTCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085021807 Original CRISPR GTAGAGAAACAGGTTCAGAA AGG (reversed) Intergenic
No off target data available for this crispr