ID: 1085021811

View in Genome Browser
Species Human (GRCh38)
Location 11:73214773-73214795
Sequence ATGCCTATCTCACAGGGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085021808_1085021811 11 Left 1085021808 11:73214739-73214761 CCTGTTTCTCTACATGTCACATG No data
Right 1085021811 11:73214773-73214795 ATGCCTATCTCACAGGGTTCTGG No data
1085021805_1085021811 23 Left 1085021805 11:73214727-73214749 CCCCTTTCTGAACCTGTTTCTCT No data
Right 1085021811 11:73214773-73214795 ATGCCTATCTCACAGGGTTCTGG No data
1085021806_1085021811 22 Left 1085021806 11:73214728-73214750 CCCTTTCTGAACCTGTTTCTCTA No data
Right 1085021811 11:73214773-73214795 ATGCCTATCTCACAGGGTTCTGG No data
1085021807_1085021811 21 Left 1085021807 11:73214729-73214751 CCTTTCTGAACCTGTTTCTCTAC No data
Right 1085021811 11:73214773-73214795 ATGCCTATCTCACAGGGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085021811 Original CRISPR ATGCCTATCTCACAGGGTTC TGG Intergenic
No off target data available for this crispr