ID: 1085022493

View in Genome Browser
Species Human (GRCh38)
Location 11:73218271-73218293
Sequence CCCCGAAGCCGGGCCAGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 298}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085022493_1085022503 -5 Left 1085022493 11:73218271-73218293 CCCTGCCTGGCCCGGCTTCGGGG 0: 1
1: 0
2: 2
3: 31
4: 298
Right 1085022503 11:73218289-73218311 CGGGGTTGGGGAACAGCGCAGGG 0: 1
1: 0
2: 1
3: 9
4: 209
1085022493_1085022506 2 Left 1085022493 11:73218271-73218293 CCCTGCCTGGCCCGGCTTCGGGG 0: 1
1: 0
2: 2
3: 31
4: 298
Right 1085022506 11:73218296-73218318 GGGGAACAGCGCAGGGAGGTGGG 0: 1
1: 0
2: 3
3: 28
4: 416
1085022493_1085022507 9 Left 1085022493 11:73218271-73218293 CCCTGCCTGGCCCGGCTTCGGGG 0: 1
1: 0
2: 2
3: 31
4: 298
Right 1085022507 11:73218303-73218325 AGCGCAGGGAGGTGGGTAGCCGG 0: 1
1: 0
2: 2
3: 28
4: 344
1085022493_1085022502 -6 Left 1085022493 11:73218271-73218293 CCCTGCCTGGCCCGGCTTCGGGG 0: 1
1: 0
2: 2
3: 31
4: 298
Right 1085022502 11:73218288-73218310 TCGGGGTTGGGGAACAGCGCAGG 0: 1
1: 0
2: 1
3: 11
4: 142
1085022493_1085022511 26 Left 1085022493 11:73218271-73218293 CCCTGCCTGGCCCGGCTTCGGGG 0: 1
1: 0
2: 2
3: 31
4: 298
Right 1085022511 11:73218320-73218342 AGCCGGGCTCCCAGGCACGTGGG 0: 1
1: 0
2: 1
3: 17
4: 145
1085022493_1085022504 -2 Left 1085022493 11:73218271-73218293 CCCTGCCTGGCCCGGCTTCGGGG 0: 1
1: 0
2: 2
3: 31
4: 298
Right 1085022504 11:73218292-73218314 GGTTGGGGAACAGCGCAGGGAGG 0: 1
1: 0
2: 0
3: 23
4: 354
1085022493_1085022505 1 Left 1085022493 11:73218271-73218293 CCCTGCCTGGCCCGGCTTCGGGG 0: 1
1: 0
2: 2
3: 31
4: 298
Right 1085022505 11:73218295-73218317 TGGGGAACAGCGCAGGGAGGTGG 0: 1
1: 1
2: 1
3: 61
4: 557
1085022493_1085022510 25 Left 1085022493 11:73218271-73218293 CCCTGCCTGGCCCGGCTTCGGGG 0: 1
1: 0
2: 2
3: 31
4: 298
Right 1085022510 11:73218319-73218341 TAGCCGGGCTCCCAGGCACGTGG 0: 1
1: 0
2: 0
3: 11
4: 218
1085022493_1085022508 10 Left 1085022493 11:73218271-73218293 CCCTGCCTGGCCCGGCTTCGGGG 0: 1
1: 0
2: 2
3: 31
4: 298
Right 1085022508 11:73218304-73218326 GCGCAGGGAGGTGGGTAGCCGGG 0: 1
1: 0
2: 2
3: 88
4: 397
1085022493_1085022509 18 Left 1085022493 11:73218271-73218293 CCCTGCCTGGCCCGGCTTCGGGG 0: 1
1: 0
2: 2
3: 31
4: 298
Right 1085022509 11:73218312-73218334 AGGTGGGTAGCCGGGCTCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085022493 Original CRISPR CCCCGAAGCCGGGCCAGGCA GGG (reversed) Intergenic
900250880 1:1668770-1668792 CCCCAATGCGGGGCCGGGCATGG + Intronic
900298492 1:1964861-1964883 GCCCGCAGCTGGGCCAGGAACGG - Intronic
900665259 1:3810926-3810948 CCCTGGAGCAGGGCCAGGCAGGG - Intergenic
901070898 1:6517788-6517810 CCCCGAGGCCAGGCCAGGCCAGG + Intronic
902431493 1:16367117-16367139 CCCGGAAGAGGCGCCAGGCAAGG - Exonic
902636400 1:17737605-17737627 CCCTGACTCTGGGCCAGGCATGG - Intergenic
902793462 1:18784760-18784782 CCCCGAGGCTGGGCTTGGCATGG - Intergenic
903035624 1:20490883-20490905 CCCCAAAGCCCTGCCAGGCTCGG + Intergenic
904738909 1:32656640-32656662 ACCTGCAGCTGGGCCAGGCATGG - Intronic
904898507 1:33836820-33836842 AGCCGAAGCAGGGCGAGGCATGG - Intronic
905033740 1:34904330-34904352 CCCGGGGGCCGGGCCAGGCAAGG - Exonic
905510966 1:38519801-38519823 CCCAGAAGCCTGGCCAGCCTGGG + Intergenic
905671629 1:39794392-39794414 GTCAGAAGACGGGCCAGGCATGG + Intergenic
906618519 1:47253886-47253908 CCCTGAAACCAGGCCAGGCATGG + Intronic
907021651 1:51072201-51072223 GCCCGAAGCCAGGCCAGGCCTGG - Intergenic
907212264 1:52833946-52833968 CAAGGGAGCCGGGCCAGGCAAGG + Intergenic
907540978 1:55215246-55215268 CGCAGCAGCCGGGCCAGGCTGGG + Intergenic
908401308 1:63774671-63774693 CCCCGGAGCCCCGCCAGGCCAGG + Intronic
911188729 1:94927346-94927368 CCCCGCCCCCGGGCTAGGCAGGG + Intergenic
913583850 1:120253809-120253831 CCCCGAAACAGTACCAGGCAAGG + Intergenic
913624323 1:120644511-120644533 CCCCGAAACAGTACCAGGCAAGG - Intergenic
914418437 1:147506011-147506033 CCCCTAAGCAGCGCCAGGTATGG - Intergenic
914565838 1:148865645-148865667 CCCCGAAACAGTACCAGGCAAGG + Intronic
914606987 1:149264603-149264625 CCCCGAAACAGTACCAGGCAAGG - Intergenic
914679822 1:149931279-149931301 CCCCCAAGCCGAGTCAGGAAGGG + Exonic
915549852 1:156625537-156625559 CCCCGCCGCCGGGCCAGCCGGGG - Exonic
915686186 1:157636976-157636998 CCCCGTGGGCAGGCCAGGCATGG - Intergenic
915824599 1:159061693-159061715 CCCTGTATCCAGGCCAGGCACGG - Intergenic
920066340 1:203272567-203272589 TCCTGAAGCCAGGCCAGGCTGGG - Intronic
920874960 1:209826303-209826325 CCCAGCAGCTGGGCCAGCCAAGG - Intergenic
921163752 1:212491193-212491215 CCCGGAAGCAGGGCAAGGCAGGG - Intergenic
923171440 1:231421450-231421472 TGCCGAAGCCGAGCCCGGCAAGG - Exonic
924393631 1:243592043-243592065 ACCCTAAGCCTGGCCAGGCACGG + Intronic
924757108 1:246951436-246951458 ACCAGAAGCTGGGCGAGGCAAGG + Intronic
1062829124 10:593600-593622 CCCAAAAGCTGGGCCAAGCATGG + Intronic
1064226850 10:13494126-13494148 CTGAGATGCCGGGCCAGGCATGG + Intronic
1064791436 10:18960961-18960983 GCCTGAAGCAGGGCCAGGGAGGG - Intergenic
1066059433 10:31708792-31708814 CCCCAAGGGCGGGCCATGCATGG + Intergenic
1066063974 10:31749411-31749433 CCCCGGGGCCGTGCCAGGCCAGG + Intergenic
1067792700 10:49299833-49299855 CCCCAGCGCTGGGCCAGGCAGGG + Intronic
1070255954 10:74813465-74813487 CCCCGAAGCCACCCCAGGCGCGG - Intergenic
1071533940 10:86411965-86411987 CCACGATGCCCGGCCAGGCCTGG - Intergenic
1071603100 10:86968535-86968557 CCCCGAAGCCATGGCAAGCAAGG + Exonic
1072051900 10:91713041-91713063 CCCAGAAGCCGGAAGAGGCAAGG + Intergenic
1072651893 10:97302452-97302474 CCCAGAAGACAGGCCTGGCATGG + Intergenic
1073327931 10:102653205-102653227 CCCCGTAGCCAGGACAGGGAGGG + Intronic
1076372963 10:129966897-129966919 CACCGCAGCCAGGCCAGGGATGG + Intergenic
1076908281 10:133373789-133373811 CCCAGGCGCAGGGCCAGGCACGG + Intergenic
1077100107 11:818926-818948 CCCCAAAGCCTGAACAGGCAGGG + Exonic
1077325840 11:1963657-1963679 CCCCTTAGCCGGGCCAGTCCCGG + Intronic
1077524771 11:3057448-3057470 CCCGGAAGACGGGCCCGGCGTGG - Intronic
1078979831 11:16520657-16520679 AGCCGAAGCAGGGCGAGGCATGG + Intronic
1079122840 11:17697355-17697377 TCCCGAGGCAGGGCCAGGGAAGG - Intergenic
1079271171 11:18987299-18987321 CACAGAAGCCGGGGCAGGAAGGG - Intergenic
1079291898 11:19195976-19195998 TCCTGAATCCAGGCCAGGCATGG + Intronic
1081794701 11:45811348-45811370 CCCCGGGGCCGGGCCATCCAGGG - Exonic
1083476418 11:62918581-62918603 CCCTGCAGCCGGGTGAGGCAGGG - Intronic
1083620718 11:64048114-64048136 CCCAGAAGCAGGGCCGGGCAGGG + Intronic
1083718632 11:64593027-64593049 CCCTGCAGCCGTGCCAGGTAGGG + Intronic
1084526337 11:69700764-69700786 CCCCCAGGCCAGGCCAGGCCAGG + Intronic
1084588901 11:70078968-70078990 CTCCGAGGCCGGGCCATGCCTGG - Intronic
1084604580 11:70165098-70165120 CCCAGAAGCTGGGAGAGGCAAGG - Intronic
1084951826 11:72670720-72670742 CCCTGAAGTAGGGCCAGGCTGGG - Intronic
1085022493 11:73218271-73218293 CCCCGAAGCCGGGCCAGGCAGGG - Intergenic
1085405701 11:76260472-76260494 CCCCCAGGCCGTGCCAGGCCAGG + Intergenic
1085519747 11:77130979-77131001 TCCCAAAGCCAGGCCAGGAAGGG + Intronic
1085666030 11:78416970-78416992 TCCCAAACCCGGGCCAGCCACGG + Intronic
1090378301 11:126307037-126307059 CTCAGAAACCTGGCCAGGCATGG + Intronic
1202808820 11_KI270721v1_random:18836-18858 CCCCTTAGCCGGGCCAGTCCCGG + Intergenic
1091765061 12:3114558-3114580 CCCTGCAGTCTGGCCAGGCATGG + Intronic
1091770915 12:3150784-3150806 CCCCAAGGCCAGGCCAGGCGTGG - Intronic
1094503083 12:31037492-31037514 GACGGAAGCCAGGCCAGGCAGGG - Intergenic
1095098504 12:38160220-38160242 CCCCTGCGCCGGGCCAGGGATGG + Intergenic
1095417306 12:41990762-41990784 ATCAGAAGCCGGGCCGGGCATGG - Intergenic
1096700640 12:53380535-53380557 CCCCGTGGCCGGGGCGGGCAGGG - Intronic
1096896121 12:54821903-54821925 CCCCGGAGCCAGGCCAGGGCTGG - Intergenic
1101696525 12:107132472-107132494 GCCTGAACCCAGGCCAGGCAGGG - Intergenic
1102030237 12:109736119-109736141 CACCTATGCAGGGCCAGGCAGGG - Intronic
1102059888 12:109924157-109924179 CCCCCATGAAGGGCCAGGCACGG + Intronic
1102567527 12:113806329-113806351 GCCTGAAGCCAGGCCAGACAAGG + Intergenic
1103509844 12:121466957-121466979 GCCCGCAGCCGGCCCGGGCAGGG - Intronic
1107108819 13:36674255-36674277 ACCCGAGGCCGCCCCAGGCAAGG - Intronic
1109758334 13:66792377-66792399 ACCCAAACCTGGGCCAGGCACGG + Intronic
1111239070 13:85451233-85451255 CCCCAACCTCGGGCCAGGCATGG + Intergenic
1112279685 13:98051688-98051710 TGCCACAGCCGGGCCAGGCACGG + Intergenic
1113052933 13:106234859-106234881 CACAGAAGCAAGGCCAGGCAGGG - Intergenic
1113567558 13:111327905-111327927 CCGCGCAGCAGCGCCAGGCACGG - Intronic
1113799182 13:113077718-113077740 CCTCTATGCCGAGCCAGGCACGG + Intronic
1119678660 14:76575460-76575482 GCCGGAAGCCGGGAGAGGCAAGG - Intergenic
1119731897 14:76956488-76956510 GGCGGCAGCCGGGCCAGGCAGGG - Intergenic
1121443187 14:93961945-93961967 GCCCACAGCAGGGCCAGGCATGG - Intronic
1121683148 14:95811019-95811041 CCCTGAAGACAGGCCGGGCAGGG + Intergenic
1122081627 14:99271057-99271079 CCCCGGCGCCTGGCCAGGCTCGG + Intronic
1122809138 14:104279359-104279381 GCCCGCAGCCGCGCCAGGCAGGG + Intergenic
1122846858 14:104504930-104504952 CCCCGAAGCCTGGAGAGACAGGG + Intronic
1122993194 14:105248598-105248620 CCCCGCGGCCGGGCCTGGCCGGG + Exonic
1123125959 14:105946131-105946153 CCCCGAGGCTGTGCCAGGCAGGG - Intergenic
1123406542 15:20022549-20022571 CCCCGAGGCTGTGCCAAGCAGGG - Intergenic
1123515872 15:21029197-21029219 CCCCGAGGCTGTGCCAAGCAGGG - Intergenic
1125745458 15:41994471-41994493 CCCTGAACCAGGGCCACGCAGGG + Intronic
1126829822 15:52590076-52590098 CCCAGAAGAAGGGCCGGGCATGG - Intronic
1127355318 15:58193531-58193553 AGCCGAAGCAGGGCGAGGCATGG + Intronic
1127641902 15:60923926-60923948 GCCCACAGCAGGGCCAGGCATGG - Intronic
1128761296 15:70217749-70217771 CTCCAAAGCCCTGCCAGGCAGGG - Intergenic
1128906616 15:71473346-71473368 TCTCAAAGCTGGGCCAGGCACGG - Intronic
1129273855 15:74433189-74433211 CCCGGAGCTCGGGCCAGGCAAGG - Intronic
1131000196 15:88933720-88933742 CCCCCATGCAGGGCCAGCCACGG - Intergenic
1132678231 16:1129453-1129475 CCCCGCAGCAGGGGCAGGCCCGG - Intergenic
1132690381 16:1179330-1179352 CCCCGATGCCTGGTCAGCCAGGG - Intronic
1132698457 16:1212253-1212275 CCCCCATGCAGGCCCAGGCAAGG - Intronic
1132885779 16:2181355-2181377 CACCTCAGCCGGGCCAGTCATGG + Exonic
1133280053 16:4660060-4660082 CTCAGATGCTGGGCCAGGCATGG + Intronic
1133800658 16:9082447-9082469 CCCCACAGCTGGGCCGGGCACGG - Intergenic
1134117021 16:11556593-11556615 CCCCGTAGTTGGCCCAGGCATGG + Exonic
1135323487 16:21512041-21512063 CCCTGCAGACGGGCCAGGCAAGG + Intergenic
1136269618 16:29140959-29140981 CCACCAAGCCTGGCCTGGCATGG - Intergenic
1136398429 16:30005264-30005286 CCCAGAACCCCGGCCAGGGAAGG - Exonic
1138619074 16:58197716-58197738 GCCCGCGGCCGGGCCGGGCATGG + Exonic
1139392693 16:66615021-66615043 CCCAAAAGCCAGGCCAGCCAGGG + Exonic
1139473728 16:67192187-67192209 CCCCTCAGCCAGGCCAGGCCAGG - Exonic
1139635519 16:68255997-68256019 CCCCCACGCTGGGCCAGGTAGGG - Intronic
1139649785 16:68356468-68356490 CCCTGCAGCCGGGCCACACATGG - Intronic
1141629048 16:85276950-85276972 CCGTGCAGCCGGGCCAGGCCTGG + Intergenic
1141882348 16:86868305-86868327 TCCCGAAGCTGGGCCAGCCCTGG - Intergenic
1142035688 16:87861125-87861147 CCCTGCAGACGGGCCAGGCAAGG + Intronic
1142073107 16:88102227-88102249 CCACCAAGCCTGGCCTGGCATGG - Intronic
1142553010 17:752418-752440 CCCGGAAGAGGGGCCGGGCAGGG - Intronic
1142847889 17:2690956-2690978 CCCCGAGGCCGGGTCAGGTGCGG - Intronic
1143219150 17:5247020-5247042 CCACCATGCCCGGCCAGGCAAGG - Intergenic
1144158000 17:12526698-12526720 CCCCAAATCAAGGCCAGGCATGG - Intergenic
1145064215 17:19751048-19751070 GCCAGGAGCCAGGCCAGGCAGGG - Intergenic
1145908316 17:28528390-28528412 CATCAAAGCAGGGCCAGGCATGG - Intronic
1146840595 17:36150621-36150643 ACCTGAAACAGGGCCAGGCATGG + Intergenic
1148163460 17:45465416-45465438 CCCTGAGGCTGGGCCGGGCACGG + Intronic
1149539576 17:57458864-57458886 CCGCGGAGCAGGGACAGGCAAGG - Intronic
1150133317 17:62680722-62680744 CCCCGGAGGCGGGCGCGGCAGGG - Intronic
1150226853 17:63529120-63529142 CCACCACGCCCGGCCAGGCATGG + Intronic
1150394687 17:64812068-64812090 CCCTGAAGCTGGGCCGGGCACGG + Intergenic
1151344576 17:73493846-73493868 CTCTGAAGCTGGGGCAGGCAGGG - Intronic
1152283113 17:79396888-79396910 CCGTGAAGCCGGGCCAGGGTGGG + Intronic
1152523833 17:80876204-80876226 CACCGAACCCGTGCCACGCAGGG + Intronic
1152528961 17:80905826-80905848 CCCGGAACCCAGGGCAGGCACGG - Intronic
1152785343 17:82245061-82245083 CCGCGGAGCCGGGCTCGGCAGGG + Intronic
1152905774 17:82970181-82970203 CCTGGAAGCCAGGCCAGCCAAGG + Intronic
1153051466 18:906211-906233 CCTCCATCCCGGGCCAGGCAGGG - Intronic
1153642107 18:7166074-7166096 ACCAGAAGCTGGGACAGGCAAGG + Intergenic
1156452553 18:37274914-37274936 CCCAGAAGCAGGGCCAGGGAGGG + Intronic
1158648808 18:59269114-59269136 CCCCGAAGCCGGGCCCGCACGGG + Exonic
1160040009 18:75336957-75336979 CCCTGGGGCCGGGCCAGGCCTGG + Intergenic
1160516284 18:79480844-79480866 CCCAGAAACATGGCCAGGCATGG - Intronic
1160982631 19:1823347-1823369 CCCCGGAGCTGGGTCAGGGAAGG + Intronic
1161166376 19:2790038-2790060 CCACCAAGCCTGGCCGGGCAGGG + Intronic
1161491966 19:4567145-4567167 CCCCTCAGCCGCTCCAGGCACGG + Intergenic
1161583708 19:5094043-5094065 CCCTGAAGCCAGGAGAGGCAGGG - Intronic
1161718256 19:5889598-5889620 CAGCAAAGCAGGGCCAGGCAGGG + Intronic
1162528999 19:11224772-11224794 CCCTGCAACCCGGCCAGGCATGG + Intronic
1162739710 19:12767018-12767040 CTCCCACCCCGGGCCAGGCACGG - Intronic
1163080775 19:14940531-14940553 CCCAGAATGCAGGCCAGGCACGG + Intergenic
1163106453 19:15125570-15125592 CCCCGACCCCGGGCCAGGCTGGG + Intronic
1163310172 19:16509569-16509591 CCCCGAGGCAGGCCCAGGCGAGG + Exonic
1163666680 19:18606854-18606876 CCCCGGGGCCGGGCCGGGCCGGG - Intronic
1163738213 19:18994807-18994829 ACCCATAGCCGGGCCAGCCAGGG - Intronic
1165488691 19:36110931-36110953 CCACCAAGCAGAGCCAGGCAAGG - Intergenic
1165533247 19:36421601-36421623 CTCCGAAGCCAGGCCGCGCATGG - Intergenic
1165834563 19:38746213-38746235 CCCCAAAACAGGGCCGGGCATGG + Intronic
1166666343 19:44682672-44682694 CCCCGAAGCCGGGGTGGGGAGGG + Intronic
1167645596 19:50703494-50703516 CCCCGAGGCCGGCCCAGGTAGGG - Exonic
1168589265 19:57619072-57619094 CCCTGAAGCCTTGCCAGGAAGGG + Intronic
1168638980 19:58018150-58018172 CCCCTCATCCTGGCCAGGCATGG + Intergenic
925441124 2:3886443-3886465 CCCCGACGCTGGGTCATGCAGGG - Intergenic
926121369 2:10242968-10242990 TCCCGGAGCCGGGCCAGCCCTGG - Intergenic
926136790 2:10342304-10342326 CCCTGGAGGCGGGCGAGGCAGGG - Intronic
926574639 2:14566596-14566618 CCCCCCAGCAGGGCCAGCCACGG + Intergenic
927257760 2:21054991-21055013 ACCCGAATCCAGGCCAGGCATGG - Intergenic
928129866 2:28641743-28641765 CTTCGAAGGTGGGCCAGGCAAGG - Intronic
928158130 2:28894955-28894977 GCCCGAAGCCGAGCCCGGGAAGG - Intronic
928172429 2:29012197-29012219 CCCCGAACCCAGGCCAGGGTGGG + Intronic
928463320 2:31496527-31496549 AGCCGAAGCAGGGCGAGGCAAGG + Intergenic
929519613 2:42636054-42636076 CCACGGCGCCGGGCCAGGAATGG + Intronic
930453927 2:51581363-51581385 ACCCGATACCCGGCCAGGCACGG + Intergenic
930537120 2:52656858-52656880 ACCAGAAGCTGGGCAAGGCAAGG - Intergenic
932023539 2:68112337-68112359 CCCCAAAGCATGGGCAGGCAAGG + Intergenic
932744019 2:74316599-74316621 ACCTAAAGCCAGGCCAGGCAAGG + Intronic
934502471 2:94871296-94871318 CCCCGAGGCGGGGACAGGGATGG + Intergenic
935208969 2:100922287-100922309 CTCCAAAGCCTGGCCAGGCATGG + Intronic
938673055 2:133603513-133603535 CCCTGATGCCGGGCTGGGCACGG - Intergenic
942004881 2:171687960-171687982 CCCCAAAGCTGGGCCGGGCGGGG - Intronic
942078719 2:172380818-172380840 CCCCTCTGCCTGGCCAGGCAGGG + Intergenic
944238959 2:197467235-197467257 TCCAGAACCCAGGCCAGGCATGG - Intronic
946145774 2:217729799-217729821 CCCTGGAGCTGGTCCAGGCATGG - Intronic
947588326 2:231370543-231370565 GACCGAGGCTGGGCCAGGCAGGG - Intronic
947791078 2:232869788-232869810 CACCTACTCCGGGCCAGGCATGG + Exonic
947899179 2:233706196-233706218 CCACAAAGCTGGCCCAGGCAGGG + Intronic
948602457 2:239115192-239115214 CCCGGCAGCCGGTCCAGGTAGGG + Exonic
948742497 2:240056989-240057011 CCCCGCATCTGTGCCAGGCATGG - Intergenic
948747320 2:240106124-240106146 CCCCCAAGAGCGGCCAGGCAGGG - Intergenic
948801692 2:240436111-240436133 GCCCAAAGCCCGGCCAGGCCCGG - Intronic
1168814158 20:725277-725299 CCTGGAGGCCAGGCCAGGCAAGG + Intergenic
1169190313 20:3654779-3654801 CCCAGCAGCCCGGCAAGGCAGGG + Intergenic
1170773715 20:19357212-19357234 CCCAGAAGCTGAGACAGGCAAGG + Intronic
1171186530 20:23127506-23127528 CCCTGATGCGGGGCCAGGCCTGG + Intergenic
1171189090 20:23145668-23145690 CCCTGAAGCCTGGCCAGGCAGGG + Intergenic
1171351512 20:24506602-24506624 CCCAGTAGCAGGGCCAGGCTGGG - Intronic
1171500017 20:25585824-25585846 GCCCGGAGGCCGGCCAGGCAGGG + Intergenic
1172699117 20:36842019-36842041 ACCCAAACCCAGGCCAGGCATGG - Intronic
1172841087 20:37903162-37903184 CCCCGAAGCCGGGGCTGGGCCGG + Exonic
1173991491 20:47307158-47307180 CCCCGGAACTTGGCCAGGCACGG + Intronic
1174367515 20:50065432-50065454 CCCTGAAGCCTGGCCAAACAGGG - Intergenic
1175119588 20:56707819-56707841 ACCAGAAGCCAGACCAGGCAAGG - Intergenic
1175553500 20:59831840-59831862 CCCCAGAGCCGGCGCAGGCAAGG - Intronic
1175917006 20:62430643-62430665 CCCCCCAGCCGGGCCAGCAAGGG - Intergenic
1175931399 20:62495571-62495593 CCTCGAGGCCAGGGCAGGCAAGG - Intergenic
1175947863 20:62567043-62567065 CCCCGAGGCCCTGCCTGGCAGGG - Intronic
1176263397 20:64195142-64195164 CCCAGAAACAGGGCCGGGCATGG - Intronic
1177166238 21:17608074-17608096 CCCAGAACCTTGGCCAGGCATGG + Intronic
1179810201 21:43865234-43865256 CCCCGACGCAGGGCCGGGCCGGG + Intronic
1179909946 21:44442306-44442328 CCCCTAGCCCAGGCCAGGCAAGG - Exonic
1180174799 21:46082334-46082356 CCCCGAGGCCAGGCCAGGTGGGG + Intergenic
1180843806 22:18970927-18970949 CCCCGAGGCTGGGCCAGGTCCGG + Intergenic
1181761237 22:25060036-25060058 CCCGGAAGCCAGGCCAGGCAGGG + Intronic
1183253101 22:36744084-36744106 CCCTGCAGCCTGGCCAGGCTGGG + Intergenic
1183305302 22:37079929-37079951 CCCCATAGCCAGGCCAGGCCGGG + Intronic
1184122302 22:42459921-42459943 CCACAAAGCCTGGCAAGGCAGGG - Intergenic
1184232489 22:43166197-43166219 CTCAGAAGGCAGGCCAGGCATGG - Intergenic
1184442357 22:44525040-44525062 CCCCGACGCCCAGCCAGGCACGG + Intergenic
1185018223 22:48358126-48358148 CCCCACTGCCGGGCCAGGAATGG + Intergenic
1185235816 22:49712331-49712353 CCCCAGAGCCGGGCCAGGCTGGG + Intergenic
1185271140 22:49929723-49929745 CCCGGGAGCCGGGCCGAGCAGGG - Intergenic
949509084 3:4753000-4753022 CCACGAAGCGTGGCCAGGGAGGG + Intronic
950093157 3:10311778-10311800 CCCTGAAGCCAGACCAGGCAGGG - Intronic
950444472 3:13028364-13028386 CCCCGAGGCTGGGCCAGGCTAGG + Intronic
950469050 3:13173428-13173450 CCCCAAAGCCTGACCAGACAGGG - Intergenic
950478892 3:13232553-13232575 ACCTGCAGCCGGGCCAGGCTGGG - Intergenic
950639020 3:14335951-14335973 CCCCGAGGACTGGCCAGGCCAGG - Intergenic
950658563 3:14452525-14452547 CCCAGAGCCCGGGCCAGGCTTGG + Intronic
952241284 3:31533147-31533169 CGCCGAAGCCGGCCCCGGCGGGG + Exonic
954368055 3:50156480-50156502 CCCTGAAGCTGGGCCAGGTTGGG + Intronic
959067827 3:101676346-101676368 CCCGGAGGCCGGGCCAGCCGCGG - Intronic
959585200 3:108019352-108019374 CACCGAAGCTGGGAGAGGCAAGG - Intergenic
960747101 3:120902162-120902184 AGCCGAAGCAGGGCGAGGCATGG - Intergenic
960881722 3:122352370-122352392 CCACTGAGCCAGGCCAGGCATGG + Intergenic
961454395 3:127016996-127017018 CCCCGAATCCGGGCCAAGTATGG + Exonic
961658819 3:128457654-128457676 CCCTAAGGCCTGGCCAGGCAGGG - Intergenic
962299685 3:134227961-134227983 CTCCAAAGTCAGGCCAGGCACGG - Intronic
962916966 3:139912899-139912921 CGCCCAGGCGGGGCCAGGCAAGG - Intergenic
968378092 4:61424-61446 TCTAGAAGGCGGGCCAGGCACGG - Intronic
968470831 4:781616-781638 GCCCGCAGCGGGGCCGGGCAGGG + Intergenic
969281207 4:6171768-6171790 CCTCGATTCCGTGCCAGGCAGGG - Intronic
969592681 4:8130857-8130879 CCCAGCAGCCAGGCAAGGCAAGG - Intronic
969673868 4:8604208-8604230 TCCCGAAACGGGGCCAGGCCAGG - Intronic
969710519 4:8840608-8840630 CCTGGAAGCTGGGCCAGGCACGG - Intergenic
970194045 4:13539223-13539245 CCGCGGAGCTGGCCCAGGCAGGG + Intergenic
970456061 4:16226023-16226045 CCCCGCGGCCGCGCCAGGCCAGG - Intronic
971950913 4:33344790-33344812 CTTCGAATCAGGGCCAGGCATGG + Intergenic
973670342 4:53210952-53210974 AACCCAAGACGGGCCAGGCATGG + Intronic
978616355 4:110600615-110600637 CCACCATGCCCGGCCAGGCAGGG - Intergenic
982217116 4:153092022-153092044 GCCAGGAGCTGGGCCAGGCAAGG - Intergenic
985708711 5:1416071-1416093 GCCCCTAGCAGGGCCAGGCAGGG - Intronic
985852123 5:2396723-2396745 CCCTGGACCCGTGCCAGGCATGG + Intergenic
986026275 5:3854448-3854470 CCACAAAGCCGGGCCAGGCCCGG - Intergenic
986622591 5:9691294-9691316 CCCAGAAGCCGGAAGAGGCAAGG + Intronic
986884145 5:12213464-12213486 CACCGAAGCTGGGAGAGGCAAGG - Intergenic
988546389 5:32161735-32161757 ATCAGAAGTCGGGCCAGGCACGG + Intronic
988953589 5:36291032-36291054 CAAAAAAGCCGGGCCAGGCATGG - Intronic
989100877 5:37822007-37822029 CTCCTCAGCCTGGCCAGGCAGGG + Intronic
989151704 5:38306420-38306442 CCCAGAGGCCAGGCCAGGCCAGG - Intronic
997368385 5:133340227-133340249 CCCTGGAGCCAGGCCAGGCAAGG - Intronic
998517546 5:142770069-142770091 GCCCGAATCCGAGCCACGCATGG - Intergenic
1001442017 5:171750519-171750541 CCAAGAAGAAGGGCCAGGCAAGG + Intergenic
1001496205 5:172188882-172188904 CCGGGAAGCCGGGCCCTGCAGGG - Intergenic
1002182166 5:177436293-177436315 CACAGAAGCCTGGCCAGCCAGGG + Intronic
1002458780 5:179362102-179362124 CCCAGGAGCTGGGCGAGGCAGGG - Intergenic
1006056926 6:31391879-31391901 ACCCAAAGACGGGTCAGGCATGG + Intergenic
1007777490 6:44231912-44231934 CCACGAATCCAGGCCAGGCGTGG - Intronic
1010207657 6:73337458-73337480 CCCCTAGGCCAGGTCAGGCACGG + Intergenic
1011517043 6:88166243-88166265 GCCCCACGCCGGGCCAGGCGGGG - Exonic
1011717570 6:90123282-90123304 CCCAGAAGCTGGGACAGGCAAGG + Intronic
1014251291 6:119117896-119117918 CCCAGAAGCAGGACCAGTCAGGG + Intronic
1016937127 6:149455699-149455721 CCCAGAGTCAGGGCCAGGCAGGG + Intronic
1017446195 6:154509720-154509742 CACCGCACCGGGGCCAGGCAGGG + Intronic
1017707732 6:157139491-157139513 CCCTGCAGGCGGGCCAGGGAGGG - Intronic
1018433822 6:163743971-163743993 ACCCAAAGCCAGGCCAGCCATGG + Intergenic
1018910674 6:168099584-168099606 CCCGAAAGCCAGGCCAGGCGGGG - Intergenic
1019176410 6:170161440-170161462 ACCCGCAGCCACGCCAGGCAGGG - Intergenic
1019465857 7:1188472-1188494 CCCAGAAGCCTGGGCAGGCCAGG - Intergenic
1019620537 7:1989749-1989771 TGCCGAAGCCGGGCCACGCTGGG - Intronic
1021948733 7:25753750-25753772 CCTCGTAGCCGAGCCAGGCAAGG - Intergenic
1023970402 7:44986698-44986720 CCCCGAAGCCGTGCGTGGCCGGG + Intergenic
1024056061 7:45660491-45660513 CCCCGCAGGGGGGCCAGGGATGG + Intronic
1026987010 7:74561056-74561078 CCTCCAGGGCGGGCCAGGCACGG + Intronic
1027187741 7:75981989-75982011 CCCAGAAGCCGGGGCAGGGCTGG - Intronic
1027213979 7:76172467-76172489 CCACCAAGCCCGGCCTGGCATGG - Intergenic
1027234798 7:76291914-76291936 CCACGAAGCCAGGGCAGGCATGG - Intergenic
1029245252 7:99194893-99194915 ACTCAAAGCCAGGCCAGGCACGG - Intronic
1029807984 7:103016509-103016531 AGCCGAAGCAGGGCAAGGCATGG + Intronic
1034468078 7:151241610-151241632 CCCAGCAGCCGGGCTAGGCGGGG + Exonic
1035023527 7:155812293-155812315 CCCCGCAGCCGCGGCGGGCAAGG - Intergenic
1037355706 8:18017561-18017583 TCCCAAGGCTGGGCCAGGCATGG + Intronic
1037811365 8:22089109-22089131 CCACGCAGCCGGGCCGGGAAGGG + Intergenic
1037827024 8:22165571-22165593 CCCCGGCGACGGGCCAGGCGGGG + Intronic
1038417245 8:27406081-27406103 ACCAGAAGCTGGGACAGGCAAGG - Intronic
1038865347 8:31433698-31433720 CCCCAGAGCCAAGCCAGGCAGGG - Intergenic
1040907801 8:52486564-52486586 CCCCCATGCCCGGCCAGACATGG + Intergenic
1043571538 8:81609078-81609100 ACCCTAATCTGGGCCAGGCATGG + Intergenic
1045958185 8:107934660-107934682 TCCCGCAACAGGGCCAGGCATGG - Intronic
1047262584 8:123275200-123275222 CCCCGCAGCGGGGCCAGCGAGGG + Intronic
1049212256 8:141392172-141392194 CCCCGAAGCCGTGCCCGGAGCGG - Intronic
1049420042 8:142512412-142512434 CTTCGAAGCTGGACCAGGCAAGG + Intronic
1049431982 8:142569475-142569497 CCCCTCAGCCGGGACAGCCAGGG + Intergenic
1057858972 9:98624807-98624829 CCCCGAGCCCGGGGCAGACAGGG + Intronic
1059367604 9:113798966-113798988 GCCCCAAGCTAGGCCAGGCATGG + Intergenic
1059699922 9:116765295-116765317 CCCCAGAGTCGGGCTAGGCAAGG + Intronic
1060139838 9:121201066-121201088 CCCTGCAGCCGGGCCGGGCCGGG - Intronic
1060490687 9:124081953-124081975 CACAGAATCTGGGCCAGGCATGG + Intergenic
1060607865 9:124933703-124933725 TCCAGAATCCAGGCCAGGCAGGG - Intronic
1061829881 9:133284996-133285018 CCCCTCAGTGGGGCCAGGCACGG + Intergenic
1061965426 9:134011243-134011265 CCGAGAAGCAGGGCCAGGCACGG + Intergenic
1062015246 9:134287979-134288001 GCCTGAAGCCCGGGCAGGCAGGG + Intergenic
1062289697 9:135788994-135789016 CCCGGAGGCAGGGCCAGGCCTGG + Intronic
1062483592 9:136763531-136763553 CCCAGCAGCAGGGGCAGGCATGG - Intronic
1062502778 9:136858440-136858462 CGCCCAGGCCGGGCCAGGCCAGG - Exonic
1062574257 9:137199241-137199263 CCACGCACCCGGGCCTGGCAGGG + Exonic
1203571147 Un_KI270744v1:132825-132847 TCTAGAAGGCGGGCCAGGCACGG + Intergenic
1187506279 X:19880897-19880919 TCTAGAAGCCGGGCAAGGCAGGG + Intronic
1188526933 X:31097330-31097352 CCCCGTGGCCAGACCAGGCATGG + Intergenic
1189324561 X:40104975-40104997 CCGCGGAGCCCGGCCAGGCTCGG + Intronic
1189355738 X:40308687-40308709 CCCAGAAGCTGGTCAAGGCAGGG - Intergenic
1189380204 X:40497286-40497308 CCCAGAAGCCGGAAGAGGCAAGG + Intergenic
1189455704 X:41187121-41187143 CACCGAATCTGGGCCGGGCATGG - Intronic
1191907405 X:66108100-66108122 CCCCCACCCCGGGCCAGGCATGG + Intergenic
1192795201 X:74420637-74420659 GCCAGGAGCCGGGCCAGGAAGGG - Intergenic
1200172036 X:154083910-154083932 CCCCCACGCCCGGCCAGGCTCGG - Intronic