ID: 1085022516

View in Genome Browser
Species Human (GRCh38)
Location 11:73218335-73218357
Sequence CACGTGGGTCTCTGCGGCTG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 155}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085022501_1085022516 30 Left 1085022501 11:73218282-73218304 CCGGCTTCGGGGTTGGGGAACAG 0: 1
1: 0
2: 0
3: 9
4: 134
Right 1085022516 11:73218335-73218357 CACGTGGGTCTCTGCGGCTGCGG 0: 1
1: 0
2: 0
3: 9
4: 155
1085022512_1085022516 -10 Left 1085022512 11:73218322-73218344 CCGGGCTCCCAGGCACGTGGGTC 0: 1
1: 0
2: 1
3: 34
4: 237
Right 1085022516 11:73218335-73218357 CACGTGGGTCTCTGCGGCTGCGG 0: 1
1: 0
2: 0
3: 9
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085022516 Original CRISPR CACGTGGGTCTCTGCGGCTG CGG Exonic
900032647 1:382069-382091 CAGGTGGGCGTCTGCGGCCGGGG + Intergenic
900053405 1:611131-611153 CAGGTGGGCGTCTGCGGCCGGGG + Intergenic
902288482 1:15421744-15421766 CACGTGGGACCCAGGGGCTGGGG + Intronic
906518271 1:46452351-46452373 CACCTGGGACTCTGTTGCTGAGG - Intergenic
913986223 1:143568672-143568694 CACGTGTTTCTGTGGGGCTGAGG - Intergenic
914204600 1:145516456-145516478 CACGTGTTTCTGTGGGGCTGAGG - Intergenic
915394847 1:155575524-155575546 CACCTGGGTCTGGGAGGCTGAGG - Intergenic
922899988 1:229129386-229129408 CACCCGGGGCTCTGCGGCTAAGG - Intergenic
1066608505 10:37209328-37209350 AACGTGGGGCTCTGCTTCTGGGG + Intronic
1067142548 10:43669144-43669166 CACTTGGGTCTGTGTGGCTCTGG + Intergenic
1068529333 10:58167092-58167114 CACTTGGGTCTCGGAGGTTGAGG - Intergenic
1069551505 10:69367478-69367500 CACCTGGTTCTCTGAGGCTTTGG + Intronic
1070222064 10:74458213-74458235 CACTTGGGCCTGTGAGGCTGAGG - Intronic
1074191638 10:111143035-111143057 CACGTGGGTCTTTGAGGGTTGGG + Intergenic
1074963648 10:118469997-118470019 CACCTGGGTCTCAGAGGATGAGG - Intergenic
1075443117 10:122494825-122494847 GACGGGGGTCACTGCGGGTGAGG + Intronic
1076800596 10:132826278-132826300 GTGGTGGGTCTCTGCGGCTCCGG - Intronic
1077213500 11:1384268-1384290 CAAGTGGGTCATTGAGGCTGGGG - Intergenic
1077254634 11:1574675-1574697 CTCGGGGGTCTCTGGGGCTCGGG + Intergenic
1077266290 11:1652334-1652356 AACGTGGGTCTCTGCTGCCAGGG - Intergenic
1081749130 11:45495235-45495257 CAAGTGGGTCTGTGTGGCTGTGG - Intergenic
1084143590 11:67250742-67250764 CACAAAGTTCTCTGCGGCTGAGG - Exonic
1085022516 11:73218335-73218357 CACGTGGGTCTCTGCGGCTGCGG + Exonic
1087308403 11:96510715-96510737 CACACGGTTCTCTGCAGCTGAGG + Intergenic
1088266865 11:107996236-107996258 AACGTGGCTCTCTGCCACTGAGG + Intergenic
1088324910 11:108592107-108592129 CACGTGGGTGTGTGTGGGTGTGG + Intronic
1096991675 12:55809358-55809380 CACTTGGGTCTGGGAGGCTGAGG + Intronic
1097102131 12:56597214-56597236 CTCCAGGGTCTCTGCTGCTGGGG + Exonic
1101739657 12:107491084-107491106 TAGGTGGGCCTCTGTGGCTGAGG + Intronic
1102666674 12:114580124-114580146 CATGGGGGTCTCTGTTGCTGAGG - Intergenic
1103446155 12:120996534-120996556 CTCGTAGGTCTCAGCAGCTGGGG + Exonic
1103573051 12:121857535-121857557 CAGGAGGGTCTCTGCCCCTGAGG - Intronic
1104858506 12:131912918-131912940 CCCAGGGGTCTCTGGGGCTGAGG + Intronic
1106360871 13:29029472-29029494 CACCTGGGCCTCTGAGGCTCAGG + Intronic
1113872122 13:113565778-113565800 GAGGAGGGTCTCTGCGTCTGAGG - Intergenic
1113949327 13:114062778-114062800 CAGGTGGGCCTCGGCTGCTGAGG + Intronic
1113956994 13:114104371-114104393 CCAGTGGGTGTCTGTGGCTGGGG - Intronic
1116122779 14:40742003-40742025 CAGGTAGCTCTCTGCAGCTGAGG - Intergenic
1117302251 14:54441227-54441249 CACGTGAGTAGCTGGGGCTGGGG - Exonic
1119654540 14:76407796-76407818 CACGTGGGTCTCACTGGCTTTGG - Intronic
1123110462 14:105864746-105864768 CCCGGGGGTCTGTGTGGCTGGGG - Intergenic
1126212922 15:46120186-46120208 CTCATGGGTTTCTGCAGCTGTGG + Intergenic
1128258691 15:66216846-66216868 CAAGTGGCTCTCTGTAGCTGAGG - Intronic
1128361229 15:66963224-66963246 AAGGTGGGTCTCTGCAGCTCAGG - Intergenic
1128757195 15:70191147-70191169 GAGGTGGGTGTCTGCAGCTGAGG - Intergenic
1129237984 15:74235143-74235165 CTCCTGGGGCTCTGGGGCTGGGG - Intergenic
1130026797 15:80277185-80277207 GAGGTGGGTCTCTGAGGCTGAGG - Intergenic
1130882166 15:88064741-88064763 TATGGGGGTCTCTGCTGCTGAGG + Intronic
1133284613 16:4684758-4684780 CACGAGGCTGTCTGCGGCTCTGG + Intronic
1135220144 16:20607344-20607366 CTTGTGGGTCTCTGGGTCTGAGG + Intergenic
1137029374 16:35507291-35507313 CACGCGGCTCTCTGCTGCTCAGG + Intergenic
1141274566 16:82575077-82575099 CATGTGGATCTCTCAGGCTGAGG - Intergenic
1141730320 16:85818283-85818305 CAGGTGGGGCTCTGCGCCTAAGG + Intergenic
1142214773 16:88825106-88825128 CGCCTGGGTGTCTGGGGCTGGGG + Intronic
1142214814 16:88825217-88825239 CGCCTGGGTGTCTGGGGCTGGGG + Intronic
1142429648 16:90019278-90019300 CGCGGGGGTCTCGGGGGCTGGGG + Intronic
1142867590 17:2800027-2800049 CAGGAGGGTCCCTGGGGCTGGGG + Intronic
1142888911 17:2930267-2930289 CACGTGGGAGCCTGTGGCTGGGG + Intronic
1143780247 17:9225490-9225512 CACGGGTTTCTCTGAGGCTGAGG + Intronic
1147393068 17:40122077-40122099 CCCGGGGGTCTCCGCGGCTCGGG - Intergenic
1147651140 17:42062690-42062712 CATGGGGGTCTTTGCGTCTGGGG - Intronic
1150136480 17:62698109-62698131 CACCTGGGTCTCCTGGGCTGTGG + Intergenic
1151884574 17:76916057-76916079 GTCGTGGGCCTCTGCTGCTGGGG + Intronic
1152296502 17:79470235-79470257 CATGTGGGCCACTGGGGCTGCGG - Intronic
1152545867 17:80999879-80999901 CATGGGGGTCCCCGCGGCTGGGG + Exonic
1152797331 17:82314768-82314790 CGCCTGGGGCTCTGCAGCTGTGG - Intergenic
1152947293 17:83205116-83205138 CAGGTGGGCGTCTGCGGCCGGGG - Intergenic
1153764463 18:8362278-8362300 CATGGGGCTCTCTGCAGCTGAGG - Intronic
1158743355 18:60168308-60168330 CACCTGGCTCTCTGAGGTTGTGG + Intergenic
1159609630 18:70511193-70511215 CATGTGGGTTTCTGCTGTTGTGG - Intergenic
1160015163 18:75134679-75134701 CACGTGTGTCTTTGTGTCTGTGG + Intergenic
1160525127 18:79531410-79531432 CACGGGGGTTTCTCCGGGTGTGG - Intergenic
1160532307 18:79572572-79572594 CACGGGGGGCTCTGGGGATGTGG + Intergenic
1160783264 19:887830-887852 CAACTGGGTCTCGGGGGCTGGGG + Intronic
1161038364 19:2097532-2097554 CCCGTGGGTCTCCGAGGCTCTGG - Intronic
1161295932 19:3520194-3520216 CACATGGGCCTTTGGGGCTGCGG + Intronic
1162135308 19:8551678-8551700 CAGGAGGGTTTCTGGGGCTGAGG + Intronic
1163329862 19:16629038-16629060 CACGGGGTTCTCTGCCGGTGGGG - Intronic
1163386781 19:17004764-17004786 CACGTGGCTCTCTGGGGTGGAGG + Intronic
1163777684 19:19227629-19227651 CACCTTGGTCTCTGCAGCAGGGG - Exonic
1166202792 19:41249369-41249391 CACTTGAGTCTGTGCGGCAGAGG + Intronic
1167253285 19:48412901-48412923 CAGGTGGATCACTGAGGCTGAGG + Intronic
1167253333 19:48413245-48413267 CAGGTGGATCACTGAGGCTGAGG + Intronic
1167291574 19:48627914-48627936 CTCCTGGGTCTATGGGGCTGGGG + Intronic
1167555978 19:50195987-50196009 GAAGTGGGTCTCTGAGCCTGAGG - Intronic
927183779 2:20467716-20467738 CTCTTGGGCCTCTGCAGCTGTGG + Intergenic
927202285 2:20585203-20585225 AATGTGGGCCTCTGCAGCTGTGG + Intronic
927982145 2:27380781-27380803 CCCGTGCGTCTCTGCGGCGGCGG - Intronic
928176339 2:29036768-29036790 CACGTGGGCCTGTGTGGCTCTGG + Intronic
933748049 2:85584914-85584936 CAGGCGGGTCTCTGCCACTGTGG - Intronic
936032195 2:109081448-109081470 CACATGGGGCTCCGCGTCTGTGG + Intergenic
937223540 2:120355527-120355549 GACGTTCTTCTCTGCGGCTGTGG + Intergenic
942084152 2:172428314-172428336 CACGTGTGTGTTTGGGGCTGGGG + Intronic
944579155 2:201116915-201116937 CGGGTGGGCCTCTGGGGCTGCGG - Intronic
948058906 2:235029392-235029414 CAGGTGGGTGTCTGAGTCTGAGG + Intronic
1168758135 20:329957-329979 GAAGTGGCTCTCTGCAGCTGCGG - Exonic
1171239237 20:23551640-23551662 CAGGTGGGACTCTGAGTCTGTGG + Intergenic
1174835207 20:53850477-53850499 CACGGGGCTCTCTGCTGATGGGG - Intergenic
1175875817 20:62228783-62228805 CACGTGCGTCTGTGGGTCTGCGG + Intergenic
1176045940 20:63092580-63092602 CACGTGGGGCTTTGAGGCTGCGG + Intergenic
1176218270 20:63958282-63958304 GGCGTGGGTCTCTGGGGTTGGGG - Exonic
1180255835 21:46626831-46626853 CAGCTGTGGCTCTGCGGCTGCGG + Intergenic
1180931956 22:19598316-19598338 CAGTTGGTTCTCTGCTGCTGGGG + Intergenic
1181032989 22:20157217-20157239 CAGGTGGTTCTCGGGGGCTGCGG + Intergenic
1181438910 22:22925597-22925619 CACATGGGGCTCTGGGTCTGGGG + Intergenic
1182418365 22:30235977-30235999 CTCGTCTGTGTCTGCGGCTGTGG + Intergenic
1182737514 22:32541551-32541573 CATGTGAGTCTCTGGGGCAGGGG - Exonic
1183966622 22:41446376-41446398 CACTCGGGTCTCCGCGGCGGCGG + Exonic
1184992586 22:48180738-48180760 CATGTGGGCTTCTGGGGCTGTGG + Intergenic
1185315753 22:50178455-50178477 CCCGTGGGCCGCTGTGGCTGTGG - Intronic
1185397701 22:50601085-50601107 CCCGGGGGTCACTGAGGCTGGGG - Intronic
952900258 3:38107775-38107797 TATGTGGGCCTCTGTGGCTGAGG - Intronic
954672454 3:52298278-52298300 CATGTGGGTCTATGGGTCTGGGG + Intergenic
955067948 3:55548557-55548579 CACGTATGTCTGTGTGGCTGGGG - Intronic
956962906 3:74423437-74423459 CAAGTGTCTCTCTGCAGCTGGGG + Intronic
960269459 3:115658565-115658587 CCCCAGGGTCTCAGCGGCTGAGG - Intronic
968543245 4:1178901-1178923 CACGTGGCCATCTGCTGCTGGGG - Intronic
968646196 4:1741772-1741794 CAGGTGGGTGTCAGTGGCTGGGG + Intronic
984363662 4:178770765-178770787 CAAGTGTGTCTCTGCAGCTGAGG + Intergenic
985174502 4:187187156-187187178 CACATGGGTTTGTGCCGCTGTGG + Intergenic
985988166 5:3534726-3534748 CACGGGGGCCTGTGGGGCTGGGG + Intergenic
995796300 5:115945193-115945215 AAAGTGAGTCTCTGCAGCTGAGG - Intergenic
999265578 5:150264871-150264893 CACGTGGGTGTTTGCGGGTTGGG - Intronic
1000291232 5:159873416-159873438 AAGGTGGCTCTCTGCAGCTGAGG - Intergenic
1001671250 5:173475832-173475854 CACCTGGGTCTCTCAGGCTTTGG + Intergenic
1002451572 5:179321861-179321883 CACTTGGGTCTGTGGGCCTGGGG - Intronic
1002706060 5:181161323-181161345 CACCTGGGTCTGTGAGGCTGCGG - Intergenic
1002741173 5:181436799-181436821 CAGGTGGGCGTCTGCGGCCGGGG - Intergenic
1003237212 6:4306183-4306205 CAAGTAGGTCTGTGCAGCTGGGG - Intergenic
1007608328 6:43132162-43132184 CAGGTGAGTCTCTGGGTCTGGGG + Exonic
1014075300 6:117228394-117228416 CAGGTGGCTCTCTTCAGCTGAGG + Intergenic
1018533455 6:164793463-164793485 CACGTGGTTCTCAGCTGCTGTGG - Intergenic
1018812443 6:167307773-167307795 CACGTGGGTCACCGCGCCTGGGG - Exonic
1018911127 6:168101397-168101419 CGCGTGGGTCTCCGCGGGCGGGG - Intergenic
1019110082 6:169702411-169702433 CAAGTGGGTCAGTGCTGCTGGGG - Exonic
1019128903 6:169859515-169859537 AACCTGGGTCTCTGATGCTGGGG - Intergenic
1019246288 6:170712496-170712518 CAGGTGGGCGTCTGCGGCCGGGG - Intergenic
1019351685 7:557013-557035 CACCTGGTTCTCTGCAGCTCAGG - Intronic
1019716575 7:2542066-2542088 AACCTGGGTCCCTGCGGCTGGGG - Intronic
1019763618 7:2832634-2832656 CAGCTGGTTCTCTGCTGCTGTGG + Intronic
1023861716 7:44220806-44220828 CGCGTGAGTCCCTGGGGCTGGGG - Exonic
1029984960 7:104914566-104914588 AAGGTGGCTCTCTGCAGCTGAGG + Intergenic
1030399261 7:109028103-109028125 AAAGTGGCTCTCTGCAGCTGAGG + Intergenic
1034280179 7:149848144-149848166 CAGGTGGGTCTCTGATGCTCCGG - Exonic
1034431410 7:151043139-151043161 CTCCCGGGTCTCTGTGGCTGTGG - Intronic
1034896680 7:154880598-154880620 CAGAAGGGGCTCTGCGGCTGTGG + Intronic
1035029376 7:155847453-155847475 CACGTGGGTCTTTGTGGGTTGGG + Intergenic
1035501784 8:95193-95215 CAGGTGGGCGTCTGCGGCCGGGG + Intergenic
1037828925 8:22176971-22176993 TACGTGGGTCGCCGCGGCGGGGG + Exonic
1041534434 8:58910054-58910076 CAAATTGGTCTCTGTGGCTGGGG - Intronic
1045060886 8:98409893-98409915 CACATGGCACTCTCCGGCTGAGG - Intronic
1049617252 8:143581051-143581073 CACCTGGGTCTGTGGGGCCGTGG + Exonic
1050058069 9:1676599-1676621 CATGTGGCTCTCTGCAGCTTAGG + Intergenic
1053892710 9:42710804-42710826 CACGCAGGTCGCTGCTGCTGGGG + Intergenic
1057857082 9:98610009-98610031 CACGTGGATGTCAGGGGCTGTGG + Intronic
1057926295 9:99153824-99153846 CAGGTGTGTCTCTGTGCCTGGGG + Exonic
1059308460 9:113372665-113372687 CACACTGGTCTCTGCGACTGGGG + Intergenic
1059448592 9:114355968-114355990 CAAGTGGGCCTCTCCGGCAGAGG - Exonic
1061481474 9:130899508-130899530 CCTGTGGGTCCCTGTGGCTGGGG - Intergenic
1062141126 9:134959715-134959737 CACGTGGGGCTCTGCCGTGGTGG + Intergenic
1203360821 Un_KI270442v1:218159-218181 CACGTGTGTGTCGGCGGGTGAGG - Intergenic
1203607052 Un_KI270748v1:67879-67901 CAGGTGGGCGTCTGCGGCCGGGG - Intergenic
1189357889 X:40325314-40325336 GAGGTGGCTCTCTGCAGCTGAGG - Intergenic
1200112100 X:153745616-153745638 CAAGTGGGTGTCAGGGGCTGGGG + Intergenic
1200246245 X:154527623-154527645 CATTTGGGTCTGTGCTGCTGTGG + Intergenic