ID: 1085023293

View in Genome Browser
Species Human (GRCh38)
Location 11:73222240-73222262
Sequence TGGGCACTCACCAGGAAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 484
Summary {0: 1, 1: 0, 2: 0, 3: 39, 4: 444}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085023293_1085023305 6 Left 1085023293 11:73222240-73222262 CCTGGCTTCCTGGTGAGTGCCCA 0: 1
1: 0
2: 0
3: 39
4: 444
Right 1085023305 11:73222269-73222291 CAGCCCTGGCTTGTAGGAGGGGG 0: 1
1: 0
2: 2
3: 20
4: 266
1085023293_1085023308 19 Left 1085023293 11:73222240-73222262 CCTGGCTTCCTGGTGAGTGCCCA 0: 1
1: 0
2: 0
3: 39
4: 444
Right 1085023308 11:73222282-73222304 TAGGAGGGGGACTCTTGCCATGG 0: 1
1: 0
2: 0
3: 9
4: 136
1085023293_1085023298 0 Left 1085023293 11:73222240-73222262 CCTGGCTTCCTGGTGAGTGCCCA 0: 1
1: 0
2: 0
3: 39
4: 444
Right 1085023298 11:73222263-73222285 GCCACCCAGCCCTGGCTTGTAGG 0: 1
1: 0
2: 2
3: 31
4: 278
1085023293_1085023309 23 Left 1085023293 11:73222240-73222262 CCTGGCTTCCTGGTGAGTGCCCA 0: 1
1: 0
2: 0
3: 39
4: 444
Right 1085023309 11:73222286-73222308 AGGGGGACTCTTGCCATGGCTGG 0: 1
1: 0
2: 0
3: 16
4: 133
1085023293_1085023304 5 Left 1085023293 11:73222240-73222262 CCTGGCTTCCTGGTGAGTGCCCA 0: 1
1: 0
2: 0
3: 39
4: 444
Right 1085023304 11:73222268-73222290 CCAGCCCTGGCTTGTAGGAGGGG 0: 1
1: 0
2: 3
3: 67
4: 372
1085023293_1085023302 4 Left 1085023293 11:73222240-73222262 CCTGGCTTCCTGGTGAGTGCCCA 0: 1
1: 0
2: 0
3: 39
4: 444
Right 1085023302 11:73222267-73222289 CCCAGCCCTGGCTTGTAGGAGGG 0: 1
1: 1
2: 1
3: 30
4: 334
1085023293_1085023295 -8 Left 1085023293 11:73222240-73222262 CCTGGCTTCCTGGTGAGTGCCCA 0: 1
1: 0
2: 0
3: 39
4: 444
Right 1085023295 11:73222255-73222277 AGTGCCCAGCCACCCAGCCCTGG 0: 1
1: 0
2: 8
3: 50
4: 401
1085023293_1085023310 24 Left 1085023293 11:73222240-73222262 CCTGGCTTCCTGGTGAGTGCCCA 0: 1
1: 0
2: 0
3: 39
4: 444
Right 1085023310 11:73222287-73222309 GGGGGACTCTTGCCATGGCTGGG 0: 1
1: 0
2: 1
3: 11
4: 99
1085023293_1085023300 3 Left 1085023293 11:73222240-73222262 CCTGGCTTCCTGGTGAGTGCCCA 0: 1
1: 0
2: 0
3: 39
4: 444
Right 1085023300 11:73222266-73222288 ACCCAGCCCTGGCTTGTAGGAGG 0: 1
1: 0
2: 0
3: 24
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085023293 Original CRISPR TGGGCACTCACCAGGAAGCC AGG (reversed) Intronic
900166951 1:1247663-1247685 TGGGAACCCACCAGGGACCCCGG + Intergenic
900193416 1:1361342-1361364 TGGGGACTCAGCACTAAGCCGGG + Intronic
901013800 1:6216192-6216214 TTGGCAGTCACCTGGAAGACTGG + Intronic
901407280 1:9057775-9057797 TGGGCACCCACCGGGAGGGCTGG + Intronic
903874287 1:26462160-26462182 TGGGCACACACCACCATGCCTGG + Intronic
903952120 1:27001941-27001963 TGGCAACCCAACAGGAAGCCGGG + Intergenic
904206304 1:28857608-28857630 TAGGCACTCACCACCATGCCTGG + Intronic
904287363 1:29461128-29461150 TGGCCAGTCACCAGGAGGCTGGG + Intergenic
905508627 1:38501047-38501069 TGGCCAGCCACCAGGAAGCAAGG + Intergenic
905616234 1:39402067-39402089 TAGGCACCCACCACCAAGCCTGG - Intronic
906637291 1:47417617-47417639 TTGGAACTCACCAGGAAACCTGG - Exonic
907388160 1:54139289-54139311 TCCTCACTCAACAGGAAGCCTGG - Exonic
907718694 1:56951607-56951629 TGTGGACTCACCATTAAGCCAGG + Intronic
908552816 1:65226618-65226640 AGGGCACACACCAGAAAGCCTGG - Exonic
909015007 1:70371407-70371429 TAGCCACTCACCAGCAAGGCAGG + Intronic
909144357 1:71910838-71910860 TGGGCACACACTACAAAGCCTGG + Intronic
910315176 1:85874638-85874660 GGGGCACTCACCCGTAAACCTGG + Exonic
910693361 1:89987022-89987044 TGGGCACACACCATCATGCCAGG + Intergenic
911600648 1:99844683-99844705 GGGGCACACACCAGCAGGCCCGG + Intergenic
911611311 1:99961582-99961604 CAGGCACTCACCAGCATGCCTGG - Intergenic
912898898 1:113626106-113626128 CAGGCACTCACCAGCACGCCTGG + Intronic
914742438 1:150476608-150476630 TTTGCACTCACTAGGAAGCCAGG - Intergenic
915113162 1:153577686-153577708 TAGGCACTCACCACCACGCCCGG + Intergenic
915784682 1:158597062-158597084 TGGGCTATCACCACTAAGCCTGG + Intergenic
915956679 1:160225984-160226006 TGGGCACACACCACCACGCCCGG + Intronic
918220921 1:182435985-182436007 TAGGCACACACCACCAAGCCTGG + Intergenic
918426470 1:184415208-184415230 AGAACACTAACCAGGAAGCCAGG + Intronic
919775742 1:201192942-201192964 TGGGGTCCCACCAGGAGGCCAGG + Intronic
920446480 1:206022318-206022340 AGGGTGCTCACCAGGAAGCCAGG + Intronic
921561953 1:216669741-216669763 CAGGCACACACCAGCAAGCCTGG - Intronic
921868403 1:220110506-220110528 TGGGCACACACCACCATGCCCGG + Intronic
922128037 1:222748430-222748452 TTGGCACTCACAAGGAAGCTAGG - Intronic
922241464 1:223758001-223758023 CAGGCACGCACCAGGATGCCAGG + Intronic
922492618 1:226030327-226030349 TGGGCACGCACCACCACGCCTGG - Intergenic
922864536 1:228848350-228848372 GGGGTACTCAGCAGGCAGCCTGG - Intergenic
923314489 1:232766515-232766537 CTGGCCCTCAGCAGGAAGCCAGG + Intergenic
923537758 1:234866124-234866146 TAGGCACTCACCACCACGCCTGG + Intergenic
924550299 1:245069900-245069922 TAGGCACACACCACCAAGCCTGG - Intronic
1062884263 10:1004591-1004613 TGGGCATTTCCCAGGAAGCAGGG + Intronic
1062961960 10:1578973-1578995 TGGGCAGGGACCAGCAAGCCTGG + Intronic
1063299264 10:4836911-4836933 TGGTCACTGACCAGCAAGCCAGG - Intronic
1063409197 10:5823806-5823828 CAGGCACTCACCACAAAGCCCGG - Intronic
1063534650 10:6871663-6871685 TAGGCACTCACCACAACGCCCGG + Intergenic
1063537938 10:6903353-6903375 TAGGCACTCACCATCACGCCTGG - Intergenic
1063618297 10:7621532-7621554 TGGTTACTCACCAAGGAGCCTGG + Intronic
1063666985 10:8068336-8068358 TTGCCACTCATCAGGAACCCTGG - Intronic
1063704133 10:8414401-8414423 TAGGCACCCACCACCAAGCCTGG - Intergenic
1064411873 10:15112369-15112391 CAGGCACACACCACGAAGCCTGG + Intronic
1064469995 10:15626361-15626383 TAGGCACTCACCACCATGCCTGG + Intronic
1065241368 10:23708493-23708515 AGAGCACTCAAAAGGAAGCCAGG - Intronic
1065512131 10:26489880-26489902 TGGGCACCCACCACTATGCCTGG - Intronic
1066107748 10:32170483-32170505 TAGGCACACACCACCAAGCCTGG + Intergenic
1066702181 10:38141965-38141987 TAGGCACTCACCACTATGCCCGG - Intergenic
1067111780 10:43406550-43406572 CGGGCACTCTCCAGCACGCCCGG - Intronic
1067521308 10:47008796-47008818 TGGGGCCTCACCAGGATGTCTGG + Intergenic
1069736962 10:70662891-70662913 TAGGCACCCACCAGCACGCCTGG + Intergenic
1069801321 10:71083697-71083719 TGGACACTCCCCAGGCAGCCTGG - Intergenic
1070769655 10:79074829-79074851 TGGCACCTCCCCAGGAAGCCTGG + Intronic
1072349832 10:94545896-94545918 TGGACACTCACCCGGGAACCGGG - Exonic
1072653139 10:97311211-97311233 TAGGCACTCACCACCATGCCTGG - Intergenic
1074211217 10:111336961-111336983 TAGGCACACACCACGATGCCTGG + Intergenic
1075157912 10:119995326-119995348 TGGGCACGCACCACCATGCCCGG + Intergenic
1075233987 10:120710153-120710175 CAGGCACTCACCACCAAGCCTGG - Intergenic
1075579892 10:123609468-123609490 TGGGTACTCACACGAAAGCCTGG - Intergenic
1076014041 10:127013601-127013623 TGGCCACACACCAGTGAGCCTGG - Intronic
1076187321 10:128459797-128459819 TGGGCACTCACCTGCTCGCCGGG + Intergenic
1076893430 10:133296368-133296390 CGGGTACTCAGCAGGCAGCCGGG - Intronic
1077082576 11:731035-731057 CAGGCACTCACCAGCACGCCTGG - Intergenic
1077291758 11:1799320-1799342 TAGGCACTCACCACCACGCCTGG + Intergenic
1077447404 11:2603831-2603853 CGGGCACGCACCACCAAGCCCGG + Intronic
1077621951 11:3733452-3733474 TGGGCACGCACCACCATGCCTGG + Intronic
1077894969 11:6447421-6447443 TAGGCACCCACCACGATGCCTGG + Intergenic
1078291502 11:10014986-10015008 TGGGCACACACCACCATGCCTGG - Intronic
1078901993 11:15650451-15650473 TGGGCCCTCACGAGGGTGCCAGG - Intergenic
1079241345 11:18724251-18724273 TGGGCACTCACCTGTGAGACTGG + Exonic
1079543271 11:21601985-21602007 TGGGCACACACCACTATGCCTGG + Intergenic
1080667660 11:34349950-34349972 TGTGCTCTCACCAGTAAGCCTGG + Intronic
1081793249 11:45803965-45803987 CTGCCACTCACCAGGCAGCCGGG - Intergenic
1083055312 11:59813470-59813492 TGGGCATGCACCACCAAGCCTGG - Intergenic
1083804862 11:65067570-65067592 TGGGCCCTGACCTGAAAGCCAGG + Intronic
1083921768 11:65785046-65785068 TGGGGTCTCACCAGGTCGCCTGG - Intergenic
1085023293 11:73222240-73222262 TGGGCACTCACCAGGAAGCCAGG - Intronic
1085564029 11:77496788-77496810 TGTGCACTCACCATCACGCCAGG - Intergenic
1086868380 11:92007484-92007506 AGGGCACACACCAGAAAGCCTGG - Intergenic
1088669612 11:112128513-112128535 TGGGAAGACACCAGGAAACCAGG + Intronic
1089273832 11:117319917-117319939 TGGGCACCCACCACCATGCCTGG - Intronic
1089293478 11:117453075-117453097 TGGGCGCCCACCATGATGCCAGG + Intronic
1091969391 12:4772993-4773015 TGGGGACTCCCCAGGCTGCCGGG + Intronic
1093485629 12:19649093-19649115 TGGGCACGCACCACCATGCCTGG + Intronic
1094567708 12:31615305-31615327 AGGGCACACACCAGAAAGCCTGG + Intergenic
1096695976 12:53348620-53348642 CAGGCACTCACCACCAAGCCTGG - Intergenic
1097595294 12:61621304-61621326 TGGGCAATCCCCAGGACCCCGGG - Intergenic
1097613643 12:61858071-61858093 TGGCCACTGAGCAGGAAACCAGG - Intronic
1098657882 12:73056212-73056234 TAGGCACCCACCACCAAGCCTGG + Intergenic
1098770505 12:74546933-74546955 CAGGCACTCACCACCAAGCCTGG - Intergenic
1098824904 12:75283669-75283691 TAGGCACGCACCACGATGCCTGG - Intronic
1100053104 12:90474975-90474997 TGGGCATTAAACAGGAAGCTTGG - Intergenic
1100675267 12:96859546-96859568 TGGGCACCCACCACCATGCCTGG + Intronic
1101778547 12:107815518-107815540 TAGGCACACACCACCAAGCCTGG - Intergenic
1101972725 12:109327272-109327294 TGGGCACCCACCACCATGCCTGG + Intergenic
1102001143 12:109558736-109558758 TGGTGACTGACCAGGGAGCCAGG - Intronic
1102022932 12:109696399-109696421 TGGCCACTCACCAGCACTCCCGG + Intergenic
1102901853 12:116644998-116645020 TGGGCACCTACCAGGAAGTGTGG - Intergenic
1103453119 12:121043623-121043645 TGGGCACTCACCATCATACCTGG - Intergenic
1104032985 12:125078676-125078698 TGGGCACCCACCACCACGCCTGG - Intronic
1104848570 12:131859776-131859798 TAGGCGCTCACCAGCATGCCTGG - Intergenic
1104997857 12:132669937-132669959 TCCTCACTCACCAGGGAGCCTGG + Intronic
1104997864 12:132669985-132670007 TCCTCACTCACCAGGGAGCCTGG + Intronic
1105419209 13:20237859-20237881 TGGCCACTCCTCAGGAAGGCGGG - Intergenic
1106459835 13:29959189-29959211 GGGGCACTCTCCAGTGAGCCAGG + Intergenic
1107909103 13:45088660-45088682 TGGGCACCCACCACCACGCCTGG + Intergenic
1108240484 13:48458129-48458151 GCGGCACGCTCCAGGAAGCCCGG - Intronic
1108360617 13:49665412-49665434 TAGGCACTCACCACCATGCCCGG + Intronic
1109603595 13:64663277-64663299 TGGGCAGCCACCAGCAGGCCTGG - Intergenic
1109994555 13:70107349-70107371 AGGGCACTCAGCAGCCAGCCAGG - Exonic
1110148321 13:72221143-72221165 TGGGCATTCTGCTGGAAGCCTGG - Intergenic
1111016196 13:82385579-82385601 TAGGCACCCACCAGCACGCCCGG + Intergenic
1111584736 13:90269681-90269703 TAGGCACACACCATGATGCCTGG - Intergenic
1111903591 13:94229962-94229984 TGGGAAATGAACAGGAAGCCAGG + Intronic
1112540911 13:100311625-100311647 TGGGCACCCACCACCACGCCTGG - Intronic
1113108524 13:106797382-106797404 TGGGCACCCACCACCATGCCTGG - Intergenic
1113956223 13:114101101-114101123 TGTGCAGTCACCAGCAAGGCGGG + Intronic
1114478620 14:23016378-23016400 CAGGCACACACCACGAAGCCCGG - Intergenic
1115094011 14:29612953-29612975 CAGGCACCCACCAGCAAGCCCGG - Intronic
1115209895 14:30956509-30956531 TGGGCACACACCACTAAACCTGG - Intronic
1115710906 14:36049801-36049823 TGGGCACACACCACCATGCCTGG - Intergenic
1116359116 14:43970831-43970853 TAGGCACTCACCACCACGCCTGG + Intergenic
1116461227 14:45177532-45177554 TGGGCACCCACCATCATGCCCGG + Intronic
1116589350 14:46750983-46751005 CAGGCACCCACCAGGAAGCCCGG + Intergenic
1116927193 14:50651767-50651789 TGGGCATGCACCACCAAGCCTGG + Intronic
1117720931 14:58628059-58628081 TGGGCTCTTCCCAGGAAGGCTGG - Intergenic
1117924696 14:60766203-60766225 TGGGCGCCCACCACCAAGCCTGG - Intronic
1118637800 14:67763930-67763952 TGTGCACTGACCAGGAATACAGG - Intronic
1118887149 14:69877134-69877156 TGGGCAAACTCCAGGATGCCAGG + Intronic
1120490532 14:85173319-85173341 TGGCCACTTACCAGAAATCCTGG - Intergenic
1121404549 14:93711617-93711639 TAGGCACGCACCACCAAGCCTGG - Intergenic
1122120702 14:99552072-99552094 TGGGCACTAACCCGGAACCTGGG + Intronic
1122373382 14:101242011-101242033 TGGGCAGGCCACAGGAAGCCAGG - Intergenic
1122579819 14:102764552-102764574 TGAGCACTCAGGAGGAAGCCTGG - Intergenic
1122800834 14:104228821-104228843 TGGCCACTCACCAGGCAGTTGGG - Intergenic
1122930228 14:104929745-104929767 TGGGCAGTCACCACAAAGGCAGG + Intronic
1122999417 14:105284465-105284487 TGGGCCATCTCCAGGAGGCCGGG - Intronic
1123056571 14:105573818-105573840 TGGGCACACACCGGTGAGCCAGG - Intergenic
1123081640 14:105697967-105697989 TGGGCACACACCGGTGAGCCAGG + Intergenic
1123457585 15:20439868-20439890 TAGGCACTCACCACCAAGCCCGG + Intergenic
1123660486 15:22560554-22560576 TAGGCACTCACCACCAAGCCCGG - Intergenic
1124214626 15:27796441-27796463 TGGGCACTCAGCATCATGCCAGG + Intronic
1124314340 15:28655039-28655061 TAGGCACTCACCACCAAGCCCGG - Intergenic
1124707169 15:31975675-31975697 TAGGCACTCAGCAGGAACACAGG - Intergenic
1124712859 15:32030136-32030158 TGGGCACTCGGGAGAAAGCCGGG - Intergenic
1125140735 15:36403529-36403551 TGGGGGCCCACCAGGGAGCCTGG + Intergenic
1125743600 15:41984336-41984358 AGGGCACTAACGGGGAAGCCTGG - Intronic
1126412746 15:48388753-48388775 TGGCCACTCTCCAGGAAGAAGGG - Intergenic
1127424063 15:58837824-58837846 TGGGCACACACCACCATGCCTGG - Intronic
1127757957 15:62111550-62111572 TGGGCACACACCACCATGCCCGG + Intergenic
1128715342 15:69903716-69903738 TGTGCACTCACCATGTGGCCAGG - Intergenic
1129605884 15:77024838-77024860 TGGGCTCTCAGCAGGTGGCCCGG - Intronic
1129977078 15:79831385-79831407 TGGGCCCGTACCAGGAAGGCTGG - Intergenic
1130080625 15:80729974-80729996 TAGGCACGCACCACCAAGCCTGG - Intronic
1130405217 15:83593959-83593981 TAGGCACACACCACCAAGCCTGG + Intronic
1130579722 15:85125150-85125172 TTGGCACTCTCCAGGAAGTGTGG + Intronic
1131269164 15:90935877-90935899 GGGGCACTAACCAGGCAGCAGGG - Intronic
1134163289 16:11909953-11909975 TAGGCACCCACCATGACGCCTGG - Intronic
1134307710 16:13048014-13048036 TGGGCACTAAGCAGGAATCCTGG - Intronic
1134685880 16:16157791-16157813 TGGGCAGCCTCCAGGGAGCCTGG + Exonic
1135401427 16:22169027-22169049 TGGGCCCTCACGAGGGAGCTGGG - Intronic
1135766353 16:25180706-25180728 CAGGCACACACCAGCAAGCCTGG + Intergenic
1135907844 16:26529761-26529783 TAGCCACTCACCACGATGCCCGG + Intergenic
1136316504 16:29457662-29457684 TGGGCCCTTAGCAGGCAGCCAGG - Exonic
1136431081 16:30197004-30197026 TGGGCCCTTAGCAGGCAGCCAGG - Exonic
1136655294 16:31705840-31705862 GGGCCACACACCAGGAGGCCTGG + Intergenic
1137755352 16:50897732-50897754 AGGACTCTGACCAGGAAGCCAGG - Intergenic
1139265106 16:65631108-65631130 TTAACACTCACCAGGAAGCCGGG + Intergenic
1140132722 16:72178032-72178054 CAGGCACTCACCACCAAGCCTGG + Intergenic
1140307233 16:73814708-73814730 TGGGCACCCACCACCATGCCTGG + Intergenic
1141603053 16:85137723-85137745 TGGGGTCCCACCAGCAAGCCTGG + Intergenic
1141649198 16:85384203-85384225 GGGGCCCCCATCAGGAAGCCTGG - Intergenic
1142000558 16:87661858-87661880 TTGGCCCCCAGCAGGAAGCCTGG + Intronic
1142047541 16:87935298-87935320 AAGGCACTGACCATGAAGCCAGG + Intronic
1143055777 17:4160732-4160754 TGGGCACGTACCAGCATGCCCGG + Intronic
1143844271 17:9760948-9760970 TGCTCACCCACCAGAAAGCCAGG - Intergenic
1144201972 17:12949719-12949741 GGGGTACTCACTTGGAAGCCTGG - Exonic
1145257681 17:21336245-21336267 GGGGCACTCTCCATGAAGACAGG + Intergenic
1145737100 17:27240644-27240666 AGGGCACTAACCTGGAAGACGGG - Intergenic
1146000975 17:29130150-29130172 TAGGCACACACCATCAAGCCTGG - Intronic
1146007128 17:29167568-29167590 TGGGCATGCACCAGCATGCCTGG - Intronic
1146251318 17:31346631-31346653 AGGGCACACACCAGAAAGCCTGG - Intronic
1146353896 17:32118346-32118368 TGGGCACATGCCAGGAGGCCTGG + Intergenic
1146534207 17:33635784-33635806 TGGGGACCTACCAGGAAGGCAGG - Intronic
1147118598 17:38321546-38321568 CGGGCACACACCATGATGCCCGG - Intronic
1147289256 17:39428508-39428530 CGGGCACTCACCAGCATGCCAGG - Intronic
1147377276 17:40030133-40030155 TGGGCGCTCACCACCACGCCTGG + Intronic
1147383624 17:40069822-40069844 TGGGCACCCACCTTGATGCCTGG + Intronic
1147459535 17:40559421-40559443 TGCGCACTCACCTGGATGCCAGG - Intronic
1147522726 17:41190000-41190022 TGGGCACACAGCAGGAGGGCTGG - Exonic
1147574589 17:41591622-41591644 CAGGCGCTCACCATGAAGCCCGG + Intergenic
1148273499 17:46282555-46282577 TAGGCACTCATCACCAAGCCTGG + Intronic
1148285885 17:46391114-46391136 TGGGCACCCACCACCACGCCTGG + Intergenic
1148308047 17:46608735-46608757 TGGGCACCCACCACCACGCCTGG + Intronic
1150058934 17:62047226-62047248 TAGGCACCCACCAGCACGCCCGG - Intronic
1150210837 17:63440629-63440651 TGGGCCCACAGCAGGGAGCCAGG - Intronic
1150258560 17:63770100-63770122 TAGGCACTCACCATCATGCCTGG + Intronic
1150409563 17:64932018-64932040 TAGGCACTCATCACCAAGCCTGG - Intergenic
1151029661 17:70721790-70721812 TGGGCACCCACCACCATGCCTGG - Intergenic
1151284945 17:73103906-73103928 TGGGTACACACCAGGAGGCGAGG + Intergenic
1151412774 17:73942281-73942303 GCAGAACTCACCAGGAAGCCAGG + Intergenic
1151741761 17:75987772-75987794 TAGGCACCCACCACCAAGCCCGG - Intronic
1152255100 17:79234370-79234392 TGGGCACTGACCAGATGGCCTGG - Intronic
1153466662 18:5395661-5395683 TGTGCACTCATCAGCACGCCTGG + Exonic
1153661254 18:7328277-7328299 TGGGCACTCACCACCACACCTGG + Intergenic
1153663060 18:7342766-7342788 TGGGCAGACAGCACGAAGCCAGG - Intergenic
1156849099 18:41705000-41705022 TTGCCACTCATCAGGAAGCCAGG + Intergenic
1156857964 18:41804839-41804861 TGGGCACTCTGCAAGAAGACAGG + Intergenic
1156965525 18:43086716-43086738 TGGGCAAACAGTAGGAAGCCTGG + Intronic
1157837793 18:50923607-50923629 TGGGCACACACCACCATGCCCGG - Intronic
1158516998 18:58138938-58138960 CTGGCAATCACCAGGATGCCTGG + Intronic
1158699843 18:59735882-59735904 CAGGCACTCACCAGCATGCCTGG + Intergenic
1160165847 18:76511712-76511734 TAGGCACTCACCACCATGCCTGG - Intergenic
1160668852 19:346531-346553 TGGGCACTCGCCACCACGCCCGG - Intergenic
1160846126 19:1166898-1166920 TTGGCACTCCCCAAGGAGCCAGG - Intronic
1161308702 19:3581738-3581760 CAGGCACTCACCATCAAGCCTGG + Intergenic
1161545423 19:4877744-4877766 TGGGCTCGCTGCAGGAAGCCAGG + Intergenic
1161779660 19:6283121-6283143 TGGGCACCCACCATCATGCCAGG - Intergenic
1162772938 19:12960888-12960910 CAGGCACTCACCATCAAGCCTGG + Intergenic
1162825891 19:13251905-13251927 TGGGCACCCACAAGCACGCCAGG + Intronic
1162851320 19:13433316-13433338 TGGGCACACGCCATGATGCCTGG - Intronic
1163116496 19:15191949-15191971 GGCTCACTCACCAGGAAGACAGG + Exonic
1163559212 19:18009107-18009129 TGGCCACTCACCAGCAGGGCTGG - Exonic
1163612865 19:18310099-18310121 TGTGCACTCACAAGGAAGACTGG + Intronic
1164537137 19:29094138-29094160 TGGGCCCTCACCAGCAATTCTGG - Intergenic
1165051879 19:33147092-33147114 TGGGCACTCATCATCATGCCTGG - Intronic
1165247399 19:34505270-34505292 TGAGCACTCTCCAGGATCCCAGG - Exonic
1165646594 19:37443873-37443895 TAGGCACCCACCAGCACGCCTGG - Intronic
1166404350 19:42508946-42508968 GGGGCAGTGACCAGGCAGCCTGG + Exonic
1166599124 19:44078602-44078624 CGGGCACGCACCACGATGCCTGG + Intronic
1167326404 19:48828917-48828939 TAGGCACTCACCACCACGCCTGG - Intronic
1168216874 19:54932796-54932818 TAGGCACGCACCACCAAGCCTGG + Intronic
1168263860 19:55210478-55210500 TGGGCACACACCAATATGCCCGG - Intergenic
1168690220 19:58372195-58372217 TAGGCATTCACCACCAAGCCCGG + Intronic
925171447 2:1752376-1752398 TGGTCACCCAGGAGGAAGCCAGG + Intergenic
925488716 2:4368506-4368528 TAGGCACTCACCACCACGCCTGG + Intergenic
925868183 2:8247067-8247089 TAGGGACACACCAGGCAGCCAGG + Intergenic
926302568 2:11614976-11614998 TGGGTCCTCACCAGGAAGGTGGG + Intronic
926903188 2:17779742-17779764 TAGGCACGCACCAGCATGCCCGG + Intronic
927077884 2:19598172-19598194 TGGGAAATCATCAGGAATCCCGG + Intergenic
927903318 2:26839232-26839254 CAGGCACCCACCACGAAGCCTGG + Intergenic
928277814 2:29919274-29919296 TGGGGAGTCACTATGAAGCCAGG - Intronic
928333181 2:30373427-30373449 CAGGCACCCACCAGCAAGCCTGG + Intergenic
928730292 2:34224276-34224298 TGGGCACCCACCACCATGCCTGG + Intergenic
929758814 2:44789448-44789470 TGGGTCTTCACCAGGAAGCAAGG + Intergenic
930200992 2:48551915-48551937 TGGTGACTGACCAGGAATCCGGG - Intronic
932621386 2:73266446-73266468 TGGGCACTCACCATTCTGCCTGG + Exonic
935118523 2:100159247-100159269 TGGGCACCCACCACCACGCCAGG - Intergenic
935995623 2:108768888-108768910 TAGGCACGCACCACGACGCCCGG - Intronic
936011028 2:108925410-108925432 TGGGCACCCATCATAAAGCCGGG - Intronic
937013594 2:118583495-118583517 TGGGCCCTCACCAGACATCCAGG - Intergenic
937280682 2:120715444-120715466 TGAGCAGTCAGCAGCAAGCCGGG - Intergenic
937881075 2:126865334-126865356 CGGACACTCAGCAGGGAGCCTGG - Intergenic
938055671 2:128212851-128212873 TGGGCGCACGCCAGCAAGCCAGG - Intergenic
938803550 2:134785705-134785727 TGGGCACTCCCAGGCAAGCCGGG + Intergenic
939446401 2:142315224-142315246 TTGGGACTCACCAGCAAGTCAGG - Intergenic
940293621 2:152100208-152100230 TGCACATGCACCAGGAAGCCTGG - Intergenic
941436347 2:165477832-165477854 AAGGCACTCACCAGCACGCCTGG - Intronic
942479849 2:176373348-176373370 TGGGCACACACCACCATGCCTGG + Intergenic
943821604 2:192330142-192330164 TGGGCCCTCCCAAGTAAGCCAGG - Intergenic
944238833 2:197465947-197465969 TAGGCACTCACCACCACGCCTGG - Intronic
944543100 2:200772546-200772568 CAGGCACTCACCACCAAGCCTGG - Intergenic
944771767 2:202921969-202921991 TAGGCACTCACCACCATGCCTGG + Intronic
945800683 2:214426027-214426049 TGGGCACCCACCATCATGCCAGG - Intronic
945962460 2:216149803-216149825 TGGGCACTCTTCTGGAAGCTTGG + Intronic
947276996 2:228403038-228403060 TAGGCACTCACCACCATGCCTGG + Intergenic
947503271 2:230687299-230687321 TAGGCACACACCACTAAGCCCGG - Intergenic
948562208 2:238861683-238861705 ACGGGATTCACCAGGAAGCCTGG - Intronic
1170292753 20:14788909-14788931 CAGGCACTCACCACGATGCCCGG + Intronic
1170601589 20:17845545-17845567 TGGGCACCCACCACCATGCCCGG - Intergenic
1170835777 20:19883480-19883502 TAGGCACTCACCACCATGCCTGG + Intergenic
1170839182 20:19909836-19909858 GAGGCACTCAGCAGGCAGCCTGG + Intronic
1171095368 20:22327657-22327679 CGGACACCCACCACGAAGCCTGG - Intergenic
1171749591 20:29035933-29035955 TGGGGCCTCTACAGGAAGCCGGG - Intergenic
1172098926 20:32474165-32474187 TGGTCACTCACCAGGTGACCTGG + Intronic
1172688978 20:36777734-36777756 AGGACCCTCACCAGGAAACCAGG + Exonic
1172796358 20:37541735-37541757 TGGGCACGCACCATGACGCCTGG - Intergenic
1174367113 20:50063230-50063252 TAGGCACGCACCACCAAGCCTGG - Intergenic
1174460376 20:50678268-50678290 AGGGCATTCACCAGGAACCTGGG + Intronic
1175204570 20:57301870-57301892 CAGGCACCCACCAGCAAGCCCGG + Intergenic
1175888602 20:62306102-62306124 AGGTCCCTCACCTGGAAGCCAGG + Intronic
1175894941 20:62331907-62331929 TAGGCACTCACCACCACGCCTGG - Intronic
1176000213 20:62828281-62828303 TGGGCACCCAGCAGGAAGGAAGG - Intronic
1176259123 20:64169971-64169993 GGGGCACTCGGCAGGAAGGCTGG - Intronic
1177164156 21:17580891-17580913 TGGGCACGCACCAGTACACCTGG + Intronic
1179597896 21:42455347-42455369 GGTCCACTCACCAGGATGCCAGG - Intergenic
1179625386 21:42646271-42646293 TGGGGGCTCCACAGGAAGCCTGG + Intergenic
1179821980 21:43942365-43942387 TGGCCACTCACCAGGAGCCTGGG + Intronic
1179920350 21:44504015-44504037 TGAGCCCTCAGCAGGAAGCAAGG + Intronic
1179969614 21:44827460-44827482 TGGGCACTCACAGGAAAGGCTGG + Intergenic
1180393440 22:12306020-12306042 TGGGGCCTCTACAGGAAGCCGGG + Intergenic
1180406308 22:12558748-12558770 TGGGGCCTCTACAGGAAGCCGGG - Intergenic
1180581965 22:16846150-16846172 TGGCCACTCCCCAGGAGCCCGGG + Intergenic
1180633762 22:17248038-17248060 TAGCCAATCACAAGGAAGCCTGG - Intergenic
1180940968 22:19659308-19659330 TGGGGACTCATCAGGCTGCCTGG - Intergenic
1181022767 22:20112388-20112410 GGGGCCCTGACCAGGAAGACAGG - Exonic
1181609783 22:24004663-24004685 TGGGCTCCCACCAGGCACCCTGG - Intergenic
1183490169 22:38111752-38111774 GCTGCACCCACCAGGAAGCCTGG + Exonic
1184458473 22:44624444-44624466 TGGGCAGTCCCCAGGCAGGCAGG - Intergenic
1184974902 22:48054126-48054148 TTGGCACTCGCAAGGAAACCAGG + Intergenic
951897764 3:27626723-27626745 TGGACACTCACCAGAAAGCAAGG + Intergenic
954136816 3:48585679-48585701 GGGACACTCACCGGGAGGCCAGG + Exonic
954398622 3:50307220-50307242 TAGGCACACACCACTAAGCCTGG - Intronic
954975209 3:54687281-54687303 CAGGCACTCACCACCAAGCCTGG + Intronic
958012231 3:87894397-87894419 TGGGCACGCACCACCATGCCTGG + Intergenic
958140465 3:89556176-89556198 CAGGCACTCACCACCAAGCCTGG + Intergenic
958880327 3:99662237-99662259 TAGGCACTCACCACCACGCCTGG - Intronic
960764811 3:121113813-121113835 TGGGCACCCACCACCACGCCCGG + Intronic
961014710 3:123458698-123458720 TAGGCACTCACCACCACGCCTGG - Intergenic
961143194 3:124572892-124572914 TAGGCACTCACCACCATGCCCGG - Intronic
961317907 3:126052928-126052950 GGGGCTTTCAGCAGGAAGCCTGG + Intronic
961659622 3:128461868-128461890 TGGGCACTCGCCAGGGAGCGTGG + Intergenic
962087612 3:132208421-132208443 TGGGCAGTAACAAGGATGCCAGG - Intronic
962403758 3:135083013-135083035 TGGGAACTCCTCAGGCAGCCAGG + Intronic
966909290 3:184549817-184549839 TGGGCAGTGACCAGGGAGCATGG - Intronic
967483063 3:189997162-189997184 TGGGCACACACCACCATGCCCGG + Intronic
967980029 3:195060169-195060191 GGGGCACGCAGCAGGAATCCAGG + Intergenic
968421144 4:485830-485852 TAGGCACGCACCAGCACGCCTGG - Intronic
968522134 4:1038817-1038839 TGGGCACGCACCACCACGCCCGG + Intergenic
968552318 4:1229939-1229961 TGGGCATTCTCCAGGAAGAAGGG + Intronic
968623529 4:1615365-1615387 TGGGCACACACACGGAAGACAGG + Intergenic
969049981 4:4365887-4365909 TGGGCTCTGATCAGGAAGCCTGG + Intronic
969442215 4:7224151-7224173 TGGGAAGTCTCCAGGAAGCTTGG + Intronic
969635852 4:8369252-8369274 TGGGGGCTCACCAGGCAGACAGG - Intronic
969810850 4:9646741-9646763 TGGGTACACACCATCAAGCCTGG - Intergenic
970377723 4:15475774-15475796 TTTCCACTCACCAGGAACCCTGG - Intronic
972617096 4:40709733-40709755 TGGGCACGCACCACCATGCCTGG - Intergenic
973773026 4:54223932-54223954 TGGGCACACACCACCATGCCTGG + Intronic
974727484 4:65814419-65814441 TGGGCACCCACCACCACGCCTGG - Intergenic
975582446 4:75919182-75919204 TAGGCACACACCACCAAGCCTGG + Intronic
976350757 4:84057117-84057139 TGGGCACACACCACCATGCCTGG + Intergenic
978401544 4:108336023-108336045 TCTCCACTCACCAGGAAACCTGG + Intergenic
981961049 4:150539116-150539138 TGGGCACGCACCACCATGCCCGG + Intronic
984811887 4:183802514-183802536 TAGGCACACACCACTAAGCCTGG + Intergenic
984921587 4:184768924-184768946 TGGGCACCCGCCACCAAGCCCGG - Intronic
984933394 4:184868214-184868236 TGGGCACCCAGCACGACGCCTGG + Intergenic
984981817 4:185289424-185289446 TGAGCAGTCATCTGGAAGCCTGG + Intronic
985431470 4:189885485-189885507 TGGGGCCTCTACAGGAAGCCGGG - Intergenic
986094617 5:4542322-4542344 TCCTCACTCATCAGGAAGCCAGG - Intergenic
988829440 5:34972972-34972994 TGCAAACTCATCAGGAAGCCTGG - Intergenic
989212460 5:38869336-38869358 AGTGCACTGACCAGGAAGTCAGG - Intronic
989565235 5:42894923-42894945 TGGGCACCCGCCACCAAGCCCGG - Intergenic
990502537 5:56410726-56410748 CGGGCACCCACCTGCAAGCCAGG - Intergenic
991354087 5:65749457-65749479 AGTGCATTCACCAGGAATCCAGG + Intronic
991457066 5:66815528-66815550 CGGGCATTCACCAGGCATCCTGG + Intronic
992702327 5:79353267-79353289 TAGGCACCCACCACCAAGCCTGG + Intergenic
992753033 5:79878743-79878765 TGGGCACTCTCGAGAAAGACAGG - Intergenic
994096683 5:95853633-95853655 GGGGCTCGTACCAGGAAGCCTGG + Intronic
997300587 5:132801038-132801060 GGGGCACTCAGCAGGAAGAAAGG - Intronic
997485857 5:134230058-134230080 CAGGCACCCACCAGGACGCCTGG - Intergenic
998105549 5:139466878-139466900 TAGACACACACCACGAAGCCTGG + Intergenic
998208340 5:140175357-140175379 AGGGCGCTCCCCAGGGAGCCCGG - Intronic
998625392 5:143840348-143840370 AAGGCACTCAACAGAAAGCCTGG - Intergenic
998970303 5:147584085-147584107 TTGGCACTCACCACCATGCCCGG + Intergenic
999372420 5:151064055-151064077 AGGGCACTCCACAGAAAGCCAGG + Intronic
1001606939 5:172967320-172967342 TAGGCACGCACCAGCAGGCCTGG - Intronic
1002111499 5:176917427-176917449 CAGGCACTCACCACCAAGCCCGG - Intronic
1002155893 5:177279353-177279375 TAGGCACACACCACCAAGCCCGG - Intronic
1002829295 6:804701-804723 GGGGCGCTCACCATGATGCCAGG + Intergenic
1003019336 6:2496356-2496378 TGGGCAGGCACCAGGAAGCATGG - Intergenic
1004519533 6:16348557-16348579 CAGGCACTCACCACCAAGCCCGG - Intronic
1005418066 6:25622328-25622350 TAGGCACCCACCACCAAGCCTGG - Intergenic
1005510377 6:26507076-26507098 CAGGCACTCACCAATAAGCCTGG - Intronic
1005925576 6:30442620-30442642 TGGGTACTCGTCAGGAAGCAGGG - Intergenic
1006188341 6:32192636-32192658 TGGGTACTGAGCAGGAAGCTGGG + Exonic
1006653469 6:35570138-35570160 TGGGCGCCCACCACCAAGCCTGG + Intergenic
1007488724 6:42201077-42201099 TAGGCACCCGCCAGCAAGCCCGG + Intergenic
1007807158 6:44458848-44458870 TAGGCACACACAAGGAAGCAGGG - Intergenic
1008279982 6:49585473-49585495 TAGGCACTCACCACCACGCCTGG + Intergenic
1008330702 6:50240941-50240963 TGGGCACTGACCAGCAAGACAGG - Intergenic
1010207215 6:73333905-73333927 TAGGCACACACCAGCAAGCCTGG - Intergenic
1011273037 6:85599507-85599529 TAGGCACGCACCAGCATGCCTGG - Intronic
1011371314 6:86639857-86639879 TGAGCTCTCACCAAAAAGCCTGG + Intergenic
1011693604 6:89892121-89892143 TAGGCACTCACCATCATGCCTGG + Intergenic
1012186006 6:96218036-96218058 TAGGCACCCACCAAGACGCCCGG + Intergenic
1013211757 6:107993290-107993312 TAGGCACTCACCACCATGCCCGG + Intergenic
1014635947 6:123846733-123846755 AGCGCCCTCATCAGGAAGCCTGG - Intronic
1015234140 6:130951465-130951487 TAGGCACTCACCACCACGCCCGG + Intronic
1016908988 6:149178430-149178452 TGGGCAGGCACCAGGACTCCGGG + Intergenic
1017366314 6:153644972-153644994 TGTGCACTCACAAGGCAGTCAGG + Intergenic
1017865848 6:158442548-158442570 TGGCCACTCACCAAGAGGCCTGG - Intronic
1018730374 6:166645658-166645680 TGGGGGCACTCCAGGAAGCCTGG + Intronic
1019047260 6:169158747-169158769 TGGGCACCCACCAGGAATAAAGG - Intergenic
1019780330 7:2936031-2936053 TGGGCACGCACCACCACGCCTGG + Intronic
1020058311 7:5133878-5133900 CAGGCACACACCAGCAAGCCTGG + Intergenic
1020132273 7:5565662-5565684 TAGGCACACACCAGCACGCCCGG + Intergenic
1020862497 7:13512259-13512281 TAGGCACACACCATCAAGCCTGG - Intergenic
1021744646 7:23726471-23726493 TGGGCACGCACCACCACGCCTGG - Intronic
1022840794 7:34161927-34161949 TGGGCACCCACCACAATGCCTGG + Intergenic
1023063554 7:36352687-36352709 TGGGCACCCGCCATGATGCCTGG - Intronic
1024045604 7:45583604-45583626 TGGCCAAGCACCAGGAAGCCAGG - Intronic
1026393030 7:69921626-69921648 TAGGCACACACCACCAAGCCTGG - Intronic
1026551428 7:71372305-71372327 TAGGCACCCACCACCAAGCCTGG + Intronic
1026688878 7:72535328-72535350 TAGGCACTCACCACCATGCCTGG - Intergenic
1026759876 7:73118670-73118692 TGGGCACCCACCACCATGCCTGG - Intergenic
1027036218 7:74927482-74927504 TGGGCACCCACCACCATGCCTGG - Intergenic
1027087345 7:75273982-75274004 TGGGCACCCACCACCATGCCTGG + Intergenic
1027262272 7:76473341-76473363 CGGGCACTTTCCAGGAGGCCTGG - Intronic
1027313653 7:76971438-76971460 CGGGCACTTTCCAGGAGGCCTGG - Intergenic
1027560062 7:79718329-79718351 TAGGCACTCACCACCACGCCTGG - Intergenic
1029522341 7:101071252-101071274 CAGGCACTCACCACCAAGCCTGG - Intergenic
1029548502 7:101223821-101223843 TGGGGACCCACCAGGAGACCAGG + Exonic
1030051852 7:105545307-105545329 TGGGTGCTCACCACCAAGCCTGG - Intronic
1030498187 7:110326405-110326427 TGGGCACACACCACCATGCCTGG + Intergenic
1030745796 7:113164629-113164651 TCGGCATTCACTAGGAAGTCAGG + Intergenic
1031352492 7:120752313-120752335 GGGGCACTCACCAATAAGGCGGG + Intergenic
1032931312 7:136675683-136675705 TGGGGACTCACAAGGAAGGGTGG - Intergenic
1034301392 7:150018186-150018208 TGGGCATGCACCACAAAGCCTGG + Intergenic
1034804657 7:154079112-154079134 TGGGCATGCACCACAAAGCCTGG - Intronic
1035682777 8:1500546-1500568 TGGGCTCTGCCCAGGAAACCAGG - Intergenic
1035984109 8:4406629-4406651 TGGCCACACAACAGGAAGCATGG + Intronic
1036389305 8:8310715-8310737 TCGGCACTGACCGGGAAGGCAGG + Intergenic
1037854167 8:22358277-22358299 TAGGCACACACCACCAAGCCTGG - Intergenic
1038262337 8:26007226-26007248 TGTCCACTCACCAAGAGGCCAGG - Intronic
1038504753 8:28074794-28074816 TGGGCACCCACCACCACGCCTGG - Intronic
1039847286 8:41334519-41334541 TGGGCAGTCACCAGGTTTCCAGG - Intergenic
1041239631 8:55838463-55838485 TGGGCACCCACCACCATGCCTGG - Intergenic
1041240424 8:55844678-55844700 TGGTCACTCAGGAGGAAGCCCGG - Intergenic
1041324501 8:56650667-56650689 TGGGCACCCACCACCATGCCTGG - Intergenic
1041753654 8:61288755-61288777 TGGAGAATCACCAGGAAGCAGGG + Intronic
1042258469 8:66831480-66831502 TAGGCACACACCAGCATGCCTGG + Intronic
1045439388 8:102194455-102194477 TAGGCGCTCACCACCAAGCCTGG - Intergenic
1046114484 8:109768346-109768368 TCTGAACTCACCAGGAAGCTAGG - Intergenic
1048048389 8:130794385-130794407 TAGGCACCCACCAGCACGCCTGG + Intronic
1048136738 8:131753390-131753412 TGGTCACTCAGAAGGCAGCCAGG + Intergenic
1049271389 8:141698102-141698124 TGGGAACTCACCAGGTGGCCTGG - Intergenic
1049475144 8:142793841-142793863 AGGGAACTCACCAGGACCCCAGG + Intergenic
1050433281 9:5583847-5583869 TGGGCACTCATCACCACGCCCGG - Intergenic
1050706036 9:8398767-8398789 TGGGCCCTCACCAGAAAGCAAGG + Intronic
1051224448 9:14884084-14884106 TGGGCACCCACCACCACGCCCGG - Intronic
1052028479 9:23601570-23601592 TGGGTACCCACCAGGTAGCCTGG - Intergenic
1053288002 9:36862279-36862301 TGGCCACACACCAGGAATGCAGG + Intronic
1057585219 9:96322859-96322881 AGGGCACTCACCACCACGCCTGG + Intronic
1058257141 9:102781008-102781030 CAGGCACCCACCAGGACGCCCGG + Intergenic
1058347251 9:103979039-103979061 TGGACAGTCACCAAGCAGCCTGG + Intergenic
1059439804 9:114300676-114300698 AGGGAACTCACCATCAAGCCAGG - Exonic
1059696983 9:116738787-116738809 TGGGCTCTCAGCTGGAAGCTAGG - Intronic
1059960539 9:119560190-119560212 TGGTGGCTCAGCAGGAAGCCAGG + Intergenic
1060299152 9:122364054-122364076 CAGGCACTCACCACCAAGCCTGG - Intergenic
1061823212 9:133239924-133239946 TGGGCACTGTCCAGGACACCAGG + Intergenic
1061869117 9:133510936-133510958 GGGGCTCTGACCAGGGAGCCAGG - Intergenic
1061992890 9:134169818-134169840 TGGGCACCCACAAGGAAGGAAGG + Intergenic
1062509021 9:136894640-136894662 TGGGCACTCAGAAGGAAACCCGG - Intronic
1062624300 9:137435960-137435982 TGAGGCCTCACAAGGAAGCCCGG + Intronic
1203454489 Un_GL000219v1:152351-152373 TGGGGCCTCTACAGGAAGCCGGG + Intergenic
1185488749 X:503248-503270 GGGGCGCCCACCACGAAGCCCGG + Intergenic
1186630808 X:11346564-11346586 TAGGCACCCACCAGCATGCCTGG - Intronic
1187391158 X:18887340-18887362 TGGGCACAGGCCAGGCAGCCTGG - Intergenic
1187478974 X:19637932-19637954 TAGGCACTCACCACCAAGCCTGG - Intronic
1187993982 X:24905703-24905725 TAGGCACTCACCACCACGCCCGG + Intronic
1188100289 X:26074120-26074142 TGGGCAATCACCAGGCAATCCGG + Intergenic
1188635786 X:32429350-32429372 TAGGCACCCACCACCAAGCCTGG + Intronic
1189913663 X:45836249-45836271 TGGGCACTCACCACCATGCCTGG - Intergenic
1189986341 X:46556861-46556883 TAGGCACCCACCACCAAGCCTGG + Intergenic
1190004646 X:46723717-46723739 TGGGCAGTTTCCAGGAAGCATGG - Intronic
1190016060 X:46828324-46828346 TGGGCACCCACCACCATGCCTGG - Intergenic
1190343861 X:49320111-49320133 TAGGCACCCACCAGCACGCCTGG + Intergenic
1190344955 X:49329655-49329677 TAGGCACCCACCAGCACGCCTGG + Intergenic
1190346049 X:49339220-49339242 TAGGCACCCACCAGCACGCCTGG + Intergenic
1190347302 X:49530251-49530273 TAGGCACCCACCAGCACGCCTGG + Intergenic
1190348401 X:49539807-49539829 TAGGCACCCACCAGCACGCCTGG + Intergenic
1190349502 X:49549363-49549385 TAGGCACCCACCAGCACGCCTGG + Intergenic
1190350606 X:49558916-49558938 TAGGCACCCACCAGCACGCCTGG + Intronic
1190351708 X:49568474-49568496 TAGGCACCCACCAGCACGCCTGG + Intergenic
1190352808 X:49578023-49578045 TAGGCACCCACCAGCACGCCTGG + Intergenic
1190353909 X:49587570-49587592 TAGGCACCCACCAGCACGCCTGG + Intergenic
1190355011 X:49597094-49597116 TAGGCACCCACCAGCACGCCTGG + Intronic
1190410814 X:50135549-50135571 TGGAAACTCACCAGGAATCAAGG + Intergenic
1193212193 X:78820348-78820370 CAGGCACGCACCAGGACGCCTGG - Intergenic
1193525762 X:82586468-82586490 AGGGCACTCAACAGGAGCCCTGG + Intergenic
1193636840 X:83961441-83961463 TGGGAACTCAGCAGGAAGGGTGG + Intergenic
1194713913 X:97268997-97269019 CGGGCACTCACCACCACGCCCGG + Intronic
1194857025 X:98943842-98943864 TGGGCACACACCATGGAGCCTGG + Intergenic
1195999889 X:110771002-110771024 TAGGCACTCACCACCATGCCTGG - Intronic
1197545850 X:127822864-127822886 CAGGCACTCACCACCAAGCCTGG - Intergenic
1197781242 X:130162644-130162666 TTGGCAGTGTCCAGGAAGCCAGG + Intronic
1198011773 X:132563889-132563911 TGGGCACTGACAAGGATGGCAGG + Intergenic
1198882800 X:141299348-141299370 TGGGCATTCACCAGGGAAACAGG - Intergenic
1201251602 Y:12063877-12063899 TAGGCACTCACCACCATGCCTGG - Intergenic