ID: 1085026379

View in Genome Browser
Species Human (GRCh38)
Location 11:73239021-73239043
Sequence CCTTCCATGCAGGGCGTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085026374_1085026379 -1 Left 1085026374 11:73238999-73239021 CCATTTCTAAAGTGTGCTGCTAC No data
Right 1085026379 11:73239021-73239043 CCTTCCATGCAGGGCGTTGAGGG No data
1085026373_1085026379 0 Left 1085026373 11:73238998-73239020 CCCATTTCTAAAGTGTGCTGCTA No data
Right 1085026379 11:73239021-73239043 CCTTCCATGCAGGGCGTTGAGGG No data
1085026371_1085026379 25 Left 1085026371 11:73238973-73238995 CCTAATCTTGCAGCACCTCAGTT No data
Right 1085026379 11:73239021-73239043 CCTTCCATGCAGGGCGTTGAGGG No data
1085026372_1085026379 10 Left 1085026372 11:73238988-73239010 CCTCAGTTTTCCCATTTCTAAAG No data
Right 1085026379 11:73239021-73239043 CCTTCCATGCAGGGCGTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085026379 Original CRISPR CCTTCCATGCAGGGCGTTGA GGG Intergenic
No off target data available for this crispr