ID: 1085028434

View in Genome Browser
Species Human (GRCh38)
Location 11:73254612-73254634
Sequence CTCTGAGAATGAAAGGAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085028427_1085028434 25 Left 1085028427 11:73254564-73254586 CCACTTGGGAGGACAGAATTATT No data
Right 1085028434 11:73254612-73254634 CTCTGAGAATGAAAGGAACTTGG No data
1085028430_1085028434 -1 Left 1085028430 11:73254590-73254612 CCCGTTGTACAGGTGACCAGAGC No data
Right 1085028434 11:73254612-73254634 CTCTGAGAATGAAAGGAACTTGG No data
1085028429_1085028434 0 Left 1085028429 11:73254589-73254611 CCCCGTTGTACAGGTGACCAGAG No data
Right 1085028434 11:73254612-73254634 CTCTGAGAATGAAAGGAACTTGG No data
1085028431_1085028434 -2 Left 1085028431 11:73254591-73254613 CCGTTGTACAGGTGACCAGAGCT No data
Right 1085028434 11:73254612-73254634 CTCTGAGAATGAAAGGAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085028434 Original CRISPR CTCTGAGAATGAAAGGAACT TGG Intergenic
No off target data available for this crispr