ID: 1085028828

View in Genome Browser
Species Human (GRCh38)
Location 11:73257615-73257637
Sequence GGCAAAGGGGAGCCATGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085028816_1085028828 19 Left 1085028816 11:73257573-73257595 CCTGTTCAGAACAAGGGCTAGCT No data
Right 1085028828 11:73257615-73257637 GGCAAAGGGGAGCCATGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085028828 Original CRISPR GGCAAAGGGGAGCCATGTGG GGG Intergenic
No off target data available for this crispr