ID: 1085029095

View in Genome Browser
Species Human (GRCh38)
Location 11:73258793-73258815
Sequence TAACCGATGACAGCTGGAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085029090_1085029095 10 Left 1085029090 11:73258760-73258782 CCAGAAGTGCCAGAAAGTTTGAG No data
Right 1085029095 11:73258793-73258815 TAACCGATGACAGCTGGAGTTGG No data
1085029089_1085029095 28 Left 1085029089 11:73258742-73258764 CCTTTGGAGCACACTTGGCCAGA No data
Right 1085029095 11:73258793-73258815 TAACCGATGACAGCTGGAGTTGG No data
1085029092_1085029095 1 Left 1085029092 11:73258769-73258791 CCAGAAAGTTTGAGGATCAGCCT No data
Right 1085029095 11:73258793-73258815 TAACCGATGACAGCTGGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085029095 Original CRISPR TAACCGATGACAGCTGGAGT TGG Intergenic
No off target data available for this crispr