ID: 1085031760

View in Genome Browser
Species Human (GRCh38)
Location 11:73275402-73275424
Sequence GTGTCCTATCCCTTCTATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 64}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085031756_1085031760 4 Left 1085031756 11:73275375-73275397 CCTTTCAAATCAGCCCACAGTTC 0: 1
1: 0
2: 1
3: 17
4: 167
Right 1085031760 11:73275402-73275424 GTGTCCTATCCCTTCTATTGAGG 0: 1
1: 0
2: 0
3: 9
4: 64
1085031755_1085031760 8 Left 1085031755 11:73275371-73275393 CCAGCCTTTCAAATCAGCCCACA 0: 1
1: 0
2: 2
3: 16
4: 195
Right 1085031760 11:73275402-73275424 GTGTCCTATCCCTTCTATTGAGG 0: 1
1: 0
2: 0
3: 9
4: 64
1085031754_1085031760 23 Left 1085031754 11:73275356-73275378 CCAGAGGGATGGGAACCAGCCTT 0: 1
1: 0
2: 0
3: 20
4: 185
Right 1085031760 11:73275402-73275424 GTGTCCTATCCCTTCTATTGAGG 0: 1
1: 0
2: 0
3: 9
4: 64
1085031757_1085031760 -9 Left 1085031757 11:73275388-73275410 CCCACAGTTCCTGAGTGTCCTAT 0: 1
1: 0
2: 1
3: 11
4: 196
Right 1085031760 11:73275402-73275424 GTGTCCTATCCCTTCTATTGAGG 0: 1
1: 0
2: 0
3: 9
4: 64
1085031758_1085031760 -10 Left 1085031758 11:73275389-73275411 CCACAGTTCCTGAGTGTCCTATC 0: 1
1: 0
2: 1
3: 5
4: 148
Right 1085031760 11:73275402-73275424 GTGTCCTATCCCTTCTATTGAGG 0: 1
1: 0
2: 0
3: 9
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085031760 Original CRISPR GTGTCCTATCCCTTCTATTG AGG Intronic
912457267 1:109806465-109806487 GGGCCCTGTCCCTTCTAATGTGG + Intergenic
917298398 1:173546069-173546091 TTATCCTATCCCTTGAATTGGGG - Intronic
921361643 1:214335234-214335256 GTGCCCTGACCCTTCTATTTGGG - Intronic
922354530 1:224763426-224763448 GCTTCCTATCCCTTCTATTCTGG - Intergenic
1062995067 10:1858039-1858061 GTGTTCTATCCTTCCTATTAAGG + Intergenic
1065125238 10:22567749-22567771 GTCTCCCACCCCTGCTATTGTGG - Intronic
1068926803 10:62548629-62548651 GGGTCCCATCCATTCTATTTTGG + Intronic
1073001213 10:100287413-100287435 ATCTCCTATCCCTTCTTCTGTGG - Intergenic
1076816218 10:132916123-132916145 CTGTGCTCTCCCTCCTATTGTGG - Intronic
1085031760 11:73275402-73275424 GTGTCCTATCCCTTCTATTGAGG + Intronic
1085312045 11:75522580-75522602 ATGTCCTGTCTCTTCTGTTGGGG - Intronic
1092074608 12:5662828-5662850 GGGTCCTATCCCATTTATTCTGG - Intronic
1098407376 12:70140610-70140632 GTGTCCTCTCTCTTCTCATGAGG - Intergenic
1101226360 12:102691841-102691863 GTGTCCTATGCCCTGTAGTGAGG - Intergenic
1107820421 13:44280933-44280955 GTGTGCTATACCTTTTATGGAGG + Intergenic
1110992951 13:82067419-82067441 TTATCTTATCCCTTCTATTCTGG - Intergenic
1112381860 13:98898718-98898740 ATATCTTATCCCTTATATTGTGG - Intronic
1112874580 13:104020102-104020124 GTGTCCTATCCTTTCTTTTTAGG + Intergenic
1120130730 14:80803743-80803765 TTGTCCTGTCCCTTATCTTGGGG - Intronic
1129908186 15:79204584-79204606 TTGTCCTATCACTTTTAGTGGGG + Intergenic
1139812373 16:69632409-69632431 GTGTGCTATCACTTCGATTAGGG + Intronic
1143758100 17:9081121-9081143 GTGTCAAATCCCATCTGTTGAGG - Intronic
1146419957 17:32674444-32674466 GTGTTCTCTCCCTTCTCTTGGGG - Intronic
1147434830 17:40404380-40404402 GAGATCTATCCCTTCTATGGTGG - Exonic
1148516518 17:48223418-48223440 GTGTCCACTCCCTTATATTCTGG + Intronic
1151587466 17:75018898-75018920 GTGTCCTGTCCCTTGGGTTGTGG - Intronic
1158195600 18:54881793-54881815 GTGTCCTATCCATCCTGCTGGGG + Intronic
1158468665 18:57714256-57714278 GTGTCCTATCTATTCTACTGTGG - Intronic
1160612626 18:80100332-80100354 GAGGCCTTTCCCTTCTATTAAGG + Intergenic
1161480532 19:4508124-4508146 CTGTCCTGTCCCTGCTTTTGGGG + Intronic
1162018087 19:7856449-7856471 GTTTCCTTTCCTTTCTTTTGAGG - Intronic
1165307332 19:35010674-35010696 GTGTCCTGTCCCTGTCATTGTGG + Intronic
1167646323 19:50707304-50707326 GTGTCCTCTCCCTTTTATCTTGG + Intronic
927063789 2:19449065-19449087 CTGTCTTACCTCTTCTATTGGGG - Intergenic
929085827 2:38166366-38166388 TTTTCCTGTCCCTTCAATTGAGG + Intergenic
938091938 2:128440126-128440148 GTGACCCTTCCCTTCTTTTGTGG + Intergenic
938706704 2:133937006-133937028 TTGTCCTATAACTTGTATTGTGG - Intergenic
943096378 2:183434608-183434630 GTCTCCTCTCCCTTGTATTGAGG + Intergenic
944523726 2:200597456-200597478 GCTTCCTATGCCTTCTACTGTGG - Exonic
944527392 2:200633958-200633980 GTGTCCCAGCCTCTCTATTGGGG - Intronic
1170922669 20:20693727-20693749 GTGACCTACCCTTTCTAGTGGGG - Intronic
1171254612 20:23680017-23680039 GTTGCCTTTCCCTTCTAATGCGG - Intergenic
1171270215 20:23811132-23811154 GTTGCCTTTCCCTTCTAATGCGG - Intergenic
1172190960 20:33061655-33061677 TTCTCCTCTCCCTTCTCTTGGGG - Intronic
1175646704 20:60680258-60680280 GTGTCCCATGCATTCCATTGTGG + Intergenic
1179367548 21:40772524-40772546 GTGTCCTATACCTCCTGCTGCGG + Intronic
1183741779 22:39672842-39672864 AGGTCCTGACCCTTCTATTGTGG - Intronic
949929782 3:9069616-9069638 GTGTCCTAGCCCCTCACTTGAGG + Intronic
956051913 3:65257238-65257260 GTGTTCTCTCCCTTCTAGTAAGG - Intergenic
956495221 3:69818334-69818356 GTGTCCTGTTCATTCTCTTGAGG + Intronic
957799229 3:85053329-85053351 TTGTCCTATCCCTGCAGTTGGGG + Intronic
961173637 3:124816589-124816611 TTCTGCTATCCCTTCTCTTGTGG - Intronic
965081688 3:164041009-164041031 GTATCCTGACCCTTCAATTGCGG + Intergenic
978052797 4:104223191-104223213 ATGTCATATCCCTTCTCTTTTGG + Intergenic
981227236 4:142311791-142311813 CTGGCCTATCCCTTCAATTCTGG - Intronic
981674181 4:147322204-147322226 GTCTTCTTTCCCTTCTATTACGG - Intergenic
984576146 4:181450686-181450708 GTGTTCTATGCCTTCTACTGAGG - Intergenic
990125171 5:52508080-52508102 CTGTCCTCTCCTTTCTATGGTGG + Intergenic
995342087 5:111071403-111071425 GTGACCAATCCTTTCTATTTGGG - Intronic
999238042 5:150111536-150111558 CTTTCCTATCCTTTCTCTTGGGG + Intronic
1000043291 5:157501111-157501133 GTGTTCTATTCCTTCTCTTAGGG - Intronic
1007105619 6:39281145-39281167 TCGTTCTATCCCTTCTACTGGGG + Intergenic
1012807142 6:103908707-103908729 CTGCCCTATGCCTTCTACTGTGG + Intergenic
1015544545 6:134348021-134348043 GTGTTCTATGCGTTCTATTGAGG - Intergenic
1026790978 7:73331584-73331606 GTGTACTAACACTTCCATTGTGG + Intronic
1030919725 7:115367189-115367211 GTGTCCACCCCCATCTATTGTGG - Intergenic
1033369377 7:140695007-140695029 GGGGCCTATCCATTCCATTGTGG + Exonic
1055407395 9:75989062-75989084 GTTTCCCATCCCTTTTATTAAGG - Intronic
1187225483 X:17372385-17372407 GTTTCCTTTCCCTTCTATTTTGG + Intergenic
1187520609 X:20010552-20010574 TTGTCCTAACCCTGCTATTTAGG - Intronic
1191865490 X:65700362-65700384 ATGTCCTATGGTTTCTATTGGGG + Intronic
1195698873 X:107686921-107686943 GTGTCCTCTCCCTTCAATTTAGG - Intergenic
1197495954 X:127180297-127180319 GTGTCTTAGCCTTTCTATTTAGG - Intergenic
1201038824 Y:9808990-9809012 TAGTTCTATCACTTCTATTGGGG + Intergenic