ID: 1085032846

View in Genome Browser
Species Human (GRCh38)
Location 11:73283200-73283222
Sequence TCCTCACATTTTGTATCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 144}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085032844_1085032846 -6 Left 1085032844 11:73283183-73283205 CCTGTTCCAGGAGTGAATCCTCA 0: 1
1: 0
2: 0
3: 11
4: 120
Right 1085032846 11:73283200-73283222 TCCTCACATTTTGTATCCCCAGG 0: 1
1: 0
2: 0
3: 7
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085032846 Original CRISPR TCCTCACATTTTGTATCCCC AGG Intronic
901277158 1:8001235-8001257 TCTTCACACTTTCTATCCCTTGG + Intergenic
901944953 1:12694174-12694196 TCCTCAGATTTTGCAGCCTCTGG - Intergenic
902744274 1:18463098-18463120 TGCTCACATTTTGTTTCTCCTGG - Intergenic
909957903 1:81801640-81801662 TCCTCACATTTCGGATCTCCCGG - Intronic
910522796 1:88141820-88141842 TCCACACATGTTGTTTTCCCTGG - Intergenic
910905660 1:92175084-92175106 TCTTCATCTTTTGTATCCCTCGG - Intronic
913391881 1:118322907-118322929 TTGCCCCATTTTGTATCCCCAGG + Intergenic
915969770 1:160346163-160346185 TCTTCAGATTTTGTTTCCCATGG + Intronic
918790751 1:188824250-188824272 TCCTCAGCTTTTGAATCTCCTGG - Intergenic
920984034 1:210867097-210867119 TCCTCACATTTCCTAGCCCTAGG - Intronic
1063704784 10:8420324-8420346 TCCTCACATTTCGTACCCTAGGG - Intergenic
1069153595 10:64997566-64997588 TCCTTATATTTTGTTTCCTCTGG - Intergenic
1069426642 10:68294365-68294387 TCCTTACATTTTGTACCCTATGG - Intronic
1071238773 10:83680670-83680692 ACCTCAGAGTTTGTAACCCCAGG + Intergenic
1071952563 10:90721945-90721967 TCTTCACATTTTCTTTCACCAGG + Intergenic
1072043936 10:91635976-91635998 TGCTCAGACTTTGTAACCCCTGG - Intergenic
1079932904 11:26587175-26587197 GCCTCACATTTTGTCTACTCTGG - Intronic
1083029713 11:59581090-59581112 TCATCAGACTTTGTATCCCCAGG + Intronic
1085032846 11:73283200-73283222 TCCTCACATTTTGTATCCCCAGG + Intronic
1085051962 11:73384600-73384622 ACCCCATACTTTGTATCCCCAGG + Intronic
1085868272 11:80320368-80320390 TCTTCTCATTCTGTATCTCCAGG + Intergenic
1086393229 11:86387716-86387738 CCCTTTCATTTTTTATCCCCAGG - Intronic
1089124886 11:116169838-116169860 TCCTGAAATTTGGTATCCCATGG + Intergenic
1090977646 11:131690750-131690772 TCCTCCCATTTTGTTCCCCAAGG - Intronic
1093300937 12:17453781-17453803 TCCTCGCATTTTCTATCTCTAGG + Intergenic
1094102356 12:26777955-26777977 GCCTGACATTTTGGGTCCCCTGG - Intronic
1095716708 12:45354038-45354060 TCCCTACATTTTTTCTCCCCTGG - Intronic
1095753427 12:45735866-45735888 TGTTCTCATTTTGTATCCTCAGG - Intronic
1096349827 12:50888128-50888150 TGCTAAAATTTTGTATCCCATGG + Intergenic
1097355806 12:58600242-58600264 TCCTTTCTTTTTGTATCCTCTGG - Intronic
1099276837 12:80587013-80587035 TAGTCACCTTTTGTATCCACAGG - Intronic
1099588809 12:84558574-84558596 TCCTCTCCTTCTGTATCTCCAGG + Intergenic
1099721822 12:86371908-86371930 TCTTCACATTTTTTATTTCCAGG - Intronic
1101643870 12:106609752-106609774 TCTTTACATATTGTATCCACTGG + Intronic
1101666141 12:106817414-106817436 TCCCCCAATTTTTTATCCCCCGG - Intronic
1103223391 12:119265807-119265829 TCCCCACTTTTGGCATCCCCAGG - Intergenic
1104606969 12:130196955-130196977 TCCCCACATTCTGCATCCCAGGG - Intergenic
1106003546 13:25747628-25747650 TCCCCACGCATTGTATCCCCAGG - Intronic
1106358114 13:29003987-29004009 TCCTCACCCTTTCTTTCCCCTGG - Intronic
1107866338 13:44706930-44706952 TACTGATATTATGTATCCCCTGG - Intergenic
1109741860 13:66563990-66564012 TCATTACCCTTTGTATCCCCAGG + Intronic
1113058195 13:106291642-106291664 TCCTCTCATTGTGGCTCCCCTGG - Intergenic
1113673428 13:112190939-112190961 TCCTCACATTTTTTATTGTCAGG + Intergenic
1114181558 14:20372336-20372358 TTCTCAAATTTTGAAGCCCCAGG + Intronic
1115767304 14:36636559-36636581 TCCTCACATTTTGTACCTAGAGG + Intergenic
1116704333 14:48277493-48277515 CCCTCACATTGTGAATCCTCTGG - Intergenic
1117347297 14:54845679-54845701 TTCTCATATTTTGTAGCACCAGG - Intronic
1120041168 14:79754421-79754443 TCTCCAGATTTTGTATCCACAGG + Intronic
1120965567 14:90164727-90164749 TTCTGTCATTTTGTATCCCTGGG + Intronic
1126136532 15:45397569-45397591 ATCTCACCCTTTGTATCCCCTGG + Intronic
1129185159 15:73901654-73901676 TCCTCACCTTTTCTAGCCTCTGG + Intergenic
1130814274 15:87414512-87414534 TCCCCACAATTTGCCTCCCCTGG - Intergenic
1133609053 16:7416109-7416131 TGCTCCCATTTTGTATTCCATGG + Intronic
1134361276 16:13533262-13533284 TCCTCTCGTTTTGGTTCCCCAGG + Intergenic
1136207797 16:28737304-28737326 TCCGCAGCTTTTGTATCCCTGGG + Intergenic
1137830523 16:51539269-51539291 TCCTCAACTTTTGTCTCCTCTGG - Intergenic
1138896465 16:61211352-61211374 GCCTCTCATCTTGTATTCCCTGG - Intergenic
1146884536 17:36462353-36462375 TCCTCACATTGTGGGTCCCCTGG - Intergenic
1147504328 17:41000110-41000132 TCATCACATTTTGTCTTCACAGG + Intergenic
1150229896 17:63544134-63544156 TCCTCACACCCTGTGTCCCCAGG + Intronic
1151119014 17:71771529-71771551 ATCCCATATTTTGTATCCCCAGG - Intergenic
1152247233 17:79191406-79191428 CCCTCACATTCTGTTTCCCGAGG - Intronic
1154031176 18:10755794-10755816 TCCTCACTTCTTGTATTCACTGG - Intronic
1154450733 18:14473764-14473786 TCCTCCCATGTCGTAGCCCCGGG - Intergenic
1156822296 18:41387763-41387785 ACCTCACTTTTTGTATTGCCTGG - Intergenic
1160584588 18:79905283-79905305 TCCTCCCATTTTTTATTCTCTGG + Intronic
1160926912 19:1550833-1550855 CCCACACATTTTGTGTCCCTTGG - Intergenic
1164562549 19:29302618-29302640 TCCTCACATTCAGTTTCCACAGG + Intergenic
1164757294 19:30699757-30699779 TCCTCCCATTTTGCAGCCTCAGG + Intronic
1168443373 19:56391102-56391124 TCCTCTTATTTTGGATCCCGAGG + Intronic
925219092 2:2123306-2123328 TACTCACATACTTTATCCCCAGG - Intronic
925923176 2:8651712-8651734 TCTCCTCTTTTTGTATCCCCAGG - Intergenic
926752360 2:16208243-16208265 TCTTCCCATTTTGTCTCCCATGG - Intergenic
928855144 2:35794294-35794316 TTCTCTCATTTTATATCCTCAGG + Intergenic
928859133 2:35834647-35834669 TCCCCACATTTTCTACCCCCAGG - Intergenic
933056295 2:77671522-77671544 TTCAGATATTTTGTATCCCCAGG - Intergenic
933816801 2:86075023-86075045 TACTCACAATTTTTGTCCCCTGG + Exonic
933927849 2:87115837-87115859 TTCAGATATTTTGTATCCCCAGG - Intergenic
937269824 2:120642139-120642161 TATTCACATTTTGGATTCCCTGG + Intergenic
941496578 2:166212165-166212187 TCCTCAATTTTGGTATCCCTTGG - Intronic
942262275 2:174180636-174180658 TCCTCAAGTTTTGTGTCCACAGG - Intronic
945822225 2:214678664-214678686 CCCTACCATTTTGTATCACCAGG - Intergenic
946439763 2:219685316-219685338 GCCTCACAGATTGAATCCCCAGG - Intergenic
948964843 2:241371019-241371041 TACTCACATTTTGCTTCTCCCGG + Intronic
1168752880 20:296210-296232 TCCTCTCACTTTATATCCTCAGG - Intergenic
1169314185 20:4574513-4574535 TCCTGACAGTTTGCATCCCAAGG + Intergenic
1175238605 20:57529533-57529555 TCGTGACATTTTGTACCCCCAGG - Intergenic
1176445499 21:6816810-6816832 TCCTCCCATGTTTTAGCCCCGGG + Intergenic
1176823667 21:13681843-13681865 TCCTCCCATGTTTTAGCCCCGGG + Intergenic
1179499044 21:41795368-41795390 TCCTAACATTTTGGATGCCAAGG - Intergenic
1181969047 22:26676312-26676334 CCCACACATTCGGTATCCCCTGG - Intergenic
953194571 3:40720441-40720463 TCCTCATATTTTGGAGCCACAGG - Intergenic
954496304 3:50967176-50967198 TGCCCACATTTTGTAGCCTCTGG + Intronic
956771999 3:72534767-72534789 CCCTCACATTTTCTTTCTCCAGG - Intergenic
960092805 3:113658810-113658832 TCCTCACATTTTGGTTTCTCAGG - Exonic
965138574 3:164806461-164806483 TTCTCACATTGAGTATGCCCTGG + Intergenic
965630698 3:170729680-170729702 TACTCACTTTTTGTAGCCACTGG - Intronic
968263694 3:197345461-197345483 TCCTCCCCTTTTTTCTCCCCAGG + Intergenic
968344560 3:197990637-197990659 TCGTCACACTGTGTATCTCCTGG + Exonic
973301032 4:48584546-48584568 TTCTCCCATATTGTATCTCCTGG - Intronic
973862986 4:55084118-55084140 TCCTCAAATTTTCTATGCCTTGG - Intronic
976656548 4:87494724-87494746 TCCTCACACTCTGTAGCCACAGG + Intronic
977751794 4:100618201-100618223 TCCTCACATATTCTTTCCTCTGG + Intronic
979765457 4:124460215-124460237 TTCTCACATTATGTTACCCCTGG + Intergenic
979784512 4:124698698-124698720 ACCTCACATCGTGTAGCCCCTGG - Intronic
985132283 4:186750724-186750746 CCCTCACATTTTCTATCAACTGG - Intergenic
987347997 5:16995865-16995887 TCCTCATATTTTGCATACCAAGG + Intergenic
988425539 5:31059045-31059067 TCCTCACCTGCTGAATCCCCTGG + Intergenic
988665199 5:33319624-33319646 TTCTCCCATTTTTTATCCTCTGG - Intergenic
988699217 5:33656547-33656569 TCCTCACTTTTTGTGTTCCAAGG - Intronic
992158588 5:73979089-73979111 TGCCCACATTTTCTATCTCCTGG + Intergenic
992443340 5:76813512-76813534 TCCTCAGTGTTTGTGTCCCCGGG - Intergenic
995956430 5:117782479-117782501 TCCACACAGATTGTATTCCCAGG - Intergenic
997050898 5:130378419-130378441 TCTTTACATTTTGTATCTGCAGG + Intergenic
1000105257 5:158053199-158053221 TGCTCACATCTTGTATGGCCTGG + Intergenic
1002058948 5:176615099-176615121 TCCTCACATGCACTATCCCCGGG + Intergenic
1002797577 6:487250-487272 TCCTCTCATTTTGTATTAACAGG + Intronic
1002878603 6:1232967-1232989 TCCTCTCCTTTCATATCCCCAGG - Intergenic
1004312823 6:14560756-14560778 TCACCACATTTTGAACCCCCTGG - Intergenic
1004464266 6:15869577-15869599 TCCTCAAATTTGGTATCTGCAGG + Intergenic
1008398739 6:51039212-51039234 GGCTGACATTTTGTATCCACAGG + Intergenic
1009903915 6:69844825-69844847 TCCCGATATTTTGTATTCCCAGG - Intergenic
1010023538 6:71189447-71189469 TCCTCTCTTTTTCTATCCTCTGG - Intergenic
1011775451 6:90725495-90725517 TCCTCATATTTTGAATAGCCAGG - Intergenic
1013406325 6:109847335-109847357 TTCCCACATTTAGTATCCTCAGG + Intergenic
1017027123 6:150191074-150191096 TCCTCACATGTTTTCTCCTCTGG + Intronic
1017064623 6:150517856-150517878 TCCTCACCTATGCTATCCCCTGG + Intergenic
1017093562 6:150783286-150783308 TACTCACATATTGGATCTCCTGG - Intronic
1019976158 7:4583097-4583119 TCCGCACTTTTTGTGTCCCTGGG + Intergenic
1019977092 7:4591601-4591623 TCCGCACTTTTTGTGTCCCTGGG + Intergenic
1023281596 7:38576320-38576342 TCCTCTTAGTTTATATCCCCAGG + Intronic
1024816869 7:53281852-53281874 TCCTCACTTTTTGTCTTCCAAGG + Intergenic
1025185844 7:56857680-56857702 TCCTTATTTTTTGTATCCACAGG - Intergenic
1025686082 7:63719261-63719283 TCCTTATTTTTTGTATCCACAGG + Intergenic
1030947714 7:115746071-115746093 TCCTCTCCTTTTCCATCCCCAGG + Intergenic
1031551705 7:123122077-123122099 TCCTCAGATTTTGTATGCTAGGG + Intronic
1032136840 7:129287147-129287169 GCCACACATCTTGTATCCTCTGG + Intronic
1035199666 7:157253932-157253954 TCCTTACGTTTTGTATTCCCAGG + Exonic
1037637899 8:20716997-20717019 TACTCCCATTTTCTACCCCCAGG + Intergenic
1042426257 8:68651736-68651758 TCCCCACTTTTGGAATCCCCAGG - Intronic
1044721779 8:95157644-95157666 TCCTGAAATTTTGTATCCTTTGG - Intergenic
1049855955 8:144862015-144862037 TCCTCACACATATTATCCCCCGG - Intergenic
1051838108 9:21363465-21363487 TCCTGACCTTTTCTCTCCCCAGG + Intergenic
1053004523 9:34595405-34595427 TCCTCAGAGTTGGTATCCTCAGG - Intergenic
1057169382 9:92951926-92951948 CCCTCAGATTTTGTCTGCCCTGG - Intronic
1059741206 9:117151736-117151758 TCCACACACTTTGGTTCCCCTGG + Intronic
1203523696 Un_GL000213v1:67715-67737 TCCTCCCATGTTTTAGCCCCGGG - Intergenic
1186807848 X:13157798-13157820 ACTTAACATTGTGTATCCCCTGG - Intergenic
1188248901 X:27867547-27867569 TCTTCCCATTTTGTATCACATGG + Intergenic
1194143324 X:90232598-90232620 TCCTGACAGTGTGTATCCCTGGG + Intergenic
1197038891 X:121910334-121910356 TCTTCAGACTGTGTATCCCCAGG - Intergenic
1199755063 X:150856054-150856076 TGCACACATTCTGTATGCCCTGG + Intronic