ID: 1085035888

View in Genome Browser
Species Human (GRCh38)
Location 11:73299800-73299822
Sequence CCCTGAGGCTCTCAAGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085035888_1085035892 -1 Left 1085035888 11:73299800-73299822 CCAGCAGCTTGAGAGCCTCAGGG No data
Right 1085035892 11:73299822-73299844 GCCACCAGGAAGCTGCTACATGG No data
1085035888_1085035896 10 Left 1085035888 11:73299800-73299822 CCAGCAGCTTGAGAGCCTCAGGG No data
Right 1085035896 11:73299833-73299855 GCTGCTACATGGAGGTCCCACGG No data
1085035888_1085035894 2 Left 1085035888 11:73299800-73299822 CCAGCAGCTTGAGAGCCTCAGGG No data
Right 1085035894 11:73299825-73299847 ACCAGGAAGCTGCTACATGGAGG No data
1085035888_1085035897 14 Left 1085035888 11:73299800-73299822 CCAGCAGCTTGAGAGCCTCAGGG No data
Right 1085035897 11:73299837-73299859 CTACATGGAGGTCCCACGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085035888 Original CRISPR CCCTGAGGCTCTCAAGCTGC TGG (reversed) Intergenic
No off target data available for this crispr