ID: 1085037112

View in Genome Browser
Species Human (GRCh38)
Location 11:73307513-73307535
Sequence GAGAAGAGCCGCCAGACTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085037110_1085037112 -6 Left 1085037110 11:73307496-73307518 CCAGGCGGAGAGTCCAGGAGAAG No data
Right 1085037112 11:73307513-73307535 GAGAAGAGCCGCCAGACTGCAGG No data
1085037103_1085037112 22 Left 1085037103 11:73307468-73307490 CCAGAGCAAGAAGAAAAGGCTCG No data
Right 1085037112 11:73307513-73307535 GAGAAGAGCCGCCAGACTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085037112 Original CRISPR GAGAAGAGCCGCCAGACTGC AGG Intergenic
No off target data available for this crispr