ID: 1085039138

View in Genome Browser
Species Human (GRCh38)
Location 11:73316872-73316894
Sequence GAGGCCAGTCAGAAGGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 382
Summary {0: 1, 1: 0, 2: 5, 3: 32, 4: 344}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085039136_1085039138 -8 Left 1085039136 11:73316857-73316879 CCAGGTGGAGGCTGTGAGGCCAG 0: 1
1: 1
2: 2
3: 52
4: 439
Right 1085039138 11:73316872-73316894 GAGGCCAGTCAGAAGGCTGCTGG 0: 1
1: 0
2: 5
3: 32
4: 344
1085039130_1085039138 15 Left 1085039130 11:73316834-73316856 CCATGTGGATAGATTGCAAGGGG 0: 1
1: 0
2: 1
3: 8
4: 100
Right 1085039138 11:73316872-73316894 GAGGCCAGTCAGAAGGCTGCTGG 0: 1
1: 0
2: 5
3: 32
4: 344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085039138 Original CRISPR GAGGCCAGTCAGAAGGCTGC TGG Intronic
900418059 1:2544044-2544066 GGGGACAGCCAGGAGGCTGCGGG - Intergenic
901295212 1:8156082-8156104 GCGGCCACTCCGAAGGCAGCAGG - Intergenic
901639342 1:10685611-10685633 GAGGCCACTCTGAGGGCTCCCGG - Intronic
901712444 1:11126309-11126331 GAGGCCAGGGAGGAGGCAGCTGG - Intronic
902719086 1:18292191-18292213 GAGGCCAGTCAGAAGAGCGGTGG - Intronic
903978263 1:27166338-27166360 GAGGAAAGCCAGAAGGTTGCGGG - Intronic
904398558 1:30240495-30240517 GAGGAGAGATAGAAGGCTGCAGG - Intergenic
904893326 1:33795461-33795483 GAGGGCAGTCAGCAGGGAGCAGG - Intronic
905325593 1:37149514-37149536 GAGGCCTGGTGGAAGGCTGCTGG + Intergenic
907524299 1:55045224-55045246 GAAGGCAAACAGAAGGCTGCAGG + Intronic
908303549 1:62786877-62786899 GAGGCCAGTTAGAAGATTGTTGG + Intronic
910216103 1:84846623-84846645 GAGGTCAGTGAGAAGTCTCCTGG + Intronic
910590089 1:88920892-88920914 GAAGCCAGTCAGAAGGCTCCAGG - Intergenic
910738314 1:90487113-90487135 GAAGCAAGTCACAAGGCTGGAGG + Intergenic
912440168 1:109691675-109691697 GAGTGCAGTGAGAGGGCTGCAGG + Intronic
912515897 1:110216391-110216413 GGGGCCAGGCTGAAGGCTGCAGG + Intronic
914442800 1:147722020-147722042 GAGGCCAGTCAGAGGTCTTATGG + Intergenic
916119975 1:161520680-161520702 GAGGCCAGTCAGGAGGCTATTGG - Intronic
916300541 1:163268785-163268807 TAGACCAGTCAGAAGGCAGAAGG - Intronic
917537302 1:175883696-175883718 GACCCCACTCAGAAGGCTGGGGG + Intergenic
919431924 1:197504597-197504619 TAGGCCTGTCAGAAAGATGCAGG + Intergenic
919618634 1:199839181-199839203 GGGGCCTGTCAGAGGGCTGAGGG + Intergenic
919730856 1:200912856-200912878 GAGGCCAGGGAGCAGGCTGGAGG + Intronic
920094545 1:203477598-203477620 GAGCCCAGACAGGTGGCTGCTGG - Intronic
920606709 1:207396065-207396087 GTGGCCTGTCAGAAGGCAGGTGG + Intergenic
921076202 1:211702088-211702110 GTTTCCAGTCAGAAGGCTGCAGG - Intergenic
922502525 1:226107943-226107965 GAGACCAGTCAGCAGGCTCTTGG - Intergenic
922986412 1:229869302-229869324 GTGGCCAGGCAGATGGCTGTAGG - Intergenic
924434208 1:244024350-244024372 GATGCCACCCAGATGGCTGCAGG - Intergenic
1062759887 10:10426-10448 GAGTCCAGTTAGAAGGGTGAGGG - Intergenic
1062768552 10:82871-82893 GAGGCCAGTCAGAGGCCTATGGG + Intergenic
1063985910 10:11501678-11501700 GAGACCAGTGAGAAGGTGGCAGG - Intronic
1065526548 10:26627547-26627569 AAGGTCAGTCAGGAGGCAGCGGG + Intergenic
1066350809 10:34635342-34635364 GATGCCAGGCATAAGGCTGAGGG + Intronic
1067471620 10:46542156-46542178 AAGGCCAGGCAGAAGGCTGCAGG + Intergenic
1070263061 10:74876536-74876558 TAAGCCAGTCAGAAGGTTTCTGG + Intronic
1070798168 10:79229264-79229286 GTGGCCAGGCAGATGGCTGGAGG + Intronic
1071564886 10:86666690-86666712 GAAGCCAGTCAGAGAGCAGCTGG - Intronic
1072628896 10:97132236-97132258 GGGGCCAGACTGAAGCCTGCAGG - Intronic
1072734461 10:97869541-97869563 GAAGCCAGACAGCAGGGTGCTGG - Exonic
1074899059 10:117801265-117801287 AGGGCCAGTCAGTGGGCTGCCGG - Intergenic
1075016753 10:118915334-118915356 GAGGTCAGGCAGAGAGCTGCCGG - Intergenic
1075266158 10:121000980-121001002 GGGGCCAGCCTGAAGGCTGTGGG - Intergenic
1075737521 10:124673176-124673198 GAGGCCAGGCAGGAGGCTATTGG - Intronic
1075894580 10:125983899-125983921 GAGGCCAGGCAGCAAGCAGCAGG + Intronic
1076563225 10:131381123-131381145 GAGGCCAGTGAGATGGAGGCTGG + Intergenic
1077141554 11:1027035-1027057 GGGGCCTGGCAGGAGGCTGCAGG + Exonic
1077251572 11:1563130-1563152 GAGGCCAGGCAGAAGGAGCCTGG + Intronic
1077909859 11:6564280-6564302 TAGGCCAGTGAGGAGGGTGCAGG - Intronic
1077938726 11:6817830-6817852 GAGGCATGGCAGAAGGCTGCAGG + Intergenic
1078180355 11:9005222-9005244 GAGGCCAGACAGAAGGTATCAGG - Intergenic
1079019624 11:16898763-16898785 GAGGCCAGTTAGGAGGGTGTTGG - Intronic
1081278051 11:41175193-41175215 GAGGCCAGTTTCAAGGCTGCTGG - Intronic
1081505456 11:43711927-43711949 GAGTCCATTCAGATGGCTGCAGG - Intronic
1083683440 11:64361765-64361787 GAGGGCGGCCAGAGGGCTGCAGG + Intronic
1083769335 11:64857659-64857681 GAGGCCAGTCAGAGGGCATGTGG - Intronic
1084634146 11:70379181-70379203 GAGGCCAGTGAGCAGACTGGAGG + Intronic
1085039138 11:73316872-73316894 GAGGCCAGTCAGAAGGCTGCTGG + Intronic
1085749629 11:79150086-79150108 GAGGCGAGTCAGAGGGATCCTGG - Intronic
1085775801 11:79365510-79365532 AAGGCTGGTCAGAAGGCAGCAGG - Intronic
1086949699 11:92879369-92879391 GAAGCCAGTCAGAGGGCCTCAGG + Intronic
1087150408 11:94854700-94854722 GAGGCCAGCCTGAAGGTTGTCGG + Intronic
1088814110 11:113409983-113410005 CAGGGCCGTCAGAAGGCAGCAGG + Exonic
1089308032 11:117538911-117538933 GTGGCCAGTCAGGAGGCTGCTGG - Intronic
1089342952 11:117772054-117772076 GAGGCCAGACATAGGCCTGCCGG - Intronic
1090084566 11:123640083-123640105 GAGAGCAGTCCGAAGGCTCCAGG + Intronic
1091665332 12:2414817-2414839 GAGGGCAGTCAGGTGTCTGCCGG + Intronic
1091842127 12:3628743-3628765 GAGGCCTTTCTGAAGGTTGCGGG - Intronic
1092096678 12:5848591-5848613 AAAGCCAGTGAGAAGACTGCTGG - Intronic
1092376119 12:7956678-7956700 GAGACCAGTTAGGAGGCTACTGG + Intergenic
1092542839 12:9430685-9430707 GCGGCCACTCGGCAGGCTGCGGG - Intergenic
1094231942 12:28115683-28115705 AATTCCAGTCTGAAGGCTGCTGG + Intergenic
1096590430 12:52655377-52655399 GAGGCGAGTCAGCAGGAGGCTGG + Intergenic
1097104290 12:56611979-56612001 GAGACCACTGAGAAGACTGCTGG + Exonic
1097608720 12:61789530-61789552 GGGGCCTGTCAGGAGGCTGGGGG + Intronic
1099225674 12:79966290-79966312 GGAGCAAGTCAGAAGGCTCCAGG - Intergenic
1102076689 12:110065649-110065671 GGGACCAGTGAGAAGGTTGCTGG - Intronic
1102587127 12:113931350-113931372 GAGGCCATGCTGAGGGCTGCTGG - Intronic
1102789112 12:115629480-115629502 AAGGCTAGTTAGGAGGCTGCCGG + Intergenic
1104680862 12:130750608-130750630 GGGCCCATTCAGAAGGCTGGGGG + Intergenic
1104963983 12:132500905-132500927 GAGGACAGCCAGAGGCCTGCTGG - Intronic
1105348209 13:19592885-19592907 GAAGCCTGACAGAGGGCTGCTGG + Intergenic
1106227905 13:27798835-27798857 TAGGGCAGTCAGAGGCCTGCTGG + Intergenic
1106419315 13:29572409-29572431 GAGGCCACCCAGGAGGATGCTGG + Intronic
1107480602 13:40782734-40782756 GAAGCCTGACAGAGGGCTGCTGG + Intergenic
1108200192 13:48035500-48035522 GAGTCCATTCAGATGGCTGGGGG + Intergenic
1108444304 13:50491903-50491925 GAGTCCATTCATAAGGATGCTGG + Intronic
1108623574 13:52206631-52206653 GAAGCCTGACAGAGGGCTGCTGG + Intergenic
1108663146 13:52604412-52604434 GAAGCCTGACAGAGGGCTGCTGG - Intergenic
1111445203 13:88338767-88338789 GAGGCCTGTCAGAGGGCAGGAGG - Intergenic
1112938778 13:104834316-104834338 GAGTTCAGTCAGATGGCTGTGGG + Intergenic
1114186255 14:20404631-20404653 GGATCCAGTCAGAAGGCAGCTGG + Exonic
1114521889 14:23344690-23344712 GAGTCCATTCAGATGGTTGCAGG - Intergenic
1115529147 14:34310797-34310819 GAGGCCATTGAAAAGACTGCTGG - Intronic
1118203711 14:63701788-63701810 AAGACCAGTTAGAAGGCTGTTGG + Intronic
1119538064 14:75419232-75419254 GAGGGCGGTCAGAAGGCCTCTGG - Intergenic
1119640363 14:76310191-76310213 GGGGCCATGCAGAAGGCTCCTGG - Intergenic
1121270368 14:92633528-92633550 CCGGCCAGTCAGAAGCCGGCTGG + Intronic
1121314773 14:92954361-92954383 GAGGCAAGTGAGAAGGCATCAGG + Intronic
1122420755 14:101575640-101575662 GAGCCCAGGCAGGAGGCTGTAGG + Intergenic
1202929388 14_KI270725v1_random:25352-25374 GAGGCAAGCCAGTGGGCTGCAGG - Intergenic
1123415700 15:20093470-20093492 GAGGACAGACAGAAGTCTGCAGG + Intergenic
1123525039 15:21100584-21100606 GAGGACAGACAGAAGTCTGCAGG + Intergenic
1124353432 15:28977454-28977476 GAGGCCAGGAACAAGGCTGGGGG - Intronic
1124821967 15:33054975-33054997 GAGTCCATTCAGATGGTTGCAGG - Intronic
1124879445 15:33627791-33627813 GAGGCCAGTTATAAGGCTCTTGG + Intronic
1126351118 15:47745651-47745673 GAGCCTAGACAAAAGGCTGCAGG + Intronic
1127946993 15:63765362-63765384 GAGTCCATTCAGATGGTTGCTGG - Intronic
1129274208 15:74434522-74434544 GAGGCAGCCCAGAAGGCTGCTGG - Intergenic
1129665630 15:77578002-77578024 GAGGAGGGTGAGAAGGCTGCAGG + Intergenic
1129741189 15:77990395-77990417 GAGGCCAGACAGCTGCCTGCAGG - Intronic
1129888795 15:79057367-79057389 GAGTCAAGTCAGGAGGCTGTGGG + Intronic
1130760190 15:86811330-86811352 GAGAACAGTCAGAAGGCTACTGG + Intronic
1131031336 15:89188343-89188365 GGTGCCAGGCAGGAGGCTGCAGG + Intronic
1132311296 15:100859886-100859908 GATGCCACTCACATGGCTGCTGG - Intergenic
1132513038 16:353368-353390 GAGGGCAGTCAGGGGGCTGCAGG + Intergenic
1132879400 16:2155243-2155265 GAGGGCCGTCCGAACGCTGCAGG - Intergenic
1132977288 16:2717067-2717089 GAGGCCAGGGAGAAGCCTGTGGG - Intronic
1133089715 16:3394704-3394726 GAGGCCGGGCAGAATGATGCTGG - Intronic
1133147275 16:3798123-3798145 CAGCCCAGGCAGAAGGATGCAGG + Intronic
1135525881 16:23213207-23213229 GAAGCAAGTGAGAAGGCTGGGGG - Intronic
1136040063 16:27571664-27571686 GAGGCCAGTGAGATGCCAGCAGG - Intronic
1136059286 16:27714023-27714045 GAGGGCAGGCCCAAGGCTGCTGG - Intronic
1136085484 16:27881926-27881948 GAGGCCAACCAGGAGGCTGCAGG - Intronic
1136297876 16:29313955-29313977 GTGGCCCTTCAGAAGGCTGCGGG - Intergenic
1137935794 16:52634210-52634232 GAGGCCATTCAGAAGGCCCAAGG - Intergenic
1138500651 16:57441226-57441248 GAGGCAAGTAAGAAGGTTGGAGG + Intronic
1138672826 16:58629486-58629508 GAGGCCAGCGAGAAGGCTCCAGG - Intronic
1139247113 16:65455826-65455848 GAGTTCTGTCAGAAGGCTGAAGG - Intergenic
1139476045 16:67203044-67203066 GAGGGCAGGCAGAGGGCGGCTGG + Intronic
1139546348 16:67651629-67651651 GTGGCCAGACACCAGGCTGCTGG - Intronic
1139737692 16:69006098-69006120 GATGCCAGTCAGAAAGCAGTGGG + Intronic
1139751708 16:69112923-69112945 GAGACCAGTAATAAGGCTGCTGG - Intronic
1140894256 16:79311157-79311179 GAGCCCAGAGAGAGGGCTGCGGG - Intergenic
1141093131 16:81144056-81144078 GAGCCCAGTCAGGAGGGTGAGGG - Intergenic
1141126539 16:81404585-81404607 GAGGACAGTTAGGAGACTGCTGG - Intergenic
1141177041 16:81727807-81727829 GGGTCCATTCAGAAGGTTGCAGG - Intergenic
1141334725 16:83143941-83143963 GAGACGAGACAGAAGGCTGGTGG + Intronic
1141886563 16:86896267-86896289 GAGGCCAGGTAGAGGGCTGGGGG + Intergenic
1142534208 17:602574-602596 TGGGCCAGTGGGAAGGCTGCAGG + Intronic
1142755648 17:2015070-2015092 AAGGCAAGACAGGAGGCTGCTGG + Intronic
1144461290 17:15460641-15460663 GAGGCCAGTTTGGAGGCTGTGGG - Intronic
1145900828 17:28489481-28489503 GAAGTCAGCTAGAAGGCTGCGGG + Intronic
1146943856 17:36861208-36861230 GAGGCCAATCAGGAGGCTGGTGG + Intergenic
1147478467 17:40736529-40736551 GAGGCCATTCAGAGGGCCTCTGG + Intergenic
1147871187 17:43588766-43588788 GAGGACAGTCAGAAGAGAGCAGG - Intergenic
1148749499 17:49936395-49936417 GAGGGCAGTGAGGAGGCTGGGGG - Intergenic
1148806532 17:50266753-50266775 GAGGCCAGGCCCAAGGCTGGGGG + Intergenic
1148844080 17:50518493-50518515 GAGGGCAGTAAGAAGGCTCTGGG - Intronic
1150008726 17:61486169-61486191 GAGCCCAGGCAGAGGGCTGGGGG + Intergenic
1150143623 17:62750375-62750397 GAGGACAGTCAGGAGGTTCCTGG + Intronic
1150302221 17:64056074-64056096 GAGACCAGTGAGAAGGCACCTGG + Intronic
1150581667 17:66479843-66479865 GAGGCCTGTCAGAAGGTGGAGGG + Intronic
1151487523 17:74410589-74410611 TAGGCCTGGGAGAAGGCTGCAGG + Intergenic
1152369710 17:79878693-79878715 GAGGGCAGGCAGAGGGCTGTGGG - Intergenic
1152529278 17:80907572-80907594 GAGGCCAGGGAGGAGGCTGATGG - Intronic
1152952758 18:10622-10644 GAGTCCAGTTAGAAGGGTGAGGG - Intergenic
1152961441 18:82705-82727 GAGGCCAGTCAGAGGCCTATGGG + Intergenic
1156103823 18:33632764-33632786 CAGACCAGTTAGAAGCCTGCGGG - Intronic
1156389304 18:36635664-36635686 GGGGCCAGTCAGTAAGCTCCTGG + Intronic
1157325429 18:46665408-46665430 GAGGCCATTTAGGAGGCTGCTGG - Intergenic
1158215642 18:55097876-55097898 GAGCCCAGGCAGAAGGGTGGTGG - Intergenic
1158422983 18:57312677-57312699 GAGGCCTCTCAGAATGCAGCTGG + Intergenic
1158746827 18:60209701-60209723 GAGGCACTTCAGAAAGCTGCAGG - Intergenic
1159831549 18:73284073-73284095 GAGGCAAGAGAGAAGCCTGCAGG - Intergenic
1159973218 18:74678485-74678507 GAGGACAGCCAGCAGGCTGATGG - Intronic
1160612140 18:80096759-80096781 GAGGCCAGCCCGTAGGCTGGGGG + Exonic
1160846670 19:1169057-1169079 GAGGTCAATCACAAGGCTCCGGG + Intronic
1161459511 19:4388545-4388567 GAGGCCAGGGAGAGAGCTGCAGG + Intronic
1161585152 19:5101864-5101886 GAGCCCAGGCAGGAGGCTGGAGG - Intronic
1162176938 19:8837637-8837659 GAGGCCAGTGTGAAGGGTGAGGG - Intronic
1162359014 19:10206409-10206431 ACGGTCAGTCAGAAGGCTGAAGG + Intronic
1162378441 19:10318250-10318272 GAGGCCAGCCTGCAGGCCGCTGG + Exonic
1164158726 19:22612481-22612503 CAGGCTGGTCAGAGGGCTGCAGG - Intergenic
1164597478 19:29539743-29539765 GAGGCTAGTGAGAAGAATGCAGG + Intronic
1165306447 19:35005574-35005596 GAGACCAGGGAGGAGGCTGCTGG + Intronic
1165309271 19:35020852-35020874 GAGGCCAGGGAGGAGGCTGCTGG + Intronic
1165390776 19:35537477-35537499 GAGGCCAGTGAGAAGCCCGGAGG + Intronic
1165490288 19:36119469-36119491 GAGGCCAGGGAGGAAGCTGCCGG - Intronic
1165789770 19:38484333-38484355 GAGGCATGTCAGAAGCCTCCTGG - Intronic
1166066166 19:40360316-40360338 GAGCCCAGGGAGGAGGCTGCTGG - Intronic
1166082361 19:40452036-40452058 GAGACCAGGGAGTAGGCTGCTGG - Intronic
1166105667 19:40597033-40597055 GCGGCCAATCAGGAGGCAGCAGG - Intronic
1166919995 19:46222743-46222765 GAGACCAGGCAGGAGGCTGATGG - Intergenic
1167571724 19:50292861-50292883 GAAGGCAGTCAGAAGGCAGGAGG + Intronic
1168102353 19:54148040-54148062 GAGGCCAGAGAGGAGGCTGCTGG + Intronic
1168641352 19:58033930-58033952 GAGGCCAATCAGAAGCCGCCTGG - Intergenic
1168649034 19:58081246-58081268 GAGGCATGTCACAAGGATGCAGG + Intronic
925036275 2:688877-688899 GCTGCCTGTCAGAAGGCTGAAGG - Intergenic
926271001 2:11365798-11365820 TAGGCCAGTCTGAGGGCTGAGGG - Intergenic
926541521 2:14185831-14185853 GAGGCCAGGCAGAAAGCAGGTGG - Intergenic
926723849 2:15982548-15982570 GAGGACAGGCAGAAGGATCCAGG + Intergenic
927746212 2:25623882-25623904 GAGTCCACTCAGATGGTTGCAGG - Intronic
927842938 2:26456910-26456932 GGGGCCAGTCTGAAGGCTTAAGG - Intergenic
929997860 2:46840303-46840325 GAGGCCAGGTAGGAGGCTGTTGG - Intronic
929999962 2:46854637-46854659 GATGCCAGTCAGAAGGGGTCAGG - Intronic
931260320 2:60612421-60612443 GAGACCAGTTAGGAGGCTGTGGG + Intergenic
932415970 2:71574150-71574172 GAGGCCGGTGGGAAGGCTGGGGG - Intronic
933014837 2:77112144-77112166 GAGGTTAGTCAGAAGGCTCCTGG - Intronic
933666595 2:84970432-84970454 GAGGGAAGCCAGGAGGCTGCCGG - Intergenic
933833035 2:86225778-86225800 GACACCAGCCAGCAGGCTGCAGG + Intronic
933839582 2:86275690-86275712 CAGGCCAGTCAGGAGGCTGACGG - Intronic
933976772 2:87518417-87518439 GATAACAGACAGAAGGCTGCTGG - Intergenic
934572835 2:95383280-95383302 GAGGCCTGTCAGAAGGTAGGTGG + Exonic
934918095 2:98317335-98317357 AAGGCCACTCAGATGGCTGGGGG - Intergenic
936317043 2:111432387-111432409 GATAACAGACAGAAGGCTGCTGG + Intergenic
937328792 2:121009049-121009071 GAGACTAGTGAGAAGGCTGCTGG - Intergenic
938105364 2:128526358-128526380 GAGGCCAGTCAGGTGGCTGAAGG - Intergenic
938263972 2:129913263-129913285 GAGGCCAGTCACAGGACAGCAGG + Intergenic
939291039 2:140195107-140195129 GAATCTAGTTAGAAGGCTGCAGG + Intergenic
940205504 2:151197510-151197532 GAGGCCAGCCAGAAGAATGAAGG + Intergenic
941448131 2:165626939-165626961 GAGGCCAGCAACAAGGCTACAGG - Intronic
942574499 2:177349160-177349182 AAGACCAGTCAGAAGGCTACTGG + Intronic
943561698 2:189471649-189471671 GAAGACAGTCAGAAGGCTCTTGG - Intronic
943573545 2:189602989-189603011 TTGGCCAGTAAGAAGTCTGCTGG + Intergenic
946146167 2:217732795-217732817 GAGGCATGACAGAAGGCTGAAGG + Intronic
946475263 2:220000806-220000828 AAGGCCAGTGAGAAAGATGCGGG + Intergenic
947868649 2:233419647-233419669 CTGGCCAGACAGAAAGCTGCAGG + Intronic
948424642 2:237879266-237879288 GAGGCCTGGCAGAAGACAGCAGG + Intronic
948677581 2:239607835-239607857 GAGGACAGGGAGAAGGTTGCTGG + Intergenic
948896513 2:240930292-240930314 GGGGCCAGGCACCAGGCTGCAGG + Intronic
1169226080 20:3857838-3857860 GAGGCCAGGGAGCAGGCTGGGGG - Intronic
1170314694 20:15030139-15030161 GTGGTCAGTCAGAAATCTGCTGG - Intronic
1171755500 20:29104318-29104340 GAAGCCAGTCAGCAGGCAGATGG - Intergenic
1173119918 20:40279249-40279271 GAGGCCAATCAGAAATCTACAGG - Intergenic
1173838342 20:46140082-46140104 CAGCCCACTCAGAAGGCTGCAGG + Intergenic
1174768230 20:53273660-53273682 GAGGCCAGCAAGGAGGCTGTTGG + Intronic
1175207825 20:57325469-57325491 GAGGGCGATCTGAAGGCTGCAGG + Intergenic
1175395193 20:58652665-58652687 AAGGCCACACAGAGGGCTGCGGG - Intronic
1175578835 20:60083001-60083023 GAGGACAGTCAGGAGGCAGGTGG + Intergenic
1175957116 20:62617056-62617078 GAGGCCAGTGGGAAGGCCCCGGG + Intergenic
1178239397 21:30881525-30881547 GATGTCAGACAGAGGGCTGCAGG + Exonic
1179914231 21:44466310-44466332 GAGCCCTGTCACGAGGCTGCAGG - Intergenic
1180256713 21:46635038-46635060 GAGTCCAGTCAGACGGCTGCGGG + Intergenic
1181293806 22:21818929-21818951 GAGGGGAGGCTGAAGGCTGCAGG + Intronic
1181341059 22:22180367-22180389 GAGGCCAATCAGAGGGCACCTGG - Intergenic
1181460428 22:23083017-23083039 GAGACCAGGCAGGAGGCTCCAGG + Intronic
1181492474 22:23269158-23269180 TGGGCCATTCAGAAGGCTGGTGG + Intronic
1181666877 22:24404647-24404669 GAGGGCAGTCAGAGGCCGGCTGG - Intronic
1182544386 22:31066009-31066031 GAGGACAGACAGAAGTCTGCAGG - Intronic
1183333904 22:37235899-37235921 GAGGCCAGGCAGGGGGCTGAGGG + Intronic
1183786018 22:40029683-40029705 GAGGCCAGGACGGAGGCTGCAGG - Exonic
1185146507 22:49139921-49139943 CAGGCCAGTGTGAGGGCTGCAGG - Intergenic
952227369 3:31392145-31392167 GGGCACAGTCAGCAGGCTGCTGG - Intergenic
952311725 3:32196708-32196730 GAGGACAGTCAGAATGGTGTGGG + Intergenic
953584078 3:44184352-44184374 GAGGCCGTTCACAAAGCTGCTGG + Intergenic
953903142 3:46854562-46854584 GAGGCCAGTGAGGAGGGTCCAGG - Intergenic
954082546 3:48221130-48221152 GAAGCCAGTCAGAAGGGTGGAGG + Intergenic
954304901 3:49720470-49720492 AAGGGCAGTCAGAAGGCTTGGGG - Exonic
954652435 3:52173353-52173375 GAGGCAAAACAGAAGGATGCAGG + Intergenic
955400778 3:58589964-58589986 GGGCCAAGTCAGAAGGCTTCAGG + Intronic
955576533 3:60370762-60370784 GAGACCAGTTTGAAGGCTGTGGG - Intronic
955793947 3:62615896-62615918 GACACCACTCAGAAGGTTGCAGG - Intronic
956065790 3:65395923-65395945 GAGGCCAGTCAGGAAGCCCCAGG + Intronic
956086943 3:65621558-65621580 AAGGTCAGTCCGAAGGCCGCTGG + Intronic
956136064 3:66100284-66100306 GAGGCCTGTCAGGGGGCTGTGGG - Intergenic
956326614 3:68059931-68059953 GAGGCCAGGAACAAGCCTGCGGG - Intronic
956582561 3:70830712-70830734 GAGACCAGTTAGAAGGCTGGTGG - Intergenic
956724410 3:72145396-72145418 GGGGCCAGTCAGAACTCTACAGG + Intergenic
961200016 3:125038216-125038238 GAGGCTAGACAAATGGCTGCAGG + Intronic
961641045 3:128365030-128365052 GAGTCCTGGGAGAAGGCTGCAGG - Intronic
962324780 3:134423878-134423900 GAGGCCACCCAGAATGCTTCTGG + Intergenic
963002078 3:140691327-140691349 GAGGCCAAAGAGAGGGCTGCTGG + Intronic
963253556 3:143122043-143122065 GCAGCCAGTCAGGGGGCTGCAGG - Exonic
967833229 3:193940256-193940278 GAGGTGAGTCCGAAGGATGCAGG + Intergenic
967884502 3:194323914-194323936 ATGGGCAGGCAGAAGGCTGCAGG + Intergenic
967920217 3:194608957-194608979 GATGACAGCCAGGAGGCTGCTGG + Intronic
968938075 4:3624051-3624073 GAGGGGAGTGGGAAGGCTGCGGG - Intergenic
969371563 4:6734507-6734529 GAGGCAAGGCAGAGGGCGGCTGG - Intergenic
969596005 4:8149608-8149630 GGGGGCAGGCAGAAGGCGGCAGG + Intronic
969856184 4:10001688-10001710 GTGGCCATTCTGAAGGCTGCTGG - Intronic
970330529 4:14978575-14978597 GAATCCAGTCAGAAGGCTGTCGG - Intergenic
971270329 4:25138051-25138073 GGGGCCTGTCAGAGGGGTGCAGG + Intronic
971425073 4:26507929-26507951 GAGGACAGACAGATGGTTGCAGG - Intergenic
973729012 4:53805166-53805188 AAGTCCAGCCAGAGGGCTGCTGG - Intronic
975627453 4:76363898-76363920 GAGACCAGTGAGAAGGCAACTGG + Intronic
975633142 4:76421473-76421495 GAGACCAGTTAGGAGGCTGTGGG - Intronic
977610550 4:99025643-99025665 GAGTCCATTCAGATGGTTGCTGG - Intronic
978301468 4:107273007-107273029 GAGGCCAGTTAGGAGGCTTATGG - Intronic
978392017 4:108236848-108236870 GAGGCCAGAAAGAAGCCTACTGG + Intergenic
978518104 4:109591087-109591109 AAGGCATGTCAGAAGGCTTCAGG - Intronic
978763914 4:112384802-112384824 GAATCCAGTGAGAAGGCTGTAGG + Intronic
984041752 4:174743968-174743990 CAGGCAAGCCAGAGGGCTGCCGG + Intronic
985031352 4:185793935-185793957 CAGGCCAGGCAGGAGCCTGCGGG - Intronic
986024690 5:3839641-3839663 GAGGCAAGACAGAAGACAGCAGG - Intergenic
987768546 5:22268969-22268991 GAGTCCAGTCAGGATGCTTCAGG - Intronic
989445985 5:41529033-41529055 GAGTCCATTCAGATGGTTGCAGG - Intergenic
992099994 5:73397828-73397850 GTGGACAGTTTGAAGGCTGCAGG - Intergenic
995011377 5:107260201-107260223 ATGGCCAGGCAGAAGTCTGCTGG - Intergenic
995215604 5:109591228-109591250 GAGGCCAGTATGTAGACTGCTGG + Intergenic
995478957 5:112576378-112576400 AAGGCAAGCCAGGAGGCTGCTGG + Intergenic
997405107 5:133639570-133639592 GAGTCAAGTCAGAAGGTTCCAGG + Intergenic
997529083 5:134571129-134571151 GAGGCCAGACAGATGTCCGCAGG - Intronic
997770286 5:136547435-136547457 CAGGCCTGTCAGAATGCTACAGG - Intergenic
998267518 5:140677281-140677303 GAGGGCAGTGGGACGGCTGCTGG + Intronic
998586229 5:143430642-143430664 GAGGACAGTGAGAAGACAGCGGG + Intronic
1001131018 5:169063494-169063516 GAGGCGGGTCAGAAAGCAGCAGG - Intronic
1001209313 5:169795416-169795438 GAGGCTCGCCAGAGGGCTGCAGG + Intronic
1002569682 5:180133095-180133117 GAGGCCAGTGCCAAGGCTGAAGG - Intronic
1002703072 5:181140962-181140984 GAGCCCAGTAAGGAGGCAGCTGG - Intergenic
1002838442 6:885206-885228 GAGCTCAGTGAGAAGGGTGCTGG - Intergenic
1003184722 6:3820924-3820946 GGAGCCAGCCAGAAGACTGCCGG + Intergenic
1003204094 6:3991352-3991374 GAGTCCATTCAGATGGCTGACGG - Intergenic
1003424589 6:5989594-5989616 GAGGCCAGCCAGGAGGAAGCTGG + Intergenic
1005113692 6:22313667-22313689 GTGCCCAGGCAGAAGCCTGCTGG - Intergenic
1005331859 6:24758370-24758392 GAGGCCATTCAGATGGTTGGGGG + Intergenic
1005648827 6:27867441-27867463 AAGGCAACTAAGAAGGCTGCCGG - Exonic
1006286284 6:33096945-33096967 GAGTCCATCCTGAAGGCTGCAGG + Intergenic
1006869677 6:37240058-37240080 GAGGCGAGACAGAAAACTGCTGG + Intronic
1007119939 6:39371362-39371384 GAGCCCAGACAGAAGGCAGAGGG - Intronic
1007228337 6:40330269-40330291 GAGGACAGTGAGAAGGCTGCTGG - Intergenic
1009337719 6:62513660-62513682 GGGGCCAGTCACAGGGCAGCGGG - Intergenic
1012436433 6:99219905-99219927 GAGGCCAGTCAGTGGGTAGCAGG - Intergenic
1012503355 6:99915490-99915512 GAGGCCTGTCAGCAGGTTGAGGG - Intergenic
1017769595 6:157634875-157634897 CAGGCCAGACACAAGGCAGCTGG - Intronic
1017859138 6:158379052-158379074 GAGACCAGTTAGGAGGCTGCTGG + Intronic
1017920143 6:158864723-158864745 AAAGCCAGTCAGCAGGCTCCAGG + Intergenic
1018205083 6:161429609-161429631 GAGGCCACGGAGATGGCTGCTGG + Intronic
1019211886 6:170413311-170413333 GAGGCAAGACAGAAGGATTCTGG - Intergenic
1019767294 7:2861060-2861082 CAGGCCAGTCTGTAGTCTGCAGG - Intergenic
1019843064 7:3468663-3468685 GAGGCCAGGAAGAATCCTGCTGG + Intronic
1020343094 7:7133837-7133859 GGGCCCAGTCAGATGGCAGCAGG + Intergenic
1022294209 7:29034570-29034592 GGGGCCTGTCAGGAGGGTGCAGG - Intronic
1022494637 7:30845116-30845138 GAGGCCAGGAGGAAGGCTGAGGG + Intronic
1023744007 7:43304992-43305014 GAGGCCAGAGAGGAAGCTGCGGG + Intronic
1024973824 7:55094984-55095006 GAGCCCTGACATAAGGCTGCCGG - Intronic
1025302185 7:57826691-57826713 GAGACAAGCCAGAGGGCTGCAGG + Intergenic
1026437742 7:70414533-70414555 GAGGCCTGTCAGATGAATGCAGG - Intronic
1028096586 7:86768652-86768674 GAGGCCAATCAGAAAACTGTGGG + Intronic
1029055033 7:97732758-97732780 GAGCCCAGGAAGAAGGGTGCGGG - Intronic
1029239077 7:99145699-99145721 TAGGACAGGCACAAGGCTGCAGG - Intergenic
1031102766 7:117502685-117502707 GAGGCCAGTCTGAATACAGCAGG - Intronic
1033419286 7:141192249-141192271 GAGGACAGGCAGAGGGCTCCAGG + Intronic
1034412735 7:150949785-150949807 GGGGCCAGGCATGAGGCTGCAGG + Intronic
1034927040 7:155130852-155130874 GCGGCCAGCCAGAAGGATGAGGG - Intergenic
1035255893 7:157627130-157627152 GAGGCCACTGAGAAGGCTCCAGG - Intronic
1035395593 7:158532912-158532934 GAGGCCAGTCAGGAGGGAGCAGG - Intronic
1037648428 8:20815115-20815137 GAGGCTAGTTGGAAGCCTGCGGG - Intergenic
1038803691 8:30771730-30771752 GAGGTCTGTCATGAGGCTGCAGG - Intergenic
1039006967 8:33050370-33050392 GAGGGCAATCAGGAAGCTGCAGG - Intergenic
1040549519 8:48427682-48427704 AATGCCATTCAGAAGGCTGTGGG + Intergenic
1041084169 8:54241888-54241910 GGGGCCATTCTGAAGGGTGCTGG + Intergenic
1041609913 8:59833516-59833538 GAGGGCAGTTGGAAGGCTACTGG + Intergenic
1042274238 8:66986443-66986465 TAGGGCAGTCAGAAGGTTTCTGG - Intronic
1042353573 8:67802040-67802062 GAGACCAGTCAGGAGGTTACTGG + Intergenic
1043453502 8:80391968-80391990 GAAGCCAGTTAGGAGACTGCAGG + Intergenic
1045673341 8:104581276-104581298 GGGGCCTGTCAGAAGGTGGCGGG + Intronic
1046726535 8:117680879-117680901 GGGGCCTGTCAGAAGGATGTGGG - Intergenic
1046827611 8:118708756-118708778 CAGGCCACTCAGAAGTCTGAGGG + Intergenic
1047957053 8:129984206-129984228 GACAACAGTCAGAGGGCTGCAGG + Intronic
1048317914 8:133375563-133375585 GAGGGCAGTGGGAAGGCTGAAGG + Intergenic
1048444460 8:134482894-134482916 GAGGCCCAACAGGAGGCTGCAGG - Intronic
1048462255 8:134630998-134631020 GATGCCAGCCACAAGGCAGCTGG + Intronic
1049130407 8:140835007-140835029 GTGGCCATCCAGAATGCTGCAGG + Intronic
1049199050 8:141331048-141331070 GCAGCCAGGCAGGAGGCTGCGGG + Intergenic
1054302042 9:63387581-63387603 GAGGCAAGCCAGTGGGCTGCAGG - Intergenic
1056335909 9:85568639-85568661 AAGACCAGTCAGAAGGTTACTGG + Intronic
1057304455 9:93904207-93904229 GAGGCCAGTGACCAGGGTGCAGG - Intergenic
1057593612 9:96395310-96395332 GAGGCCGGCCAGGAGGCTGTCGG - Intronic
1061176652 9:129001734-129001756 GAGGCCAGCCCGAAGGCAGGAGG + Intronic
1062103393 9:134739795-134739817 GAGGTCAGGCAGCAGGATGCAGG + Intronic
1062439763 9:136564457-136564479 GGGGCAAGGCAGGAGGCTGCGGG - Intergenic
1062671076 9:137709720-137709742 GCAGCCAGTCAGACAGCTGCAGG - Intronic
1062736713 9:138141413-138141435 GAGGCCAGTCAGAGGCCTATGGG - Intergenic
1186301517 X:8204749-8204771 GGGGCCAGTCAGGAGGCAGAGGG + Intergenic
1186626273 X:11297004-11297026 GTGGCCAGGCGGGAGGCTGCTGG - Intronic
1187435799 X:19267914-19267936 AAGGTCAGTCAGAAGGCTCAGGG + Intergenic
1189148965 X:38685043-38685065 GAGGCCAGACAGGAGGGTGAGGG - Intronic
1189294139 X:39907117-39907139 GTGGCCCATCAGAAGGCTGGGGG - Intergenic
1190560265 X:51679837-51679859 GACGACAGTCAGAAGGGGGCTGG - Intergenic
1190564026 X:51713484-51713506 GACGACAGTCAGAAGGGGGCTGG + Intergenic
1190604703 X:52128644-52128666 GAGTCCATTCAGATGGTTGCAGG - Intergenic
1191054614 X:56229141-56229163 GAGCCCAGTCTGAGGGCTGGAGG - Intergenic
1192173610 X:68872323-68872345 GAGACCAGCCGGCAGGCTGCAGG + Intergenic
1192634397 X:72804131-72804153 GAGAACAGTCGGAAGACTGCTGG - Intronic
1192647313 X:72916670-72916692 GAGAACAGTCGGAAGACTGCTGG + Intronic
1193283933 X:79689330-79689352 GAGTCCATTCAGATGGTTGCAGG + Intergenic
1194279830 X:91936123-91936145 GAGCCCATTCAGATGGTTGCAGG + Intronic
1196038160 X:111170051-111170073 GAGTCCAGTTAGGAGGCTGTTGG + Intronic
1199979325 X:152912249-152912271 GACTCCAGTCAGAAGACTCCGGG - Intergenic
1200233999 X:154459582-154459604 GAGGCCAGACAGCGGGCTCCTGG + Intronic
1200597307 Y:5159603-5159625 GAGCCCATTCAGATGGTTGCAGG + Intronic