ID: 1085043055

View in Genome Browser
Species Human (GRCh38)
Location 11:73338138-73338160
Sequence TAGGAAACAGGACCTGACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 173}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085043050_1085043055 1 Left 1085043050 11:73338114-73338136 CCTCTTTCCAGAAGAGAGGGTCT 0: 1
1: 0
2: 3
3: 25
4: 201
Right 1085043055 11:73338138-73338160 TAGGAAACAGGACCTGACCAGGG 0: 1
1: 0
2: 0
3: 13
4: 173
1085043047_1085043055 13 Left 1085043047 11:73338102-73338124 CCTTGAGAGGCTCCTCTTTCCAG 0: 1
1: 1
2: 3
3: 21
4: 247
Right 1085043055 11:73338138-73338160 TAGGAAACAGGACCTGACCAGGG 0: 1
1: 0
2: 0
3: 13
4: 173
1085043052_1085043055 -6 Left 1085043052 11:73338121-73338143 CCAGAAGAGAGGGTCTCTAGGAA 0: 1
1: 0
2: 0
3: 14
4: 144
Right 1085043055 11:73338138-73338160 TAGGAAACAGGACCTGACCAGGG 0: 1
1: 0
2: 0
3: 13
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085043055 Original CRISPR TAGGAAACAGGACCTGACCA GGG Intronic
901917543 1:12511444-12511466 GAGGAAACAGGCCCTGCCCCTGG + Exonic
902133337 1:14282637-14282659 AAGGAAACAGGAGCTCAGCATGG + Intergenic
903930310 1:26858137-26858159 GAAGAAACAGGAGCTGCCCAAGG + Intergenic
905241015 1:36581541-36581563 CAGGAAACAGGACTTGCTCAGGG + Intergenic
907142768 1:52203822-52203844 TAGGAGACAGGACATGACTGAGG - Intronic
907338245 1:53714841-53714863 TGGGAAGCAGGACCTTGCCAGGG - Intronic
913681456 1:121189686-121189708 TATGAAACATCATCTGACCAGGG + Intronic
914033287 1:143977323-143977345 TATGAAACATCATCTGACCAGGG + Intergenic
914156159 1:145090644-145090666 TATGAAACATCATCTGACCAGGG - Intronic
915100307 1:153494598-153494620 TAGCAAGCAGGACCTGCCTAGGG - Intergenic
916368767 1:164064902-164064924 TGGGAAACAGGAAATGACCCGGG + Intergenic
916374297 1:164135263-164135285 GAGGAAACAGGACTAGAGCAGGG + Intergenic
917143998 1:171868269-171868291 TAGGACCCAGGGCTTGACCAAGG - Intronic
917696000 1:177524695-177524717 TAGGAAACAAGAAGTGACTATGG + Intergenic
920468770 1:206208204-206208226 TATGAAACATCATCTGACCAGGG + Intronic
924419556 1:243895660-243895682 GAGGCAACAAGACCTGACCCGGG - Intergenic
1063822102 10:9847740-9847762 TGTGTAACAAGACCTGACCAAGG + Intergenic
1065158134 10:22892187-22892209 TTGGAAAAAGGACATCACCAAGG - Intergenic
1065294019 10:24257900-24257922 TAGGAGGCAGGACCTGACTCAGG - Intronic
1067261446 10:44696554-44696576 AAGGAAACAGAGCATGACCAGGG - Intergenic
1067680622 10:48435982-48436004 TAGGAAACAGGAAAGGTCCAAGG - Exonic
1071314997 10:84387099-84387121 TATGAAAAAGGCCCTGAACATGG - Intronic
1071353605 10:84770853-84770875 TAGGAAATAGGATTTGAGCAAGG + Intergenic
1071708575 10:88026308-88026330 GAAGAAACAGGAGTTGACCAGGG - Intergenic
1072820752 10:98554793-98554815 GAGGAAACATGACCTACCCAAGG - Intronic
1074332364 10:112528048-112528070 TCAGAAACAAGACCTGAACATGG + Intronic
1074347022 10:112696642-112696664 AAGAAAACAGAATCTGACCAAGG - Intronic
1074636624 10:115326063-115326085 TATGAAACAGTACCTTGCCAGGG + Intronic
1075898820 10:126021523-126021545 TAGGAAAAAGCCCCTGAACAAGG + Intronic
1078737733 11:14036006-14036028 TTGGAAATAGGAATTGACCAGGG + Intronic
1079046393 11:17107757-17107779 GAGGAAACAGAAGTTGACCAAGG + Intronic
1083270565 11:61570124-61570146 GAGGAAACAGTGCCTGTCCAAGG + Intronic
1085043055 11:73338138-73338160 TAGGAAACAGGACCTGACCAGGG + Intronic
1087033325 11:93728678-93728700 CAGGAAACAGAAACTGGCCATGG + Exonic
1087269503 11:96097293-96097315 AAGGGAACAAGACCTAACCAGGG + Intronic
1089317963 11:117605050-117605072 TGGGAGACAGAACCAGACCAGGG - Intronic
1091894470 12:4089789-4089811 TAGGACACATGGCCTGACAAAGG + Intergenic
1093800177 12:23363226-23363248 TAGGATACAGGGCCTGAGCAGGG + Intergenic
1094186391 12:27647315-27647337 TAAGAAAAAGAACCTGGCCAGGG - Intronic
1094389939 12:29938431-29938453 GAAGAAACAGGACTTGAGCATGG + Intergenic
1099961826 12:89404182-89404204 TAGGAAACAGCTGCTGACCTAGG - Intergenic
1104247238 12:127055661-127055683 TAGGAAACAGCACCAGGCCTGGG + Intergenic
1107816884 13:44252423-44252445 TAGGAAACATGGCCTGGCAATGG - Intergenic
1109204147 13:59463008-59463030 AAGGAAACAAGAGCTGGCCATGG - Intergenic
1110871959 13:80462856-80462878 AAGGAAACAGGACTGGATCAAGG + Intergenic
1114714280 14:24807974-24807996 TAGAAAACACAACATGACCAAGG + Intergenic
1116551524 14:46245943-46245965 TAGGAAACAGCAAATGCCCATGG - Intergenic
1117028933 14:51650741-51650763 AAGGAAACAGGACCTGAGAAAGG - Intronic
1117436490 14:55719510-55719532 GAGGTAACAGGAGCTGGCCAGGG - Intergenic
1117492028 14:56257950-56257972 AACAAAACAGTACCTGACCAAGG - Intronic
1119804014 14:77470510-77470532 GAGGTAACAGTACCTGAACAGGG + Intergenic
1120696788 14:87653879-87653901 GAGGGAACAGGACCAGTCCAAGG + Intergenic
1121031982 14:90666067-90666089 GAGGAGACAGGACCTCCCCAGGG + Intronic
1121533968 14:94678304-94678326 TAGGAATCTGGACTTGACCCTGG + Intergenic
1123105577 14:105839679-105839701 TAGGCAGCAGGCCCTGAGCAGGG + Intergenic
1124251866 15:28112214-28112236 TAAGAAACAGCACCTCACTATGG + Intronic
1124848563 15:33314066-33314088 TAGGGAACAAGACCTAAACAAGG + Intronic
1127875215 15:63106149-63106171 CAGGAACCAGATCCTGACCATGG - Intergenic
1128104222 15:65031126-65031148 TAGGAAAAAGGACTGGTCCAGGG - Intergenic
1128408990 15:67374238-67374260 TAGGAAATCTGACCTCACCAAGG - Intronic
1130612272 15:85372220-85372242 AAGGAAGCAGGCCCTCACCAAGG - Intergenic
1130860959 15:87889148-87889170 TAGGAAAAATGACTTGCCCAGGG - Intronic
1131302212 15:91209720-91209742 TAGGTAACAGGAGCTGAGAAAGG - Intronic
1131824209 15:96304682-96304704 TAAAAAAGAGGTCCTGACCATGG - Intergenic
1137466588 16:48715334-48715356 TAGGAAACAGGGCCTGCCCTTGG + Intergenic
1137766898 16:50984893-50984915 TAGGAAACAGGACCTGCGTAAGG + Intergenic
1137808382 16:51329351-51329373 TAGGTTACAGGACCTCACAAAGG - Intergenic
1138307736 16:55993490-55993512 TAGGAATCAGGATCTGAGCAGGG + Intergenic
1139599216 16:67976546-67976568 TAGGAAACAGGCCCTGAGAGTGG + Intronic
1146299190 17:31674937-31674959 TAGGAAACAGGACTTCACAGAGG - Intergenic
1147959239 17:44156043-44156065 GAGGCAACAGGACTTGCCCAAGG - Intronic
1148813538 17:50310531-50310553 TAGGAAACAATACCTGAGTAAGG - Intergenic
1149661320 17:58335449-58335471 AAGGACACAGGACCTGTCCTTGG + Intergenic
1150363280 17:64557724-64557746 TAGAAAACAAGATATGACCAAGG + Intronic
1151258068 17:72894928-72894950 TAAGCAGCAGGAACTGACCAGGG + Intronic
1151757774 17:76084365-76084387 CAGGAGACAGGCCCAGACCAAGG - Intronic
1153473116 18:5468521-5468543 TAGGGGACAGGAGCTGCCCATGG + Intronic
1155516312 18:26626790-26626812 TAAGAAACAAGACCTATCCATGG + Intronic
1156309730 18:35910833-35910855 CAGGTAACAGAACCTGACCATGG - Intergenic
1156898897 18:42277778-42277800 GAGGCAAGAGGACTTGACCAGGG + Intergenic
1158163863 18:54517232-54517254 TAGGAAGCAGTACCTGAATAAGG - Intergenic
1159955547 18:74516108-74516130 TATGAAACAGGGCCTGGCCCAGG - Intronic
1163194425 19:15705135-15705157 TTGCAAAAAGGACATGACCAAGG + Intergenic
1164763507 19:30745596-30745618 CAGGAAACAGGCCCTGAGAAGGG + Intergenic
1166742123 19:45120972-45120994 GATGAGAAAGGACCTGACCAAGG - Intronic
1168681454 19:58318918-58318940 TAGGAAACAGGCCCAGAGCTGGG + Intergenic
932054136 2:68427666-68427688 AAAGAAACAAGACCAGACCAGGG - Intergenic
932695959 2:73956735-73956757 AAGTAAAGAGGACCCGACCAGGG + Intronic
932813800 2:74845473-74845495 TAGGCAGCAGCACCTGTCCAGGG - Intronic
934676002 2:96250062-96250084 TGGGAGACAGGACCTGCCAAAGG - Exonic
935460970 2:103333850-103333872 TAGGAAACAGGACTTGCCTTTGG - Intergenic
936093369 2:109514869-109514891 TGGGAAGCACCACCTGACCAGGG - Intergenic
936960517 2:118069041-118069063 AAGGCAAAAGGACCTAACCAGGG - Intergenic
937247295 2:120501933-120501955 GAGGAAGAAGGACCTGCCCAGGG + Intergenic
937284197 2:120739585-120739607 TAGGAAACAGGCTCTGGCCCAGG - Intronic
940480240 2:154219754-154219776 CAGGGAATAGGACCTAACCATGG - Intronic
943365877 2:186967131-186967153 TAGGCGACAGGGCCAGACCATGG + Intergenic
943478892 2:188393998-188394020 TTGCAAAAAGGACATGACCAAGG - Intronic
947237621 2:227959394-227959416 CAGGAAACAGCACCTGCCAAAGG - Intergenic
948383952 2:237570099-237570121 TGGGAAACAGGATTTGGCCATGG - Intergenic
1169570293 20:6898808-6898830 TGGGAAGCAGCACCTGCCCAGGG - Intergenic
1171126743 20:22609023-22609045 TGGGCCACAGCACCTGACCAAGG + Intergenic
1173226028 20:41162932-41162954 CAGGAAACAGAACCTGGTCAGGG - Intronic
1178566490 21:33690913-33690935 GTGGAAACAGGACTTGCCCATGG - Intronic
1179438343 21:41377127-41377149 CAGGAAACAGGAGCCAACCAAGG + Exonic
1179498588 21:41791339-41791361 TGGGAATCTGGACCTGTCCAAGG - Intergenic
1181896264 22:26110593-26110615 GAAGAGAAAGGACCTGACCAAGG + Intergenic
1182897849 22:33873607-33873629 TGGGAAACAGCCACTGACCAGGG + Intronic
955027209 3:55180407-55180429 AAGGAGACGGGACCTGACCCCGG + Intergenic
955027765 3:55187062-55187084 TAGGCAACATGACATGATCAAGG - Intergenic
956423338 3:69107928-69107950 GAGGACACAGGATCTGACCCGGG + Exonic
958070951 3:88610504-88610526 GAGGAACCAGGACATGACCAGGG + Intergenic
959142627 3:102505046-102505068 AAGGAAACTGGAGATGACCAAGG + Intergenic
959611944 3:108305179-108305201 TAGAAAACAGAACCTGAGCAAGG + Intronic
960914676 3:122683145-122683167 TAGGAAACTGAAACTGACTAGGG - Intronic
961372644 3:126440852-126440874 AAGGAAACAGGACCAGGCCTGGG - Intronic
964658535 3:159094759-159094781 TGGGAAATAGGACTTGACCTTGG + Intronic
968085629 3:195872747-195872769 CAGGCAACATGACCTGTCCACGG + Intronic
968647393 4:1747556-1747578 AAGGAAACAGGAGCTGTCCTGGG + Intergenic
972898435 4:43653453-43653475 TAAGAAATAGGACATTACCAAGG + Intergenic
973742579 4:53932783-53932805 TAGGAGACAGGCACTGAGCAAGG + Intronic
973774475 4:54231681-54231703 TCCGAAGCAGGGCCTGACCAGGG - Intronic
982402541 4:154984163-154984185 TTGGAAGCAGGAACTGACTAGGG + Intergenic
985949060 5:3209500-3209522 TAGGATAAAGGACTTGTCCAGGG - Intergenic
987073503 5:14359612-14359634 GAGGACACAGGACCTCAGCAGGG - Intronic
988731114 5:33973959-33973981 GAGGAACCAGGAGCTGAACAGGG + Intronic
989288780 5:39736823-39736845 TAGGAGACTAGACATGACCAGGG - Intergenic
992193418 5:74316355-74316377 TGTGTAACAGGACCTCACCATGG - Intergenic
994803845 5:104417341-104417363 TAGGATACAGGAACTGGCAAAGG + Intergenic
995046026 5:107649042-107649064 GAGGAAACACGACTTGACCAAGG + Intronic
997830948 5:137149267-137149289 TAGGCAACAGGAGCTGAGAATGG + Intronic
997862170 5:137427963-137427985 ATGGAAACAGGACTTGGCCAGGG - Intronic
1003343013 6:5239891-5239913 TAGGGAACAGTACCTGGCCATGG + Intronic
1005665206 6:28045857-28045879 TAGTAAACAGTACCTAAACAAGG - Intergenic
1006387553 6:33739763-33739785 TAGGAAACAGAACAGGCCCAGGG - Intronic
1006837478 6:37007690-37007712 GAGGAAACAGAAGCTGGCCAGGG + Intronic
1007765583 6:44157959-44157981 TCTGAAACAGGAGCTGACCTTGG - Intergenic
1011217273 6:85018344-85018366 CAGGAAACAGGACCTGAATGAGG - Intergenic
1011543985 6:88464843-88464865 GAGGAAGCATGACCTGACCAAGG - Intergenic
1011976952 6:93313802-93313824 TAAGAAATAGGACCAGACTAAGG + Intronic
1012827215 6:104162057-104162079 AAGGAAACAGGAACTGAAGAGGG + Intergenic
1014464756 6:121742089-121742111 TAAGACACAGGCCCTGACCAAGG - Intergenic
1014859505 6:126447760-126447782 GAGGGAGCAGGATCTGACCAAGG - Intergenic
1015841277 6:137479848-137479870 TTGGAAACAAGAGCTCACCATGG + Intergenic
1016031899 6:139346375-139346397 TTGGAAAAAGGACATCACCAAGG + Intergenic
1019339859 7:503838-503860 TCAGAAACAGGACCTGGCCTGGG + Intronic
1021446415 7:20738286-20738308 TGTGGCACAGGACCTGACCATGG - Intronic
1022454620 7:30547475-30547497 TGGGAAACAAGACCTGTCCATGG - Intronic
1023768478 7:43533456-43533478 TGGGAAACAGGACATTACAATGG + Intronic
1023921994 7:44637007-44637029 GAGGAACAAGCACCTGACCAGGG - Intronic
1024483707 7:49892565-49892587 CAAGAAACAGAACATGACCAGGG - Intronic
1024497532 7:50065461-50065483 TAGGAAAAACAACCTGCCCAAGG - Intronic
1024701885 7:51912299-51912321 TAAGAAACGGGACTTGAACAAGG - Intergenic
1025634820 7:63313133-63313155 TATGCAACAGGACCTGACACTGG - Intergenic
1025647875 7:63435037-63435059 TATGCAACAGGACCTGACACTGG + Intergenic
1026632362 7:72048457-72048479 TAGGACACAGGACCTGGGAAGGG + Intronic
1027171390 7:75875362-75875384 GAGGAAGCAGGACCTCACCCTGG - Intronic
1027434320 7:78148578-78148600 TAGGAGACAGGAGGTGAGCAGGG + Intronic
1028163640 7:87513320-87513342 TAGGAAACAGAAACTGCCCTAGG - Intronic
1029308437 7:99639275-99639297 CAGGAAACAGGTCCAGTCCATGG - Intergenic
1030253487 7:107478849-107478871 TAGAAAACAGGACCTTAGTAGGG + Intronic
1030524407 7:110636132-110636154 CAGGAAGCAGGCCCTCACCAGGG + Intergenic
1032548469 7:132762727-132762749 CAGGAAAGATGACCAGACCACGG - Intergenic
1033894023 7:146050317-146050339 TAGGAAACATTTACTGACCACGG + Intergenic
1037182813 8:16027699-16027721 TGGCAATCAGTACCTGACCATGG + Intergenic
1037437566 8:18879430-18879452 GAGGCGAAAGGACCTGACCAAGG + Intronic
1041939067 8:63366861-63366883 TAGGAAATAGGATATGCCCATGG + Intergenic
1042025800 8:64422435-64422457 AAAGAAACAGGACATGAGCAGGG - Intergenic
1043112603 8:76206373-76206395 TAGGAAAATGGAGCTGTCCAAGG + Intergenic
1043373515 8:79621161-79621183 CAGGAAAATTGACCTGACCAAGG - Intronic
1043803153 8:84637376-84637398 TAGGAAACGTCACCTGACCTTGG - Intronic
1046435603 8:114183964-114183986 TATGAAACAGTAACTGACAATGG + Intergenic
1049796300 8:144498711-144498733 CAGTTGACAGGACCTGACCAGGG + Intronic
1050138697 9:2495306-2495328 AAAGGAACATGACCTGACCAAGG - Intergenic
1051344273 9:16138546-16138568 TAGGAAACAGGGCATGTGCATGG - Intergenic
1051730216 9:20134006-20134028 AAGAAAACAGGAGCAGACCATGG + Intergenic
1054301010 9:63379963-63379985 TTGGAAACAGGACGTGCACAAGG - Intergenic
1055031708 9:71776784-71776806 TAGGAAACTTGAGCTCACCATGG + Intronic
1058372652 9:104287739-104287761 CAAGAAACAGGACATCACCAGGG - Intergenic
1060219636 9:121757538-121757560 TGGGAAACAGGCCCAGACAAGGG - Intronic
1061435832 9:130561290-130561312 AAGGAAACAGGCCTTGACAAGGG - Intergenic
1062354441 9:136154954-136154976 TAGGAGCCAGGGCCTGGCCATGG - Intergenic
1185862930 X:3595824-3595846 TAAGAAGCAGAACCTGACCCAGG + Intergenic
1191631105 X:63323020-63323042 TTGTAAACTGGACCTTACCATGG + Intergenic
1192850563 X:74951693-74951715 TAGGAAAGAGAGCCTGACAATGG + Intergenic
1196066842 X:111473193-111473215 TATCAAACAGCAACTGACCAAGG - Intergenic
1198668465 X:139051344-139051366 TAGGATACACAACCTGATCAAGG - Intronic