ID: 1085043823

View in Genome Browser
Species Human (GRCh38)
Location 11:73342269-73342291
Sequence GACACAGGACAAGCTGGATC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 170}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085043818_1085043823 -2 Left 1085043818 11:73342248-73342270 CCAAGATGGTCCCAGGTATAGGA 0: 1
1: 0
2: 0
3: 10
4: 99
Right 1085043823 11:73342269-73342291 GACACAGGACAAGCTGGATCCGG 0: 1
1: 0
2: 0
3: 13
4: 170
1085043816_1085043823 1 Left 1085043816 11:73342245-73342267 CCTCCAAGATGGTCCCAGGTATA 0: 1
1: 0
2: 0
3: 11
4: 97
Right 1085043823 11:73342269-73342291 GACACAGGACAAGCTGGATCCGG 0: 1
1: 0
2: 0
3: 13
4: 170
1085043815_1085043823 2 Left 1085043815 11:73342244-73342266 CCCTCCAAGATGGTCCCAGGTAT 0: 1
1: 0
2: 0
3: 5
4: 112
Right 1085043823 11:73342269-73342291 GACACAGGACAAGCTGGATCCGG 0: 1
1: 0
2: 0
3: 13
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085043823 Original CRISPR GACACAGGACAAGCTGGATC CGG Intronic
900581247 1:3410774-3410796 GATTCAGGGCAAGCTGGCTCAGG - Intronic
902708453 1:18222484-18222506 CAAACAGGACATCCTGGATCAGG - Intronic
902855348 1:19199655-19199677 GACACAGCACAAGCCTCATCTGG + Exonic
902982579 1:20136364-20136386 GACACAAGTCATGCTGGATTAGG - Intergenic
905179778 1:36158251-36158273 GTCACATGAGAACCTGGATCAGG + Intronic
907257233 1:53188986-53189008 GACAAAGGCAAAGATGGATCAGG - Intergenic
913159345 1:116131393-116131415 GACACAGGTCAAGATGAGTCTGG + Intronic
914970867 1:152307197-152307219 GGCCCAGGACAAGCAGGAACTGG - Exonic
924692445 1:246364074-246364096 GATGCAGGACAAGCTGGAAAAGG + Intronic
1063430777 10:5986205-5986227 GACAGAGGGCAAGGTGGGTCTGG - Intergenic
1069134513 10:64747012-64747034 GGCATAGGTCAAGCTGAATCTGG - Intergenic
1069500545 10:68949225-68949247 GAAACAGGACGAGCTGGAAATGG + Intergenic
1070452664 10:76577711-76577733 GACACAGGAAAAACTGGAGCAGG - Intergenic
1070838682 10:79468301-79468323 ACCTCAGGACAAGCTGGATTAGG - Intergenic
1072809019 10:98445472-98445494 GAGAAAGGACAAGCTGGAGAAGG + Intronic
1072911284 10:99503729-99503751 GTCTCAGAACAAGCTGCATCAGG + Intergenic
1073515788 10:104074525-104074547 GACACAGGACAAGCCGGTGGAGG - Intronic
1073682305 10:105717683-105717705 GCCAAAGGACAAGCAGGAGCAGG - Intergenic
1076064532 10:127439069-127439091 GTCCCAGGACAAGCTGGACAAGG + Exonic
1076794042 10:132790260-132790282 GCCACAGGACATGCTGGATGTGG + Intergenic
1078331569 11:10426381-10426403 CACAGAGGACAAGCTGAAGCAGG - Intronic
1082067868 11:47915533-47915555 GACACAGGACAGGATGGAAAGGG - Intergenic
1082921359 11:58498134-58498156 GAAACAGGACAAGCAGGGGCAGG + Intergenic
1084569157 11:69949215-69949237 GACACAGGGCAAGGAGGATGTGG + Intergenic
1084897487 11:72284353-72284375 GACACAGGACAAGGGGAATATGG - Intergenic
1085043823 11:73342269-73342291 GACACAGGACAAGCTGGATCCGG + Intronic
1086300407 11:85421244-85421266 CACAAAGGACAAGCTGAAGCAGG - Intronic
1087239268 11:95757181-95757203 CACACTGGACATGCTGGATGAGG - Intergenic
1088848833 11:113689520-113689542 GACACAGGAAATGGTAGATCTGG + Intronic
1089600509 11:119611635-119611657 GAGACAGGACAGGCTAGATGGGG - Intergenic
1093763680 12:22938595-22938617 GCCACAGGTCAAGCTGCACCTGG - Intergenic
1096091529 12:48904939-48904961 CACACAGGACAAGCTGGCCAAGG + Exonic
1097705806 12:62867022-62867044 GCCACAGGAAAGGCTGGAACTGG - Intronic
1103704419 12:122863544-122863566 GAAACAGGACAGGGTGGGTCAGG + Intergenic
1103864918 12:124044070-124044092 GACACAGGAAGAGCTGCATAGGG - Intronic
1104555946 12:129799974-129799996 GTCACAGGACATGCTGCCTCAGG + Intronic
1107989822 13:45810008-45810030 GACTCAGGACTAGCTCGACCAGG - Intronic
1111850216 13:93563604-93563626 GAGACAGGACCAACTGGAACTGG + Intronic
1113383962 13:109830352-109830374 GTCACAGGAAAAGCAGCATCCGG + Intergenic
1116130943 14:40855181-40855203 GACACAGGACAGGCTTGCTGGGG + Intergenic
1118624615 14:67646499-67646521 AACACAGGACACACTTGATCTGG - Intronic
1122389342 14:101369695-101369717 GGCACAGGACATGCTGCATTGGG + Intergenic
1122659303 14:103283956-103283978 GTCACAGGACAAGGTGGATGCGG + Intergenic
1125410879 15:39404982-39405004 GACAAATGACGAGCTGGAGCTGG + Intergenic
1125844903 15:42843203-42843225 CACACAGGCCAAGCTGGCTATGG + Intronic
1127919441 15:63481651-63481673 TGCACAGGACCATCTGGATCAGG + Intergenic
1128092448 15:64928146-64928168 GACACAGGTAGAGCTGGATTTGG + Intronic
1128879054 15:71226434-71226456 GAAACAGGACAGCCTGGATCAGG + Intronic
1130573501 15:85070047-85070069 GAGACAGGGCAAGCTGGTTCGGG - Intronic
1131450161 15:92532766-92532788 GGGACAGGACAAGCTGGAAAGGG - Intergenic
1131893742 15:97003454-97003476 GACCCAGTAAGAGCTGGATCTGG + Intergenic
1132982339 16:2744924-2744946 GGCACAGGCCAAGCTGTGTCAGG - Intergenic
1133412579 16:5580552-5580574 GAAGCAGGACCAGCTGGAGCTGG - Intergenic
1136653680 16:31695800-31695822 GCCACATGACAAGCTGGAGTGGG - Intergenic
1136672300 16:31869603-31869625 GCCACATGACAAGCTGGAGGGGG - Intergenic
1138299753 16:55916117-55916139 GCCACAGGACCAGTTGGGTCAGG + Intronic
1139622939 16:68162000-68162022 TACACAGTACATGCTAGATCTGG - Intronic
1141608988 16:85170685-85170707 GAAGCAGGAGAAGCTGGCTCAGG + Intergenic
1143771962 17:9174647-9174669 GACACCGGTCATGTTGGATCAGG + Intronic
1144198186 17:12915924-12915946 GACGGAGGACAAGCTGGCTCAGG + Exonic
1144855377 17:18264530-18264552 GACGCAGGACCACCTGGGTCAGG - Exonic
1146968142 17:37050290-37050312 GGCACAGCAGAAGCTAGATCGGG - Intronic
1147034849 17:37672237-37672259 GTCAGAGGAAGAGCTGGATCTGG + Intergenic
1148443450 17:47723967-47723989 GACAAAGTACAAGCTAGATTTGG + Intergenic
1148856059 17:50579881-50579903 GGCACAGGTCAAGCCGGGTCTGG + Intronic
1148888911 17:50793669-50793691 GCCACAGGACAAGGGGGAGCAGG + Intergenic
1150289633 17:63973839-63973861 GTCCCAGCACAAGCTGGATTGGG + Intergenic
1151969970 17:77452610-77452632 GAGACAGCACCTGCTGGATCAGG + Intronic
1152143161 17:78550502-78550524 GACACTGGTCATGCTGGATGAGG - Intronic
1153499458 18:5733162-5733184 GTTACAAGACAAGCTGGAGCTGG + Intergenic
1155957022 18:31962802-31962824 GGCACAGGACAAGATGGCCCAGG + Intergenic
1158698254 18:59722191-59722213 GAAACACCACAAGCTGGATGCGG + Intergenic
1161866205 19:6833793-6833815 GACCCAGGACATCCTGGAACTGG + Intronic
1165755246 19:38289071-38289093 GACACAGGCCTAGCTGGGTCTGG - Intronic
1166510708 19:43407080-43407102 GCCACAGGACATGGTGGCTCAGG - Intronic
925901164 2:8510479-8510501 GACACAGGTCATATTGGATCAGG - Intergenic
929608441 2:43251674-43251696 GACATGAGACAAGCTGGCTCAGG - Intronic
933837579 2:86258274-86258296 AACAGATGACAAGCTGGATTTGG - Intronic
936175047 2:110212360-110212382 GACGCAGAAGAAGCTGGACCTGG - Intergenic
937064600 2:119008105-119008127 GCCACAGGACCAGCTGGATTTGG + Intergenic
937071952 2:119070925-119070947 GACACAGGACTAGCTGGAAGAGG - Intergenic
938825653 2:135003028-135003050 GACACAAATCCAGCTGGATCGGG - Intronic
941489871 2:166129990-166130012 GACTCAGGACCAGGTGGACCAGG + Intergenic
942515029 2:176742975-176742997 GACACAGGAGAGGCTGAATGAGG - Intergenic
945628096 2:212236579-212236601 GGCACAGGACCAGATGGATTCGG - Intronic
947467013 2:230360220-230360242 AAAACAGGACAAACTGGATTTGG + Intronic
1170869839 20:20195511-20195533 GACACAGGACAGGCTGGCCCAGG + Intronic
1171479711 20:25444786-25444808 GACACAGGACAAGCAATACCTGG + Intronic
1172068752 20:32240593-32240615 GACACTGCACAAGCTGGTTTAGG + Intergenic
1172125857 20:32624826-32624848 GAGACAGGCCAAGCTGGAACAGG - Intergenic
1175586100 20:60141134-60141156 CACACAGGGCAAGGTGGAGCAGG + Intergenic
1176932411 21:14829293-14829315 GACACAGGACAACTTGGTTAGGG + Intergenic
1178692289 21:34760203-34760225 GGCACCGGACAACCTGGGTCAGG - Intergenic
1180942333 22:19667449-19667471 GACACACAACAGGCTGGATGTGG + Intergenic
1183991018 22:41597107-41597129 GTCAGAGGACATGCTGGAACTGG + Intergenic
1185350086 22:50330873-50330895 GATGCAGGACAAGCTGGAAAAGG + Intergenic
949128381 3:472702-472724 GACACAAGACAGGCTGGATTTGG + Intergenic
949133444 3:534206-534228 GACTCAGGATAAGGTGGAGCTGG + Intergenic
950429498 3:12942794-12942816 GACACCAGTCAGGCTGGATCAGG - Intronic
950528222 3:13536972-13536994 GGCACAGCACAAGCAGGAGCTGG + Intergenic
950594359 3:13965705-13965727 GAAAGAGGAGAAGCTGGAGCTGG - Intronic
954135854 3:48581809-48581831 GTCACAGGACTTGCTGGGTCAGG - Intronic
954439465 3:50513760-50513782 AACCCAGGAGGAGCTGGATCGGG - Intergenic
954796715 3:53165184-53165206 GACTAAGGACAAGCAGGAGCTGG + Intronic
954829327 3:53405963-53405985 GACAAAGGACAAGCTGGGCATGG + Intergenic
955163728 3:56490205-56490227 GACACCAGTCAGGCTGGATCAGG - Intergenic
955400588 3:58588390-58588412 GTCAGAGCAGAAGCTGGATCTGG - Intronic
955412069 3:58662115-58662137 CAGAGAGGACAAACTGGATCAGG + Intronic
963040297 3:141065316-141065338 GACACAGAACAAGGTGCAGCAGG - Intronic
966047842 3:175574545-175574567 GACACAAGAGAAACTGGAGCTGG - Intronic
968470005 4:775840-775862 GACACAGGATAAGCTGCTTCTGG - Intergenic
968922661 4:3530748-3530770 GACAGAGGACCAGCTGGAGGTGG + Intronic
969056838 4:4407587-4407609 GCCACAGGACCAGCTGAATGGGG - Intronic
971404476 4:26309296-26309318 GGCACAGGACACGGTGGCTCAGG - Intronic
972200609 4:36710188-36710210 GACAGAGGTCATGCTGTATCAGG - Intergenic
972339615 4:38140092-38140114 GAATGAGGACAAGCTGGAACTGG + Intergenic
976414056 4:84751061-84751083 GAAACAGCACAGGCTGGATTTGG - Intronic
977672771 4:99715290-99715312 CACACAGGACAACCTGATTCTGG - Intergenic
978673546 4:111281033-111281055 GACACTGGAGAAGCTGGGTAGGG - Intergenic
979623449 4:122821232-122821254 GGCAAGGGACAAGCTGCATCTGG - Intergenic
980167542 4:129247368-129247390 CACACAGGCCAAGGTGGAGCTGG - Intergenic
982215357 4:153078753-153078775 GACACAGGAGCAGCTGGAAGGGG - Intergenic
983673070 4:170260283-170260305 GACCCAGTACAATCTGGAGCGGG - Intergenic
985773574 5:1827957-1827979 GCCCCAGGACACGCAGGATCAGG - Intergenic
986676432 5:10189546-10189568 GGCACAAGACAAGATGGAACAGG - Intergenic
988208978 5:28177752-28177774 GAAACAGGAAAAGCTGCATTTGG + Intergenic
992178272 5:74172226-74172248 GACAAAGCACAAAATGGATCAGG - Intergenic
993980059 5:94533563-94533585 GACACAGCATAGGCTGGATGTGG - Intronic
995485553 5:112636715-112636737 GAGACAGGACAAGCAGGCTGAGG + Intergenic
1002406997 5:179042503-179042525 GACCCAGGGCCTGCTGGATCAGG + Intergenic
1002599881 5:180348022-180348044 CACACAGGACAGGTTGGCTCTGG + Intronic
1003723433 6:8732528-8732550 GGCAGAGGACAAGCTAGTTCAGG + Intergenic
1004188807 6:13446504-13446526 GACACAGGACATGGTGAAGCCGG + Intronic
1006362893 6:33597042-33597064 GAGACAGGATAAGCTGGGTGTGG - Intergenic
1013322740 6:109010307-109010329 GACACAGGACTGGAGGGATCTGG - Intronic
1015839150 6:137457641-137457663 GACACAGGTCAAACTAGATTAGG + Intergenic
1022208292 7:28183654-28183676 GGCACTGGACATGCTGGATTTGG - Intergenic
1023766111 7:43512246-43512268 GACACAGGACAAGCCAGGGCAGG + Intronic
1025178367 7:56813059-56813081 GAGACAGGAGGAGCTGGACCTGG + Intergenic
1025178797 7:56814801-56814823 GAGACAGGAGGAGCTGGACCTGG + Intergenic
1025179235 7:56816591-56816613 GAGACAGGAGGAGCTGGACCTGG + Intergenic
1025179693 7:56818477-56818499 GAGACAGGAGGAGCTGGACCTGG + Intergenic
1025180141 7:56820315-56820337 GAGACAGGAGGAGCTGGACCTGG + Intergenic
1025180612 7:56822297-56822319 GAGACAGGAGGAGCTGGACCTGG + Intergenic
1025181057 7:56824144-56824166 GAGACAGGAGGAGCTGGACCTGG + Intronic
1025181486 7:56825886-56825908 GAGACAGGAGGAGCTGGACCTGG + Intronic
1025689851 7:63748645-63748667 GAGACAGGAGGAGCTGGGTCTGG - Intergenic
1025689990 7:63749267-63749289 GAGACAGGAGGAGCTGGACCTGG - Intergenic
1025690427 7:63751094-63751116 GAGACAGGAGGAGCTGGACCTGG - Intergenic
1025690875 7:63752917-63752939 GAGACAGGAGGAGCTGGACCTGG - Intergenic
1025691315 7:63754692-63754714 GAGACAGGAGGAGCTGGACCTGG - Intergenic
1025691754 7:63756516-63756538 GAGACAGGAGGAGCTGGACCTGG - Intergenic
1025692201 7:63758339-63758361 GAGACAGGAGGAGCTGGACCTGG - Intergenic
1025692647 7:63760162-63760184 GAGACAGGAGGAGCTGGACCTGG - Intergenic
1025693063 7:63761841-63761863 GAGACAGGAGGAGCTGGACCTGG - Intergenic
1025693509 7:63763664-63763686 GAGACAGGAGGAGCTGGACCTGG - Intergenic
1026251772 7:68677503-68677525 GACACAGGACAGGCTGGGCGTGG + Intergenic
1027928335 7:84497221-84497243 TTCAAAGGACAAGCTGCATCAGG + Intergenic
1028684611 7:93577238-93577260 GACACAGCAGAAGCAAGATCAGG + Intergenic
1028937903 7:96486483-96486505 GACACAGGGCCAGGTGGAACAGG - Intronic
1030922461 7:115408644-115408666 GACACAGAGCAGGGTGGATCTGG + Intergenic
1035991645 8:4497508-4497530 TATACAGAACAAGCTGGATTTGG - Intronic
1036228601 8:6981203-6981225 GACACAGGTCAGGTTGTATCTGG + Intergenic
1036231053 8:7000313-7000335 GACACAGGTCAGGTTGTATCTGG + Intronic
1036975059 8:13401541-13401563 GAAACTGGACCAGCTTGATCAGG - Exonic
1043322542 8:79007712-79007734 GACACAGGCCAAGAGGCATCTGG + Intergenic
1043565862 8:81546725-81546747 GACACAGGAAAATCTGTATGTGG - Intergenic
1049241691 8:141540593-141540615 GACACCAGACATCCTGGATCAGG + Intergenic
1049683243 8:143929134-143929156 GACGCTGGGCAAGCTGGAGCAGG - Exonic
1052443775 9:28532883-28532905 GACAGAAGGCAAGCTGGATTCGG - Intronic
1052880613 9:33599172-33599194 GACACTGGAAAAGCGGGACCCGG - Intergenic
1053055546 9:34991354-34991376 GACACAGGGCAAGCTCTTTCAGG - Intronic
1053906152 9:42846543-42846565 AACACAGGGCAAGCTGTGTCGGG + Intergenic
1060194962 9:121617586-121617608 GACAAAGGACAGGCTGCCTCTGG - Intronic
1060584847 9:124779567-124779589 GTCCCAGGACAAGCTGGGGCTGG + Intronic
1061944534 9:133901435-133901457 ACCACAGGCCATGCTGGATCCGG - Intronic
1062460494 9:136660757-136660779 GACATAGGACAAGCTGGGGTGGG + Intronic
1188929414 X:36088063-36088085 GACACAAGCCAAACTGGATTTGG + Intronic
1191058674 X:56271402-56271424 GATAAATGACAAGCTGCATCTGG - Intronic
1193112295 X:77742406-77742428 GACAAAGGAGAAGCAGGATTGGG + Intronic
1193442794 X:81564155-81564177 GACAAAGGTGAAGCTGGAACAGG - Intergenic
1197131815 X:123014265-123014287 GACACAGAGCAAGGTAGATCAGG + Intergenic
1197164294 X:123359655-123359677 TACACAGGGCAAATTGGATCTGG + Intronic
1198126361 X:133648075-133648097 GACATAGGAGAGGCTGGAGCAGG - Intronic