ID: 1085045090

View in Genome Browser
Species Human (GRCh38)
Location 11:73347982-73348004
Sequence GGAGAAGCACAACTGGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 216}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085045084_1085045090 -1 Left 1085045084 11:73347960-73347982 CCTCGGATAGGTGGGGCCCAGGG 0: 1
1: 0
2: 4
3: 17
4: 193
Right 1085045090 11:73347982-73348004 GGAGAAGCACAACTGGAGCAAGG 0: 1
1: 0
2: 3
3: 16
4: 216
1085045075_1085045090 23 Left 1085045075 11:73347936-73347958 CCAAGATGATGTCTGGGCTCCTG 0: 1
1: 0
2: 2
3: 27
4: 235
Right 1085045090 11:73347982-73348004 GGAGAAGCACAACTGGAGCAAGG 0: 1
1: 0
2: 3
3: 16
4: 216
1085045082_1085045090 4 Left 1085045082 11:73347955-73347977 CCTGGCCTCGGATAGGTGGGGCC 0: 1
1: 0
2: 0
3: 12
4: 220
Right 1085045090 11:73347982-73348004 GGAGAAGCACAACTGGAGCAAGG 0: 1
1: 0
2: 3
3: 16
4: 216
1085045074_1085045090 24 Left 1085045074 11:73347935-73347957 CCCAAGATGATGTCTGGGCTCCT 0: 1
1: 0
2: 0
3: 12
4: 146
Right 1085045090 11:73347982-73348004 GGAGAAGCACAACTGGAGCAAGG 0: 1
1: 0
2: 3
3: 16
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085045090 Original CRISPR GGAGAAGCACAACTGGAGCA AGG Intronic
900212462 1:1462850-1462872 GGAGTGGCCCAACTGGGGCAGGG - Intronic
901037825 1:6346952-6346974 GGAGAAGCAAGCCTGGGGCAAGG + Intronic
902285232 1:15403999-15404021 GGATAAGCATGATTGGAGCATGG + Intergenic
903020341 1:20389290-20389312 GGAGGAGCAGGGCTGGAGCAGGG + Intergenic
903294617 1:22335818-22335840 GGAAGAGCACACCTGGGGCAAGG - Intergenic
906639340 1:47432356-47432378 GAAGAGGCAGGACTGGAGCAGGG + Intergenic
906874537 1:49522797-49522819 GTAGAAGCACAGCATGAGCACGG + Intronic
911620186 1:100057712-100057734 GGAGAAGAATAACTGAAGAAAGG + Intronic
917277398 1:173345734-173345756 GGAGAAGCATAACTGAAGTTTGG + Intergenic
921213484 1:212918876-212918898 GAAGAAGCCCAGCTGGTGCATGG + Intergenic
1064910043 10:20390738-20390760 GGAGAAGCATCACTATAGCACGG + Intergenic
1065299742 10:24310648-24310670 TTAGAGGCACACCTGGAGCAAGG - Intronic
1065468000 10:26045856-26045878 GGATAGGCACAAATGAAGCATGG - Intronic
1067067540 10:43112316-43112338 CCAGAAGCAGACCTGGAGCAGGG - Intronic
1067196510 10:44124104-44124126 GGAGAAGCCCAACAGGGGTAAGG + Intergenic
1067540702 10:47150249-47150271 GGAGAGTCATAACTGGAGCCTGG - Intergenic
1068055356 10:52005942-52005964 CGAGAAGAAGAACTGAAGCATGG + Intronic
1070796355 10:79219190-79219212 GGAGAAGGAGACCTGGAGAATGG + Intronic
1071089409 10:81901256-81901278 GCAGAAGCAGAACTGCAGCCGGG + Intronic
1072112001 10:92331281-92331303 GAAAAAGCACAACTGAATCAAGG - Intronic
1073963529 10:108961636-108961658 GGAAAAGAACAATTGGACCATGG - Intergenic
1074919003 10:117988290-117988312 GGAGAGGCAAGACAGGAGCAGGG - Intergenic
1075779839 10:125010109-125010131 CGAGAAGGACCACAGGAGCAGGG + Intronic
1075930538 10:126291683-126291705 GGAGAAGCTCCACTGGAGTTGGG + Intronic
1077287131 11:1772695-1772717 GGAGGGGCAGGACTGGAGCAGGG - Intergenic
1077346320 11:2057798-2057820 GGAGAAGGAAAAATGGAGTATGG - Intergenic
1077347076 11:2066047-2066069 GGAGAATGATACCTGGAGCATGG - Intergenic
1078396357 11:10985305-10985327 GGAGAGGCACAACGGAGGCACGG + Intergenic
1078594098 11:12672104-12672126 CAAGAAGCATATCTGGAGCAAGG + Intergenic
1080196053 11:29610345-29610367 AAAGAAGCAGAACTGGATCATGG - Intergenic
1083259204 11:61514105-61514127 AGAGAAGCAAAAATGGAGGAAGG + Intergenic
1083778096 11:64903922-64903944 GAAGAACCACAAATGCAGCAGGG - Intronic
1084329131 11:68419928-68419950 GGAGGTGCACAACTTGAGCCTGG - Intronic
1084391918 11:68882936-68882958 AGAGAAGCACACCTGGGGCTGGG - Intergenic
1084647510 11:70466983-70467005 GTAGCAGCACATGTGGAGCAGGG + Intergenic
1085045090 11:73347982-73348004 GGAGAAGCACAACTGGAGCAAGG + Intronic
1085101650 11:73805750-73805772 GTAGAAGAACCACTTGAGCATGG - Intronic
1085406514 11:76266294-76266316 TGAGAAGCTGAACTAGAGCAGGG + Intergenic
1091298562 11:134490170-134490192 GGAGGAGCACACCTTGGGCAGGG + Intergenic
1092162820 12:6325283-6325305 GGAGAAGCAGAGCTGGGACAGGG - Intronic
1093709593 12:22314778-22314800 GGAGAAGTACGCCTGGAGCCAGG - Intronic
1095284973 12:40399848-40399870 GGAGAAGCAGAAGTGTACCATGG + Intronic
1095964433 12:47857445-47857467 GGAGAAGCACTAGTGGAGCCAGG - Intronic
1096186037 12:49581153-49581175 GGATATGTAGAACTGGAGCATGG + Intronic
1096849654 12:54427419-54427441 GGAGAAACAGACCTGGAGAAGGG + Intergenic
1097107198 12:56632856-56632878 GGAGAAGCACAGCTGCAGCATGG - Intronic
1102226764 12:111234303-111234325 GGAGCAGCAAAGCAGGAGCAAGG + Intronic
1104033125 12:125079365-125079387 GGGGACGCAGAGCTGGAGCACGG - Intronic
1104517764 12:129443551-129443573 GGAGAGCCAGAACTGGAGCCAGG - Intronic
1104670485 12:130676812-130676834 GGAGAGGCAGAACTCCAGCAGGG + Intronic
1105940326 13:25141977-25141999 GGAGAAACACATGTGGAGGATGG - Intergenic
1106010019 13:25811500-25811522 AGAGAAGTACAACCGGGGCAAGG - Intronic
1106823097 13:33488303-33488325 GGAGAAGCACACCTGGATGAGGG - Intergenic
1107372956 13:39772197-39772219 GGTTAAGCAAAACTGGAGCAAGG - Intronic
1110600312 13:77365174-77365196 GTAGAAGCACATTTGGAGAAAGG + Intergenic
1110898385 13:80786924-80786946 GGAGACTGACAAGTGGAGCAAGG + Intergenic
1111231852 13:85354345-85354367 GGAGCATCCCTACTGGAGCATGG + Intergenic
1112084750 13:96018420-96018442 GCAGAAGTACAACTTGAGCCTGG + Intronic
1116799168 14:49425177-49425199 GGAGAAGTACATCTGAAACATGG - Intergenic
1118255940 14:64205905-64205927 GGTGAAGCTCAACTGGCCCACGG - Intronic
1118468541 14:66053840-66053862 GGAGATGCACTACAGGAGAATGG - Intergenic
1119294736 14:73523754-73523776 GGAGCAGCACAAATTGAGCTGGG - Intronic
1119916607 14:78407839-78407861 GGAGGAGCAGCACTGGAACATGG - Intronic
1120032377 14:79656770-79656792 GGTGAAGCACAACTGCAGCCAGG + Intronic
1122837237 14:104436275-104436297 GGAGAAGCAGGACGGCAGCAAGG + Intergenic
1202891576 14_KI270722v1_random:164125-164147 GGAGAAGCAAAACTGTAGCAGGG + Intergenic
1125680958 15:41529899-41529921 GGAGAAGCTCCACTGGACCCAGG - Exonic
1128369485 15:67029994-67030016 GGAGATGCCCAATTAGAGCAGGG + Intergenic
1129675346 15:77630293-77630315 GGAGAAGCACAATTGGGGTTGGG - Intronic
1129836097 15:78707368-78707390 GAAGAAGAACAACTCAAGCAGGG + Intronic
1130151472 15:81314937-81314959 ACAGAAGGACAACTGGGGCATGG + Intronic
1132118432 15:99156182-99156204 GGAGGAGCAGACCTGGCGCAGGG - Exonic
1132175773 15:99712678-99712700 GGCCAAGCACAATTGGAGAATGG - Exonic
1132350512 15:101136960-101136982 GGAGAAGGGCAACCGGAGCCTGG + Intergenic
1133000791 16:2850451-2850473 GGAGAAACAGGACAGGAGCAGGG + Intergenic
1133440545 16:5817583-5817605 GGAGAAGCCCAGCTGGAGAGGGG + Intergenic
1134233744 16:12449606-12449628 GGAGATGCACAGCTGGAGCACGG - Intronic
1134636381 16:15795000-15795022 GGAGAATCAGAACTGCAGGATGG + Intronic
1137618704 16:49861639-49861661 GCAGATGCAAAACTGGAACACGG - Intergenic
1138810388 16:60142814-60142836 GGAGAAACAGAAGTGGAGAAAGG - Intergenic
1141728993 16:85809441-85809463 GGAGAAGCATAGCTGTAGCCAGG + Intergenic
1143217046 17:5233005-5233027 TGAGAAGGACAAGTGGAGCGAGG - Intronic
1143537802 17:7551568-7551590 GAAGAGGCACACCGGGAGCAGGG - Intronic
1145749385 17:27344317-27344339 GGAGAGGAAGAACTGGGGCAGGG - Intergenic
1146744456 17:35314980-35315002 AGAGAGGCAGAGCTGGAGCAGGG - Intergenic
1146907412 17:36626682-36626704 GGGGAAGCACACCTTGATCATGG + Intergenic
1147389202 17:40099135-40099157 CGAGAGGCACACGTGGAGCAGGG - Intronic
1147473387 17:40685768-40685790 GGAGAAGCAAAATAGGAACAAGG - Intergenic
1148766072 17:50039044-50039066 TGAGAAACACACCTGGAGCTTGG - Intergenic
1148859931 17:50599531-50599553 GGAGAAGCCCAAGTGGAGAGCGG + Exonic
1151326632 17:73383742-73383764 GGAGAGGCACACATGGAGGAGGG + Intronic
1153026657 18:679004-679026 GGAGGAGCGCAGCTGGAGCATGG - Intronic
1158473228 18:57757319-57757341 GGAGAGGTACAACTTGAGCCTGG - Intronic
1159302003 18:66585377-66585399 AGAGTAGCACATGTGGAGCAAGG + Intronic
1161084625 19:2329043-2329065 GGAGAAGCAGAACCGGAGGATGG - Intronic
1161641375 19:5425544-5425566 GGAGAAGCAGGGGTGGAGCAAGG - Intergenic
1161899326 19:7106189-7106211 GGAGAAGCACAAATGAAGAGAGG + Intergenic
1162549512 19:11350842-11350864 GGAGGAGCACAAGTGGGGCATGG + Exonic
1164053739 19:21604860-21604882 GCAGAAGCATAACTTGGGCATGG - Intergenic
1164771423 19:30812277-30812299 GGTGAAGCAGGACTGGAGCAGGG + Intergenic
1164807477 19:31128075-31128097 GGACAAGCACAGGTGGACCAAGG - Intergenic
1165395743 19:35562707-35562729 GGAGAAGGGAAACTGAAGCAGGG - Intronic
1165485923 19:36096049-36096071 GGAGTAGCACCACTGGATCCTGG + Intronic
1167506115 19:49871934-49871956 GGAGGAGGACACATGGAGCATGG - Intronic
1167869534 19:52356191-52356213 GATGAAGCACAACTGAAGAATGG - Intronic
1168413775 19:56156320-56156342 TGAGAGGCATAACTGAAGCATGG + Intronic
925514641 2:4666759-4666781 AGAGAAGCAAAACGGGAGAAAGG - Intergenic
926425717 2:12736963-12736985 GGGGAAGCACAATTAGGGCAAGG + Intronic
927498010 2:23563631-23563653 GGCGCAGCACACCTGGAGCGCGG - Intronic
928284663 2:29979387-29979409 AGAGAAACAGAACAGGAGCATGG - Intergenic
928416348 2:31095286-31095308 TTGGTAGCACAACTGGAGCAAGG - Intronic
928997353 2:37307114-37307136 TTGGATGCACAACTGGAGCAGGG - Intronic
930570304 2:53077748-53077770 GCAGCAGCTCAACTGGAGGATGG - Intergenic
931408864 2:62008872-62008894 GAAGAATCACCACTTGAGCACGG - Intronic
933939873 2:87236211-87236233 GGTGAAGCAAACATGGAGCAGGG - Intergenic
934721058 2:96577155-96577177 GGAGAGGGAAAACTGGAACAAGG - Intergenic
935938693 2:108215926-108215948 GGAGAAGAACCACGGGAGCCTGG - Intergenic
936353264 2:111729562-111729584 GGTGAAGCAAACATGGAGCAGGG + Intergenic
936875403 2:117183723-117183745 GGATGAGTATAACTGGAGCATGG + Intergenic
937028685 2:118720345-118720367 GGAGCAGAATAGCTGGAGCAGGG - Intergenic
938121233 2:128635760-128635782 GGAGAAGCAAAACAACAGCAAGG + Intergenic
938238350 2:129724044-129724066 TGGGAAGCAGAATTGGAGCAGGG - Intergenic
938626643 2:133116897-133116919 GTAGAAACACAACTGGTACAAGG + Intronic
942231823 2:173867349-173867371 GGAAAATCAGAAGTGGAGCATGG - Intergenic
942911093 2:181245259-181245281 GGAAAAACACAACTGGAACCTGG - Intergenic
946109745 2:217404131-217404153 GGAGAGACTCAACTGGAGGAGGG - Intronic
946614474 2:221494816-221494838 GGAGAAACAGATCTGGAGAAGGG + Intronic
947870014 2:233429822-233429844 GGAGAAGAACACCTGGGGCCGGG - Intronic
1170600346 20:17836777-17836799 GGAGCAGCACAGCTGGATCTTGG + Intergenic
1172281865 20:33713474-33713496 GGAAAAGCAAAATTAGAGCAGGG - Intronic
1173119935 20:40279511-40279533 GGAGAAGGAGAACTAAAGCAGGG - Intergenic
1173843402 20:46173656-46173678 GGGGAAGGGCATCTGGAGCAAGG + Intergenic
1173937590 20:46880842-46880864 GGAGAAGCAGGAGTGGAGCCTGG + Intergenic
1176969613 21:15250322-15250344 GGAGAAGCACAAATTGTTCAGGG - Intergenic
1177911160 21:27034052-27034074 GGAGAAGCACAAGGGGAGGATGG - Intergenic
1182991313 22:34770619-34770641 GGAGAAACACAGCTGGTGAAAGG - Intergenic
1183382307 22:37496327-37496349 GGAGAAGGGCAATTGGGGCAAGG + Intronic
1183795523 22:40113823-40113845 GGAGGAGCACAACACCAGCAAGG - Intronic
1184903823 22:47465230-47465252 GGAGAGGCACAAATGGAGCCTGG + Intronic
951510188 3:23491808-23491830 AGGGAAGCACAACTGGAGGCAGG + Intronic
952814439 3:37435002-37435024 GGAGCAGCACACCTGGTGCGTGG + Exonic
954638650 3:52085223-52085245 GGAGGAGCCCAGCTGGGGCAGGG - Intronic
955204687 3:56885193-56885215 GGAGAAGCAGAACTCAAGAAGGG - Intronic
957891496 3:86364764-86364786 GGAGAAGAACAGTTGGAACATGG + Intergenic
958586156 3:96091022-96091044 GGACAAGCAGAAGTGGGGCATGG + Intergenic
961103805 3:124223889-124223911 GGAGAAGCAAAAGTGGGGCTTGG + Intronic
961506213 3:127372073-127372095 GGAGAAGCCTACCTGGGGCAGGG - Intergenic
969277994 4:6149914-6149936 GGAGAAGCCCAGCTGGAGGGTGG - Intronic
971468142 4:26987581-26987603 GGAGATTCAGAACTGCAGCATGG - Intronic
971879634 4:32353861-32353883 GGGCAAGAACAACTGTAGCAGGG - Intergenic
978595805 4:110375697-110375719 GGAGAAGCAGATTTAGAGCAAGG + Intronic
978904852 4:113993839-113993861 GGAGAAACAGGACTGGAGGAGGG + Intergenic
979790224 4:124771269-124771291 AGAAAAGCAAAACTGCAGCAAGG - Intergenic
981176846 4:141691944-141691966 GGAGAACCTCTGCTGGAGCAGGG - Intronic
986095201 5:4547719-4547741 GGAGCAGCAAAACTGAAGCTGGG - Intergenic
986751894 5:10794857-10794879 CCAGAAGCAGAACTGGAGCTGGG + Intergenic
989282514 5:39661589-39661611 GGAAAACCAAAACTGGGGCATGG + Intergenic
989779624 5:45248120-45248142 GGAGCAGAATAAATGGAGCACGG - Intergenic
990447283 5:55904567-55904589 TGAGAAGGACAACTGAGGCATGG - Intronic
990523771 5:56605184-56605206 ACAGAAGCACTACTGGTGCACGG - Intronic
991249437 5:64543708-64543730 GGAGCTGCATAAGTGGAGCAGGG + Intronic
992594354 5:78330580-78330602 GTAGAAGAATAACGGGAGCAGGG - Intergenic
992628241 5:78654152-78654174 GGATAAGCTCAACTGGATGAGGG - Intronic
993936475 5:94011021-94011043 CAAAAAGCACAACTTGAGCAAGG + Intronic
995680573 5:114713813-114713835 GGAGAAAGACAACTGTAGTAAGG - Intergenic
996960961 5:129249126-129249148 CGAGAAGTATAACTGGAGTAAGG - Intergenic
997259573 5:132455717-132455739 GCAGAAAATCAACTGGAGCAGGG - Intronic
997334955 5:133100897-133100919 GCAGAAGGACCACTTGAGCATGG - Intronic
1001821334 5:174712818-174712840 GGAGAAGGACAGGTGGAGCGGGG - Intergenic
1002133525 5:177095236-177095258 GGACAAGCAGCACTGGACCAGGG - Intronic
1002998434 6:2308538-2308560 AGAGAATCACTACTGGATCAAGG + Intergenic
1006441152 6:34054484-34054506 GGGGAAGGAGGACTGGAGCAGGG - Intronic
1007763864 6:44149887-44149909 CGAGAAGCACCACAGCAGCAGGG - Exonic
1008007297 6:46424478-46424500 AGAGAAGAAGAACTGGAGGATGG - Intronic
1011770314 6:90668574-90668596 GGAGATGCACAATTGGTTCAAGG - Intergenic
1013355317 6:109341319-109341341 GGAGCAGGACAACTGCAGCCTGG + Intergenic
1013387144 6:109642767-109642789 GGAGAAGCACATTGGGGGCAGGG + Intronic
1014904688 6:127011849-127011871 GGAGAAGCATTACTGGAGAATGG - Intergenic
1017052610 6:150407761-150407783 GAAGAAGGACAACTGGATAAAGG + Intergenic
1017555077 6:155555507-155555529 GGAGAAGGACAATAGAAGCAGGG - Intergenic
1017747606 6:157460873-157460895 GGAGAAACACAACTGGGCCTAGG - Intronic
1018634917 6:165852630-165852652 GGAGAAGCACACTGTGAGCAAGG + Intronic
1023460644 7:40392714-40392736 GGAGAGACAAAACTGGAGGAAGG + Intronic
1027237461 7:76306570-76306592 AGAGACCCACATCTGGAGCAGGG + Intergenic
1027500877 7:78949876-78949898 GGAGAAGCCGAAGGGGAGCAAGG - Intronic
1029877062 7:103765232-103765254 GAGAAAGCACAATTGGAGCAAGG + Intronic
1030007051 7:105130132-105130154 GGAGAAGCACAACAGAATGAGGG - Intronic
1030035050 7:105401788-105401810 GGAGAAGAGGAACAGGAGCAGGG + Intergenic
1030709994 7:112738731-112738753 GGAGCTGCAGCACTGGAGCAAGG - Intergenic
1030918017 7:115341070-115341092 GGAGAAGCAGAGCTGGAAGAGGG - Intergenic
1031343894 7:120640817-120640839 GGAGAAGCACCCCAGGAGAAAGG - Intronic
1032940576 7:136785160-136785182 GGAGATGCTCACCTTGAGCATGG - Intergenic
1034036580 7:147829987-147830009 GGAGATCCACTTCTGGAGCAAGG - Intronic
1035216691 7:157372848-157372870 GGAGAAGAACAGCTGGGGAAGGG - Intronic
1035621231 8:1036944-1036966 GGAGAAGGAAACCAGGAGCACGG - Intergenic
1036610134 8:10342622-10342644 TGAGCAGCACAGCTGGGGCAGGG + Intronic
1037879702 8:22566634-22566656 GGAGAAGCACAACCTCAGCTTGG - Intronic
1039079148 8:33718788-33718810 GAAGAGGCACAACTATAGCAGGG - Intergenic
1040712071 8:50200633-50200655 CCAGAAGCACAAGAGGAGCAAGG + Intronic
1041211098 8:55551917-55551939 TGAGAAGCATCACAGGAGCATGG - Intergenic
1041371654 8:57167181-57167203 TGAAAAGCACAAATGGAGCCAGG + Intergenic
1041711208 8:60896184-60896206 GCAGAAGCAGAACTAGAGCTAGG + Intergenic
1042011346 8:64248588-64248610 GGAGATGAACAACTGAAGCCTGG - Intergenic
1042432254 8:68721378-68721400 GAAGAAGCACTAATGGAGGAGGG + Exonic
1045102325 8:98857902-98857924 TTAGAAGCAAAACTGGAGAAAGG + Intronic
1046211547 8:111082597-111082619 GGGGAAGCAGAAGTGGATCAGGG - Intergenic
1048511145 8:135064016-135064038 CTAGAAGCACAACTTGAGAAAGG + Intergenic
1048879566 8:138861218-138861240 TGAGCAGACCAACTGGAGCAAGG + Intronic
1049418918 8:142508276-142508298 GGAGAGGAACAGGTGGAGCAGGG - Intronic
1049730475 8:144175151-144175173 GGAGAAGCTCAGGTGCAGCAGGG - Intronic
1051669147 9:19493169-19493191 GGAGTAACAAAACAGGAGCAGGG - Intergenic
1052261626 9:26523088-26523110 AGAGAAGAATACCTGGAGCAGGG + Intergenic
1053071457 9:35104477-35104499 GGAGAGGGACAACTGGAGTCTGG + Exonic
1053141971 9:35688203-35688225 GGAGAACCAAAACTGGAGGCTGG + Intronic
1055069063 9:72148273-72148295 ACAGAAGCACCACAGGAGCAGGG - Intronic
1056065710 9:82932229-82932251 GGAGGGGCACACCTGGAGTATGG + Intergenic
1057911304 9:99022399-99022421 GGAGAAGCAGGTCTGGGGCATGG - Intronic
1057961011 9:99457386-99457408 AAAGAAGCACAAGTGGAGAATGG + Intergenic
1058185860 9:101854022-101854044 GCAGAAGCAAAAGTGGAGCAGGG - Intergenic
1059307406 9:113365547-113365569 GGAAAAGCACAAGTTGAGCTGGG - Intronic
1059529447 9:115022450-115022472 GGAGGAGCAGAGCTGGAGCTGGG + Intronic
1060312736 9:122477357-122477379 TGAGCAGGACAACTTGAGCAGGG + Exonic
1188980603 X:36723716-36723738 GGAGATGCACATTTGGAGGAAGG + Intergenic
1188984484 X:36756976-36756998 GGAGAAACAAGACTGGAGAAAGG - Intergenic
1190699843 X:52979513-52979535 GGAGAAGGACAGCTGGAGGGAGG - Intronic
1192432392 X:71121236-71121258 AGAGAACCACAACTGGGGCAAGG - Intronic
1192554405 X:72078503-72078525 GGAGAGGCAGAACTAGAGAAGGG - Intergenic
1192717309 X:73657957-73657979 GGAGAAAGACAACTTGATCATGG + Intronic
1194154659 X:90372125-90372147 GGAGAAGGACTACTGGAGTAGGG - Intergenic
1195928757 X:110052373-110052395 GGAGAAGAACTAGTGGATCAGGG - Intronic
1196984922 X:121258517-121258539 GTTGAAGCAAAACTGGACCATGG + Intergenic
1200074573 X:153544749-153544771 GGAGAAGCACACTTGGAGAAAGG - Intronic
1200246191 X:154527345-154527367 GGAGAGGCACAAATGGGGCGGGG - Intergenic
1200248700 X:154540849-154540871 GGAGCATCAGAAGTGGAGCAGGG - Intronic
1200250970 X:154553555-154553577 GGAGAGGCCCTGCTGGAGCATGG + Intronic
1200501013 Y:3949017-3949039 GGAGAAGGACTACTGGAGTAGGG - Intergenic