ID: 1085047714

View in Genome Browser
Species Human (GRCh38)
Location 11:73363104-73363126
Sequence CCTTCCGGAGGGGCATGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 643
Summary {0: 1, 1: 0, 2: 2, 3: 44, 4: 596}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085047706_1085047714 1 Left 1085047706 11:73363080-73363102 CCGGGGAAGAACAGCTTTGAGAG 0: 1
1: 0
2: 3
3: 24
4: 221
Right 1085047714 11:73363104-73363126 CCTTCCGGAGGGGCATGGCCAGG 0: 1
1: 0
2: 2
3: 44
4: 596
1085047705_1085047714 11 Left 1085047705 11:73363070-73363092 CCGGAGCAGGCCGGGGAAGAACA 0: 1
1: 0
2: 1
3: 17
4: 175
Right 1085047714 11:73363104-73363126 CCTTCCGGAGGGGCATGGCCAGG 0: 1
1: 0
2: 2
3: 44
4: 596

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085047714 Original CRISPR CCTTCCGGAGGGGCATGGCC AGG Intronic