ID: 1085048288

View in Genome Browser
Species Human (GRCh38)
Location 11:73365925-73365947
Sequence CTGTGTCTGGGGGAGGTGGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 863
Summary {0: 1, 1: 1, 2: 3, 3: 91, 4: 767}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085048288_1085048299 7 Left 1085048288 11:73365925-73365947 CCCACCACCTCCCCCAGACACAG 0: 1
1: 1
2: 3
3: 91
4: 767
Right 1085048299 11:73365955-73365977 AGTGCATCATACCCCAAGCTAGG 0: 1
1: 0
2: 1
3: 3
4: 70
1085048288_1085048301 15 Left 1085048288 11:73365925-73365947 CCCACCACCTCCCCCAGACACAG 0: 1
1: 1
2: 3
3: 91
4: 767
Right 1085048301 11:73365963-73365985 ATACCCCAAGCTAGGGATCATGG 0: 1
1: 0
2: 1
3: 3
4: 105
1085048288_1085048300 8 Left 1085048288 11:73365925-73365947 CCCACCACCTCCCCCAGACACAG 0: 1
1: 1
2: 3
3: 91
4: 767
Right 1085048300 11:73365956-73365978 GTGCATCATACCCCAAGCTAGGG 0: 1
1: 0
2: 0
3: 7
4: 55
1085048288_1085048306 29 Left 1085048288 11:73365925-73365947 CCCACCACCTCCCCCAGACACAG 0: 1
1: 1
2: 3
3: 91
4: 767
Right 1085048306 11:73365977-73365999 GGATCATGGACATTTGGTTTAGG 0: 1
1: 0
2: 1
3: 11
4: 183
1085048288_1085048305 23 Left 1085048288 11:73365925-73365947 CCCACCACCTCCCCCAGACACAG 0: 1
1: 1
2: 3
3: 91
4: 767
Right 1085048305 11:73365971-73365993 AGCTAGGGATCATGGACATTTGG 0: 1
1: 0
2: 0
3: 5
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085048288 Original CRISPR CTGTGTCTGGGGGAGGTGGT GGG (reversed) Exonic
900188182 1:1342610-1342632 CTCTTCCTGGGGGAGGCGGTGGG - Intronic
900204566 1:1426527-1426549 CTGTGGCTGGTGGGGGTGCTTGG - Intronic
900385589 1:2409172-2409194 CTTGGGCTGGGGGAGGTGGCGGG - Intronic
900472010 1:2859687-2859709 GAGTGACTGGGGGCGGTGGTGGG - Intergenic
900768329 1:4520381-4520403 CTGTGTGTGGTGGAAATGGTGGG - Intergenic
900768359 1:4520525-4520547 CTGTGTGTGGTGGAGGTGGAAGG - Intergenic
900768383 1:4520669-4520691 CTGTGTGTGGTGGAGATGGTGGG - Intergenic
900768404 1:4520765-4520787 CCGTGTATGGTGGAGGTGGAGGG - Intergenic
900768411 1:4520789-4520811 CTGTCTGTGGTGGAGGTGGAGGG - Intergenic
900768433 1:4520885-4520907 CTGTGTGTGGTAGAGATGGTGGG - Intergenic
900768442 1:4520933-4520955 CTGTCTGTGGTGGAGGTGGAGGG - Intergenic
900768474 1:4521080-4521102 CTGTGTGTGGTAGAGATGGTGGG - Intergenic
900938890 1:5784928-5784950 GTGTGTGTGGGGGGGGGGGTGGG + Intergenic
900991927 1:6102033-6102055 CTGTGCCTGGGGAAAGGGGTCGG + Exonic
901087756 1:6622001-6622023 CTGTGTTGGGGAGAGGTGTTCGG + Exonic
901330583 1:8404789-8404811 CCGTGTCAGGGCGAGGTGGAAGG + Intronic
901370390 1:8792752-8792774 CAGCATCTGGGGGAGGTGTTAGG - Intronic
901703060 1:11055749-11055771 GGGTGTCTGGGGGTGGGGGTTGG - Intronic
901743819 1:11359551-11359573 ATGTGTGTGGGGGCGGCGGTGGG - Intergenic
902689862 1:18104323-18104345 CTGTGTCTAGGTAAGGTGTTTGG + Intergenic
902705884 1:18204030-18204052 CTGTTTCTGAGGGTGGTTGTGGG + Intronic
902839494 1:19066150-19066172 CTGAGTCCTGGGGAGGGGGTGGG - Intergenic
902880457 1:19368777-19368799 CAGTGTCTGGGGGCTGAGGTGGG - Intronic
903265151 1:22153741-22153763 ATGTGTGTTGGGGAGGTGGATGG + Intergenic
904451881 1:30618564-30618586 CTGTGACTCGCAGAGGTGGTGGG + Intergenic
904470628 1:30733836-30733858 CTGAGTATGGGGGTGGTGCTGGG + Exonic
904620350 1:31771613-31771635 CTGTGTCTGGATGAGGGGTTTGG + Intergenic
905170922 1:36109096-36109118 CTCTGTCTGGGGTGGGTGGGGGG - Intronic
905519972 1:38590060-38590082 ATGTGGCTGTGGGAGGTGGGAGG - Intergenic
906207898 1:43996837-43996859 TTGTTTCTGGGGGATGGGGTGGG - Intronic
906273779 1:44501152-44501174 TTGTGCTTGGGGGAGGGGGTGGG + Intronic
906380011 1:45326799-45326821 CAGGGTGTGGGGGAGGGGGTGGG + Intergenic
907107531 1:51897509-51897531 CGGAGTTTGGGGGAGGTGGGTGG + Intergenic
907237134 1:53060464-53060486 CTATTTCTCTGGGAGGTGGTGGG + Intergenic
907300632 1:53484460-53484482 CTGGGTCTGGGGGACATGGGAGG + Intergenic
907372620 1:54013045-54013067 GTGTGTGTGGGGGAGGCGGCGGG + Intronic
907451814 1:54550278-54550300 TTGAGTCTGGGGGTGGAGGTGGG + Intronic
907464349 1:54624926-54624948 GTGAGTCTGGGGGTGCTGGTTGG + Intronic
907474432 1:54695971-54695993 GTGTGTGTTGGGGAGGTGCTAGG + Intronic
907524931 1:55048506-55048528 GAGTGTCTGTGGGAGGTGGCAGG + Intronic
908180212 1:61596496-61596518 CTGTGTGTAAGGGAGGTGGAGGG - Intergenic
909048929 1:70745413-70745435 CTGGGGTTGGGGGAGGTGGAGGG + Intergenic
909288699 1:73854686-73854708 CTGTATCTGCAGGTGGTGGTGGG - Intergenic
909308778 1:74118566-74118588 ATGTGTGTGTGGGAGGTAGTGGG - Intronic
910430786 1:87157651-87157673 TTGTGTCTGGGGGAGCAGGCAGG + Intronic
910798080 1:91118655-91118677 GTGTGGCTGGGCGTGGTGGTGGG - Intergenic
911549443 1:99262112-99262134 CTTTGTCTTGTGGAGGGGGTGGG - Intergenic
912139945 1:106712260-106712282 CAGTGATTGGGGGAGGTGGAGGG + Intergenic
912212739 1:107572389-107572411 GTGTGTGCGGGGGAGGTGGATGG + Exonic
912467037 1:109881451-109881473 CTGTGACTCGGGCAGGTGGCAGG - Intergenic
913106155 1:115615912-115615934 CTGTGTATGGTGGGGGTGGATGG + Intergenic
913172879 1:116248168-116248190 ATGTGTGTGGGGGATGAGGTGGG - Intergenic
913937236 1:125065929-125065951 CTGTGTCTGGGGCTGGGGCTGGG - Intergenic
914959286 1:152191768-152191790 ATGTGTTTGGGAGTGGTGGTGGG + Intergenic
914992965 1:152514566-152514588 CAGGGTCTGGGGGAGAGGGTGGG + Intronic
915638379 1:157202540-157202562 CGGTGTCTGGAGCTGGTGGTGGG + Intergenic
916719582 1:167474200-167474222 CTGAGTCTGGGGGTGGGGCTGGG + Intronic
917002602 1:170375944-170375966 GTGTGTGTGGGGGGGGTGGGGGG + Intergenic
917209758 1:172619865-172619887 CTGTGTCTTGGTGGGGTTGTGGG - Intergenic
917590271 1:176469348-176469370 CTGTTTCTGGGAGAGGGAGTGGG + Intronic
917979280 1:180259424-180259446 CTGTGTCTGGTGGAGGTGCATGG + Intronic
918018303 1:180659565-180659587 CGGTGGCTGGGGGGTGTGGTGGG - Intronic
918028478 1:180778509-180778531 CTGTGTTTGGAGCAGGTAGTGGG + Intronic
918082960 1:181221576-181221598 CAGTGTCTGGGGGAGGCGGAGGG + Intergenic
919422685 1:197390175-197390197 TTGTGTGGGGGGGAGGGGGTGGG + Intronic
919837100 1:201582568-201582590 CTCTGTGTGGGGGAGCTGGCTGG - Intergenic
919855542 1:201703840-201703862 CTGGGTGTGGTGGAGGGGGTGGG + Intronic
920034611 1:203057875-203057897 CTGTGTGTGGAGGAAGGGGTTGG + Intronic
920112579 1:203597768-203597790 CTGTGTGTGGGGGTGGCTGTGGG - Intergenic
920229629 1:204461780-204461802 GTGGGGCTGGGGGAGGTGGCAGG + Intronic
920937092 1:210445696-210445718 CAGTGTTTGAGAGAGGTGGTTGG + Intronic
921814593 1:219549458-219549480 TTGGGACTTGGGGAGGTGGTTGG - Intergenic
922352993 1:224750114-224750136 CTTTGTATGTGGTAGGTGGTAGG + Intergenic
922531551 1:226349085-226349107 CTGTGTGTTGGGGTGGTGGGGGG + Intergenic
922584392 1:226722734-226722756 CTGGGGCTTGGGGAGGTGTTAGG + Intronic
923420913 1:233813947-233813969 GTGTGTCTGGGCGGGGTGGGAGG + Intergenic
924047965 1:240051921-240051943 CAGGGTCTGGGAGAGGTTGTGGG - Intronic
1062831412 10:608358-608380 CTGTGTGTGGGGGGGGCTGTGGG - Intronic
1062831465 10:608486-608508 GTGTGTGTGGGGGGGGTGGGGGG - Intronic
1063064554 10:2595044-2595066 CTGTGTCTGAGGCTGGTTGTGGG - Intergenic
1065164999 10:22966986-22967008 GTGTGTTTGGGGGCGGGGGTGGG + Intronic
1065379275 10:25073069-25073091 CAGGGTTTGGGGGAGGGGGTTGG + Intergenic
1065716062 10:28569658-28569680 CTGTGGCTGGGCAAGGAGGTTGG + Intronic
1066491959 10:35902484-35902506 CTGTGTCTGGGGAAGTTTGATGG + Intergenic
1067282138 10:44880742-44880764 CTGTTGATGGGGGAGATGGTGGG + Intergenic
1067558214 10:47286896-47286918 CTGTGGCTGGGGGAAGTGTTAGG + Intergenic
1067805662 10:49391307-49391329 CTGTGTCTGGGGGCGGTCTGAGG - Intronic
1068571650 10:58636439-58636461 TTGTGTGTTGGGGAGGAGGTGGG - Intronic
1068576939 10:58694710-58694732 ATGTGTTTGGGGGTGGTGGTGGG + Intronic
1069183796 10:65396827-65396849 CTGTGTCTGGGATAGGAGGGTGG - Intergenic
1069554589 10:69389463-69389485 CTCTGGCGGGGGGAGGTGGGGGG + Intronic
1069996510 10:72345062-72345084 TTGTGTCTGTGGGTGGGGGTTGG + Exonic
1070006838 10:72432765-72432787 CTGTGCCTAGTGGAGGTGTTTGG - Intronic
1070464974 10:76712084-76712106 CTTGCTCTGGTGGAGGTGGTGGG - Intergenic
1070805692 10:79269440-79269462 GTGTGTTGGGGGGAGGTGTTGGG - Intronic
1071323205 10:84485885-84485907 GTGGGGTTGGGGGAGGTGGTAGG - Intronic
1071411242 10:85399143-85399165 CTGTGTCTGGGGGAGGTAGTTGG - Intergenic
1071601189 10:86959455-86959477 CTGTGTCTGGAAGAAGTGGATGG - Intronic
1072052010 10:91714298-91714320 CTGTGCCTGGGGGAAGTGGGAGG + Intergenic
1072881843 10:99235913-99235935 GTGTGTGTTGGGGGGGTGGTGGG - Intergenic
1073003420 10:100302451-100302473 CTGTGGGTGGTGGAGGTGGGCGG + Intronic
1073047808 10:100651078-100651100 GTGGGACTGGTGGAGGTGGTGGG - Intergenic
1073047850 10:100651204-100651226 GTGGGACTGGTGGAGGTGGTGGG - Intergenic
1073059543 10:100725074-100725096 GTGTGTATGGGGGAGGGGGAGGG - Intergenic
1073177466 10:101565207-101565229 GAGTGTATGGGGGAGGTGGGAGG - Intergenic
1073287254 10:102396392-102396414 CTCTCTCTGGGGGAGGGGCTGGG + Intronic
1073342529 10:102756401-102756423 CTCTGTCTCAGGGGGGTGGTGGG + Intronic
1073473044 10:103735697-103735719 CTGGGGCTGGGGGAGGGGCTCGG - Intronic
1074377042 10:112949753-112949775 TGGTGGCTGGGGGAGGGGGTGGG - Intergenic
1074767973 10:116714544-116714566 GTGTGTCTGGGGGAGGGGGCAGG - Intronic
1075053330 10:119199459-119199481 CTCTGTTTGGGGGAGGTGGGAGG - Intergenic
1075344693 10:121673525-121673547 CTGTCTCTGGGCGGGGCGGTGGG - Intergenic
1075649896 10:124120447-124120469 TGGTGTCTGCGGGGGGTGGTGGG + Intergenic
1075675145 10:124291073-124291095 CTGGGACTGGGGGAGCTGGCAGG - Intergenic
1075677746 10:124307998-124308020 CTGTGTCTGGGGAAGGTGTCAGG + Intergenic
1075835774 10:125451487-125451509 GTGTGTGTGGAGGAGGCGGTGGG - Intergenic
1076120516 10:127933244-127933266 GTGTGTATGGAGGGGGTGGTAGG - Intronic
1076292535 10:129358152-129358174 GTGTGTGTGGGGGGGGTGGGGGG + Intergenic
1076480748 10:130783745-130783767 CTGTGTGAGGGGGTGCTGGTGGG + Intergenic
1076742684 10:132494808-132494830 CTGTGTCTCGGGGAAGAGGGAGG - Intergenic
1076805931 10:132858724-132858746 CTGTGGCTGGTGGGGGTGGGTGG + Intronic
1076896920 10:133317564-133317586 CTGTGTCTGGGGGGGGTGTGTGG - Intronic
1076896975 10:133317738-133317760 CTGTGTCTGGGCGGGGTGTGTGG - Intronic
1076897011 10:133317876-133317898 CTGTGTCTGGGGGGGGGGTGTGG - Intronic
1076897082 10:133318110-133318132 CTGTGTCTGGGCGGGGTGTGTGG - Intronic
1076897104 10:133318207-133318229 CTGTGTCTGGGGGGGGTGTGTGG - Intronic
1076897119 10:133318272-133318294 CTGTGTCTGGGGGGGGGGTGTGG - Intronic
1076901242 10:133339121-133339143 GTGTGTCTGGGGGGGGTGTGTGG - Intronic
1077039343 11:511845-511867 CTGTGTGTGTGGGGGGTGGCTGG - Intergenic
1077294250 11:1817156-1817178 CAGGGGCTGGGGGAGGTGGAGGG + Intergenic
1077355313 11:2114175-2114197 CTGAGTTTGGGGCAGGAGGTGGG - Intergenic
1077371674 11:2185203-2185225 CTGTTTTTGGGGTAGGTTGTTGG - Intergenic
1077534114 11:3111147-3111169 CTGTGGCAGGGGGTGGGGGTGGG - Intronic
1077695793 11:4391948-4391970 CTGTGTGTGGGGGAGAAGATGGG + Intronic
1078614312 11:12850857-12850879 CTGTGGCTTGGGGAAGTGGCAGG + Intronic
1079016111 11:16870288-16870310 GTGTGTGTGGGGGTGGGGGTAGG - Intronic
1079204273 11:18400416-18400438 GTGTGTGTGGTGGTGGTGGTAGG - Intronic
1079336331 11:19573835-19573857 CTGTGTCTGTGGGAGGCTCTTGG + Intronic
1079446581 11:20562245-20562267 CTGTGCTTGGGGCAGGAGGTTGG - Intergenic
1079605642 11:22362514-22362536 TTGTGTCTTGGGTAGGAGGTAGG + Intronic
1079952186 11:26819359-26819381 CTGTTGGTGGGGGACGTGGTGGG - Intergenic
1081296183 11:41392536-41392558 GTTTGTTTGGGGGAGGTGGTGGG - Intronic
1082317629 11:50749160-50749182 CTGGGGTTGGGGGAGGGGGTAGG + Intergenic
1082628477 11:55513544-55513566 CTGCTTCTGGGGGAGGGGGGTGG - Intergenic
1083342300 11:61966875-61966897 CTGTGTGTGGCGGAGCTGCTGGG - Intronic
1083389233 11:62335959-62335981 CTGAGGCTGGGGAAGGTGGCTGG - Intergenic
1083655867 11:64229369-64229391 CTGGGTCTTGGGAAGGTGGGTGG + Intronic
1083894487 11:65613386-65613408 CTGCGGCTGGAGGAGGTGATCGG - Exonic
1083989631 11:66239000-66239022 TGGTGGCTGGGGGAGGTGGAAGG + Intronic
1084028470 11:66467098-66467120 GCGTGTCTGGGGGTGGTGGAGGG + Intronic
1084035124 11:66504959-66504981 GTGTGTGTCGGGGGGGTGGTGGG - Intronic
1084043180 11:66554513-66554535 CTGGGTCGGGGGGAGGTGGGAGG - Intronic
1084057232 11:66643379-66643401 CAGTGTCTGGGGTAGGGGCTGGG + Intronic
1084180348 11:67442906-67442928 GTGTGTCGGGGGCAGGAGGTGGG + Intronic
1084194462 11:67516557-67516579 CTGAGGCCTGGGGAGGTGGTGGG + Intergenic
1084289852 11:68155622-68155644 CTGTGTCTGGAGGTGCTGGAGGG - Exonic
1084509084 11:69591898-69591920 CTGTTTCAGGAGGAGATGGTGGG - Intergenic
1084805004 11:71572688-71572710 GTGGGTCTGGGGATGGTGGTGGG - Intergenic
1084963481 11:72730689-72730711 CTGTTTTTGGGGGAGGCGGGAGG - Intronic
1085048288 11:73365925-73365947 CTGTGTCTGGGGGAGGTGGTGGG - Exonic
1085634664 11:78149276-78149298 CTGTCTCTGGGGGAGCAGGGAGG - Intergenic
1085689262 11:78652197-78652219 CAGTGACTGGGGGTGGTGGTGGG + Intergenic
1086064451 11:82731903-82731925 CTGTGGCTGAGGGAGGAGGCCGG - Exonic
1087308219 11:96508322-96508344 GTGTGTTTGGGGGTGGGGGTGGG + Intergenic
1088697606 11:112381811-112381833 CTGACTCTGGGGCGGGTGGTGGG + Intergenic
1089081259 11:115777927-115777949 ATGTGGCTGGTGGTGGTGGTGGG + Intergenic
1089123819 11:116162214-116162236 CTGTGGCTGGGAGCGGGGGTGGG + Intergenic
1089606371 11:119643817-119643839 CAGTGTCGGGGGGTGGGGGTGGG + Intronic
1089628734 11:119770250-119770272 CAGGGGCTGGGGGAGGTGCTTGG + Intergenic
1089689982 11:120181115-120181137 ATGTGTCTGGGGGAGCAGGATGG + Intronic
1090202012 11:124864025-124864047 CTAGGTGTGGGGGAGGGGGTAGG - Intergenic
1090356011 11:126140764-126140786 CTGTTTCTTGGGGAGGTAGTAGG + Intergenic
1090406879 11:126481503-126481525 GGGTGTCTGGGAGAGGCGGTGGG - Intronic
1090664042 11:128903124-128903146 CTGGGTTTGGGGGACATGGTAGG - Intronic
1090909225 11:131104066-131104088 CTGTGTCTGTGCAAGGTGGGTGG - Intergenic
1091017603 11:132066874-132066896 GTGTGTTTGGTGGAGGAGGTTGG - Intronic
1091321779 11:134656982-134657004 CTGTGAGTGTGGGAGGTGCTCGG + Intergenic
1092504776 12:9086282-9086304 CTGTGGGTGGCTGAGGTGGTAGG + Intronic
1092797260 12:12124632-12124654 CTGTGGCTGGGGATGGTGGAGGG + Exonic
1094251041 12:28361865-28361887 CTGTGTGTGTGGGAGGGGGGCGG + Intronic
1095962644 12:47845069-47845091 CTGTGTGGGTGGGGGGTGGTGGG - Intronic
1096412980 12:51390811-51390833 CTGTGTATGGGGGTGGAGGGTGG - Intronic
1096567732 12:52495357-52495379 ATGTGTGTGGGGGAGGAGGGTGG + Intergenic
1096796047 12:54078192-54078214 GTGTCTCAGGGTGAGGTGGTGGG + Intergenic
1097802375 12:63928652-63928674 CTGGGGGTGGGGGCGGTGGTGGG + Intronic
1097966463 12:65586829-65586851 CTGTGTCTGGGCTAGGTTCTGGG + Intergenic
1098346973 12:69515883-69515905 CAGTGTGTGGGGGTGGGGGTGGG - Intronic
1100505395 12:95215586-95215608 CTGTGTCTAGCCGAGTTGGTTGG - Intronic
1100824781 12:98464429-98464451 CTGAGTGTGGGGGTGGGGGTGGG - Intergenic
1101070482 12:101069905-101069927 TAGTGTCTGTGGGAGGTGATGGG + Intronic
1101482061 12:105107775-105107797 CTGTGTCTGTGGGAGGCGCCGGG + Exonic
1101905320 12:108820437-108820459 CTGTGACTCGGGTAGATGGTGGG - Intronic
1102790445 12:115639862-115639884 CTGTAGCTGGGAGAGGCGGTGGG - Intergenic
1102934007 12:116881856-116881878 TTTTGTTTGGGGGAGGTGGGTGG + Intergenic
1103772461 12:123338719-123338741 CTGGGTGTGGTGGTGGTGGTGGG + Intronic
1104058297 12:125246906-125246928 GGGTTTGTGGGGGAGGTGGTGGG + Intronic
1105299262 13:19117932-19117954 CTGTCTCTGGGGGCAGGGGTTGG - Intergenic
1105833045 13:24182629-24182651 CGGGGCCTGGGGGAGGTGTTTGG - Intronic
1106723661 13:32462443-32462465 CTGTGTGTGGGTGAGTGGGTGGG + Intronic
1106813239 13:33380472-33380494 TTGTGTGTGGGGGGGGTGGGGGG - Intergenic
1106912375 13:34476632-34476654 CTGTGTGTGTGGGAGGGTGTAGG - Intergenic
1107108688 13:36673744-36673766 GTGTGTCGGGGGGAGGAGGGGGG - Intergenic
1109013346 13:56977023-56977045 GTGTGTGTGGGTGTGGTGGTAGG + Intergenic
1109358001 13:61257438-61257460 CTGTGTATGTGGGAGGGGGGTGG - Intergenic
1109797223 13:67331635-67331657 CAGTGTCTGGAGGTTGTGGTGGG - Intergenic
1110542546 13:76722184-76722206 CAGTTTCTTGGGGAGGTGGAAGG - Intergenic
1110697417 13:78507673-78507695 ATGTGACTGGGGGTGGCGGTGGG - Intergenic
1111165763 13:84455524-84455546 CTGTGGCTGGTGTAGGTGATGGG + Intergenic
1111649314 13:91069202-91069224 GTGTGTCTGGGTGGGGTGGGGGG + Intergenic
1111721828 13:91956023-91956045 CAGTGGCTGGGGAGGGTGGTTGG - Intronic
1112298229 13:98207895-98207917 GTGTGTGTGGAGGTGGTGGTCGG - Intronic
1112503159 13:99957373-99957395 GTGTGTGTGGGGGGGGTGGTAGG + Intergenic
1113849142 13:113408022-113408044 CTGGGTCTGGGGCTGGTGGCTGG + Intergenic
1113873712 13:113581381-113581403 TTGTGTCTGGGGGTGGTGGGGGG + Intergenic
1113879028 13:113612339-113612361 CCCTGTCAGAGGGAGGTGGTGGG + Intronic
1114083300 14:19219695-19219717 CTGTGCATGGGGGAGTTGTTGGG - Intergenic
1114231360 14:20785863-20785885 CTGTGGCTGAGGCAGGTGGCTGG + Intergenic
1114382995 14:22228196-22228218 ATTTGTCTGGGGTAGGAGGTGGG - Intergenic
1114492643 14:23113048-23113070 GTGTGTGTGGTGGTGGTGGTGGG + Intergenic
1114517708 14:23310577-23310599 GTATTTCTAGGGGAGGTGGTAGG + Exonic
1115475506 14:33809523-33809545 TTTTGTTTGGGGGAGGTGGGGGG - Intergenic
1116616509 14:47147502-47147524 CTGTTGATAGGGGAGGTGGTCGG - Intronic
1116857571 14:49966501-49966523 CTGAGTTTGGGGGCTGTGGTGGG + Intergenic
1116917814 14:50542279-50542301 TGGTGTCGGGGGGAGGGGGTTGG + Intronic
1118255955 14:64205974-64205996 ATGTGTCTGTGGGAGGGGCTTGG - Intronic
1118263098 14:64266886-64266908 CTCTGTCTGGGGGCGGGGGGAGG - Intronic
1118311718 14:64698500-64698522 CTGTATCTGCGGGTGGCGGTGGG + Intergenic
1118705689 14:68478205-68478227 CTGTGTCAGAGGGAGGTCGATGG + Intronic
1119140758 14:72265364-72265386 CTGTGTCTGAGCCAGGTGGCAGG - Intronic
1119378587 14:74214466-74214488 CAGTGTCTGGGGACAGTGGTGGG - Intergenic
1119484113 14:74977307-74977329 ATGGGGCTGGTGGAGGTGGTCGG + Intergenic
1119730841 14:76950286-76950308 GTGTGTAGGGGGCAGGTGGTGGG + Intergenic
1119915595 14:78398424-78398446 CTCTGTCGGGGAAAGGTGGTTGG + Intronic
1120121321 14:80682980-80683002 GTGTGTTTGGTGGGGGTGGTGGG - Intronic
1120215666 14:81679095-81679117 CTGTGTCTAGCTGAGCTGGTGGG - Intergenic
1120701700 14:87705489-87705511 GGGTGTCTGGGGGATGTGGGAGG + Intergenic
1121103819 14:91267801-91267823 ATGTGTATGGGGCAGGTGTTGGG + Intergenic
1121547532 14:94772873-94772895 CCTTGTCTGGGGGCGGAGGTGGG - Intergenic
1121587242 14:95070709-95070731 TGGTTTCTGGAGGAGGTGGTGGG - Intergenic
1121640332 14:95480991-95481013 CTGTGCCTGGGGTCGGGGGTGGG - Intergenic
1121791737 14:96704305-96704327 CTGTGAGTGGTGGTGGTGGTGGG + Intergenic
1122352386 14:101103601-101103623 CTGTGTGTGGGGCATGTGGAAGG + Intergenic
1122352425 14:101103788-101103810 CTGCCTCTGGGGGAGGCGGAGGG - Intergenic
1122981940 14:105196018-105196040 CTGGGTCTCTGGGAGCTGGTGGG - Intergenic
1202894916 14_GL000194v1_random:1464-1486 CTGTGCATGGGGGAGTTGTTGGG - Intergenic
1123507659 15:20960920-20960942 CTGTGTCTGGGAGATGAGATTGG - Intergenic
1123564882 15:21534663-21534685 CTGTGTCTGGGAGATGAGATTGG - Intergenic
1123601139 15:21971954-21971976 CTGTGTCTGGGAGATGAGATTGG - Intergenic
1124343950 15:28908944-28908966 CGGGGGCTGGGGGAGGTGGAAGG - Intronic
1124346272 15:28923558-28923580 CTGAGTCTGGGGGAGGTGTGGGG + Intronic
1124364763 15:29063754-29063776 TCGGGTCTGGGGGAGGTGGGTGG + Intronic
1124940645 15:34214324-34214346 CAGTTGCTGGTGGAGGTGGTGGG + Intergenic
1125183983 15:36909842-36909864 GTGTGTGTGGGGGTGGGGGTGGG + Intronic
1125751245 15:42030575-42030597 CTGTGTGAGAGGGAGATGGTGGG + Intronic
1125951150 15:43753082-43753104 CTCTGTCTCGGGGTGGGGGTGGG - Intronic
1126437068 15:48646574-48646596 CTGTGTGTGGGGGAGGGCGAGGG - Intergenic
1126673518 15:51137397-51137419 CTGTGTGTGGGGGCAGTGTTGGG + Intergenic
1127951743 15:63814439-63814461 TTGTGGGTGGGGGAGGGGGTTGG + Intronic
1128016901 15:64355912-64355934 GTGTGTCTGAGGGGGTTGGTGGG - Intronic
1129659447 15:77544813-77544835 TTCTGGCTGGGGGAGGTGGGAGG - Intergenic
1129843682 15:78758572-78758594 CTGTAGCTGGGGCTGGTGGTGGG + Intergenic
1130044512 15:80433530-80433552 CCGAGGCGGGGGGAGGTGGTGGG - Intronic
1130662968 15:85845150-85845172 ATGTGGCTGGGGGAGGTGGCGGG + Intergenic
1130749756 15:86698478-86698500 CTGTGTATGGGGGTGCAGGTGGG - Intronic
1130890005 15:88125684-88125706 CTGTGGCAGGGTGGGGTGGTGGG - Intronic
1130968424 15:88714379-88714401 CAATGTCAGGGGCAGGTGGTGGG - Intergenic
1131062234 15:89411201-89411223 CTCTGCCTGGGGTAGGTGGGAGG + Intergenic
1131385241 15:92000904-92000926 CTGAGTCTGGGGTAGTTGGAGGG + Intronic
1131636284 15:94236218-94236240 CTGTGGCCTGGGGAGGTGCTTGG - Intronic
1202973247 15_KI270727v1_random:261773-261795 CTGTGTCTGGGAGATGAGATTGG - Intergenic
1132616379 16:842924-842946 CCCTGTCTGGTGGAGGTGGATGG - Intergenic
1132910225 16:2306484-2306506 CTGGGTCTGTGGAAGGAGGTGGG - Intronic
1132991517 16:2798178-2798200 CTGGTGCTGGAGGAGGTGGTGGG + Intergenic
1133255365 16:4513103-4513125 CTTTGTCTGGTGCAGGTGGCAGG - Intronic
1133461554 16:5990632-5990654 CGGTGTATGGGGAAGGTGGGTGG + Intergenic
1133467003 16:6036990-6037012 CTGTGTGTGTTGGAGGTGGGGGG + Intronic
1134323085 16:13181504-13181526 ATGTGTCTGGAGAAGTTGGTAGG + Intronic
1134447712 16:14343467-14343489 CTGGGGTTGGGGGAGGGGGTAGG - Intergenic
1136269820 16:29141820-29141842 CTGTGGCATGGGGGGGTGGTGGG + Intergenic
1136280874 16:29210459-29210481 CTGGGCCTGGGGGAGCTGGCTGG + Intergenic
1136544404 16:30947587-30947609 CAGGGGCTGGGGGAGGTGGAAGG + Exonic
1136584216 16:31173557-31173579 CTGAGTCTGGGGCAGGGGGGTGG - Intergenic
1136683404 16:31980860-31980882 CTGTGGCTGGGGGAGATGCTGGG + Intergenic
1136692787 16:32047788-32047810 GTGTGTGTGGGGGGGGTGGTTGG + Intergenic
1136784035 16:32924416-32924438 CTGTGGCTGGGGGAGATGCTGGG + Intergenic
1136793283 16:32991013-32991035 GTGTGTGTGGGGGGGGTGGTTGG + Intergenic
1136885747 16:33929390-33929412 CTGTGGCTGGGGGAGATGCTGGG - Intergenic
1138277212 16:55743737-55743759 GTGGGTGTGGGGGAGGTGGTCGG + Intergenic
1138529340 16:57626714-57626736 GTGTGTGTGGTGGTGGTGGTGGG + Intronic
1139545697 16:67648588-67648610 CAGGATCTGGGGGAGGTTGTGGG - Intronic
1139651350 16:68363749-68363771 CTGGGGCTGGGGGAGGAGGATGG - Intronic
1139952086 16:70677435-70677457 CTGGGTCTAGGGGAGGGGATGGG + Intronic
1140027432 16:71303439-71303461 CTGTGGCTGGGGGCGGTGGGGGG - Intergenic
1141786119 16:86201901-86201923 GGGTGGCTGGGGGAGGTGGCAGG + Intergenic
1142085230 16:88176381-88176403 CTGGGCCTGGGGGAGCTGGCTGG + Intergenic
1142200024 16:88756617-88756639 ATGTATCTGGGTGTGGTGGTGGG + Intronic
1142347234 16:89561563-89561585 CTGGTTCTGGGGCAGGTGGCCGG + Exonic
1203086690 16_KI270728v1_random:1188418-1188440 CTGTGGCTGGGGGAGATGCTGGG + Intergenic
1203095542 16_KI270728v1_random:1252704-1252726 GTGTGTGGGGGGGGGGTGGTTGG + Intergenic
1143060426 17:4196033-4196055 CTGTGTGGGTGGGGGGTGGTGGG - Intronic
1143136416 17:4714968-4714990 CTGAGTCTGAGGGAGGCAGTGGG + Intronic
1143250119 17:5517352-5517374 CTGTGTATGTGGGAGGGGGGGGG - Intronic
1143304360 17:5934037-5934059 CTGAGTCTGGGGGAGCTTCTTGG + Intronic
1143513557 17:7408271-7408293 CTGTGTCTGGTGGGGCTGGCGGG + Exonic
1143527243 17:7479656-7479678 CTGTTTCCGGGGGTGGGGGTGGG - Intronic
1143594770 17:7907584-7907606 CTGTGGCTGTGGGAGGGGGTAGG - Exonic
1143652202 17:8270186-8270208 CTGTTTCTGATAGAGGTGGTTGG + Exonic
1143761988 17:9111419-9111441 GTGTGTGTGGTGGTGGTGGTAGG + Intronic
1143837662 17:9704758-9704780 GAGTGCCTGGGGGAGGTGGGGGG - Intronic
1145078731 17:19876750-19876772 CTGCCTCTCGGGGATGTGGTAGG + Intergenic
1145781210 17:27564743-27564765 CTGTGGGTGGGGGAGGTGGGGGG - Intronic
1147262583 17:39217289-39217311 CTGTGTGAGGGGTAGGTGCTGGG - Intronic
1147647646 17:42043426-42043448 CTGTGTGTGGGGGAGGCAGGGGG - Intronic
1147850016 17:43435188-43435210 CAGTGTCAAGGGGAGGTGGATGG + Intergenic
1147864804 17:43545410-43545432 CTTAGTCTGGGGGACGAGGTTGG + Intronic
1148458989 17:47826980-47827002 CTGAGTCTGGTGGGGGTGGGGGG + Intronic
1148839186 17:50483824-50483846 ATGTGTGTGGGGGGGGTGGCAGG - Intronic
1148898713 17:50858231-50858253 CTGGGTCAGGGGGAGGGGGATGG - Intergenic
1149361404 17:55899374-55899396 GTATGGCTGGTGGAGGTGGTGGG - Intergenic
1150317150 17:64178548-64178570 CTGTGTGTGGCGGTGGGGGTGGG + Intronic
1150481983 17:65517755-65517777 CTGGGTGTGGAGGGGGTGGTAGG - Intergenic
1150486028 17:65544382-65544404 GTGTGTGTGGTGGTGGTGGTGGG - Intronic
1151309213 17:73283288-73283310 CTTTTTGTGGGGGAGGGGGTTGG - Intergenic
1151574157 17:74943239-74943261 CAGGGGCTGGTGGAGGTGGTGGG - Intronic
1152308633 17:79535884-79535906 CAGTGGCTGGGGGAGGTGCAGGG - Intergenic
1152345374 17:79747916-79747938 CTGTGTCTGGGTGGGGGGATGGG - Intergenic
1152391906 17:80008470-80008492 TTGTGTCTCAGAGAGGTGGTGGG - Intronic
1152531894 17:80923624-80923646 CCGTGTCCGGGGGAACTGGTGGG - Exonic
1152604938 17:81284797-81284819 CAGTGTCTGGGTGCGGGGGTGGG + Intronic
1152790337 17:82275223-82275245 TTGTGGCTGGGGCTGGTGGTGGG - Intergenic
1152791404 17:82282386-82282408 CTGGGTCTGGGGCAGGGGGTAGG - Intergenic
1153052042 18:908693-908715 CTGTTTCTGGGGGAGGGGAAAGG + Intronic
1153291593 18:3507018-3507040 GTGTGTATGGGGCAGGGGGTGGG + Intronic
1154143902 18:11850188-11850210 CTTTGACTGGCGGAGGTGGAGGG + Intronic
1154177074 18:12092764-12092786 GGGTGTCTGGTGCAGGTGGTTGG + Intergenic
1154499984 18:14991358-14991380 CTGTGCATGGGGGAGTTGTTGGG - Intergenic
1156541317 18:37913738-37913760 CTGTGGCTGAAGGAGGTGGATGG - Intergenic
1156564151 18:38164508-38164530 CTGTCTCAGGAGGTGGTGGTGGG + Intergenic
1156864337 18:41872389-41872411 CTAAGTCTGGAGGATGTGGTGGG - Intergenic
1157331995 18:46710890-46710912 CAGTGTCTGGGGGTGGGGATGGG - Intronic
1157471127 18:47989758-47989780 GTGTGGCTGGTGGAGGTGGCGGG + Intergenic
1157742892 18:50109098-50109120 CTGTGGATAGGGGAAGTGGTGGG - Intronic
1158480340 18:57816446-57816468 ATGGGTCTGAGGGAGGTGCTAGG - Intergenic
1158662000 18:59396610-59396632 GTGTGTGTGGTGGTGGTGGTGGG + Intergenic
1158734344 18:60062646-60062668 CTGTGTCTGGTGGTGGTTCTTGG + Intergenic
1159603019 18:70446480-70446502 GTGTGTGTGGCGGAGGGGGTGGG + Intergenic
1159937511 18:74380960-74380982 CTGTGTCTGGCAGTGGCGGTGGG + Intergenic
1160598209 18:79992444-79992466 CTGGGCCTGGGGGTGATGGTTGG - Intronic
1160665328 19:325487-325509 CTGTGGCTGGAGGAGGTGGGAGG - Intronic
1160681973 19:416017-416039 CTGTGTTTGTGGGAGGAGCTGGG + Intergenic
1160807431 19:998644-998666 CTGGGTCTGCGAGAGGTGCTGGG - Intergenic
1160857453 19:1223934-1223956 CTGTTTCAGCGGGAAGTGGTGGG + Intronic
1160896265 19:1403475-1403497 CAGTGCCTGGGGGAGGTGCAGGG + Intergenic
1161245383 19:3249043-3249065 CTGTGTGGTGGGGAGGGGGTAGG - Intronic
1161256799 19:3314246-3314268 CTGTCCCTGATGGAGGTGGTGGG + Intergenic
1161374218 19:3930985-3931007 CAGGGGCTGGGGGAGGTGGGTGG - Intergenic
1161447478 19:4326769-4326791 GTGTGTGTGGGGGAGGGGGCGGG - Intronic
1161557827 19:4954520-4954542 TTGTGTGTGGGGGAGCAGGTGGG + Intronic
1161845452 19:6709613-6709635 CTGGGGCTGGGGGAGGTGGGTGG - Intronic
1161937835 19:7382968-7382990 CTGTGACTGGGGCTGGTGGTGGG + Intronic
1162015131 19:7841521-7841543 CTGTGTTTGGGGGTTGTGGGGGG - Intronic
1162068257 19:8138454-8138476 CTGTGACAGGGGCAGGTGCTGGG - Exonic
1162107263 19:8377532-8377554 ATGTCTCTTGGGGAGGTGGTGGG + Intronic
1162425742 19:10594352-10594374 CTGTGCCAGGTGGGGGTGGTTGG - Intergenic
1162523544 19:11195111-11195133 CTGGGTCGGGGGGAAGGGGTAGG + Intronic
1162729753 19:12711265-12711287 CCCTGCCTGGGGGTGGTGGTGGG - Intronic
1162966040 19:14156559-14156581 GTGTGTGTGGGGGGGGTGGGGGG + Intronic
1163035694 19:14567657-14567679 CTGGGTCTGAGGGAGGCGGTGGG - Intronic
1163115220 19:15185080-15185102 CTGGGGTTGGGGGAGGTGGGGGG - Intronic
1163430124 19:17262497-17262519 CTCTGTCTGAGGGAGGAGGTGGG - Intronic
1163698820 19:18777154-18777176 CTGTCACTGGGGGATGGGGTGGG - Exonic
1164380318 19:27730991-27731013 TTGTGTGTGGGGGGGGTGGGGGG - Intergenic
1164419739 19:28078472-28078494 ATTTGTCTTGGGGTGGTGGTAGG - Intergenic
1164681439 19:30136263-30136285 CTCTGTTTGGGGGAGTTGGAAGG + Intergenic
1164830078 19:31313603-31313625 GGGTGTCTGGGAGAGGTGGATGG - Intronic
1164836520 19:31358362-31358384 AAGGGTCTGCGGGAGGTGGTCGG + Intergenic
1165476237 19:36032573-36032595 CTGGGCCTGGGGGAGGTGGCAGG - Intronic
1165727987 19:38125536-38125558 CTGAGACTGGGGGTGGGGGTGGG - Intronic
1165742215 19:38211133-38211155 CTGCAGGTGGGGGAGGTGGTGGG - Intronic
1165897402 19:39151031-39151053 CTGTGGCCGGAGCAGGTGGTTGG + Intronic
1166105074 19:40594088-40594110 CTTATTCTGGGGGAGGGGGTGGG + Intronic
1166109315 19:40612974-40612996 GGGTGTCTGGGGGAGGTGGTGGG - Intronic
1166289960 19:41856654-41856676 CATTAGCTGGGGGAGGTGGTGGG - Intergenic
1166409500 19:42547167-42547189 CTGTGTCTGGGGGAAGGGGCTGG + Intronic
1166750894 19:45163527-45163549 CTGAAGGTGGGGGAGGTGGTGGG + Intronic
1166871559 19:45873895-45873917 CTGCCTCTGGGGGAGGAGTTGGG + Intergenic
1166943616 19:46383907-46383929 CTGCGGCTGGGGGTGGAGGTGGG - Intronic
1167087641 19:47321052-47321074 GTGTGTGTGGGGGGGGTGGGGGG - Exonic
1167249255 19:48391928-48391950 CTGGGTCTAGGGGAGGAAGTAGG - Intergenic
1167249323 19:48392142-48392164 CTGGGTCTGAGGGAGGAGGCTGG - Intergenic
1167249336 19:48392177-48392199 CTGGGTCTGAGGGAGGAGGCTGG - Intergenic
1167276689 19:48544036-48544058 CTGGGTCTGAGGGAGGAGGCTGG - Intergenic
1167276740 19:48544182-48544204 CTGGGTCTGAGGGAGGAGGCTGG - Intergenic
1167314752 19:48756787-48756809 CTGGGTCTGAGGGAGGAGGTAGG + Intronic
1167386839 19:49168468-49168490 CTGGGTCTGAGGGAGGAGGAGGG + Intronic
1167425427 19:49427636-49427658 CTGAGTCTGAGGGAGGGGCTGGG + Intronic
1167441704 19:49512910-49512932 CTGGGTCTGAGGGAGGAGGGAGG + Intronic
1167688154 19:50969148-50969170 CTGAGTCTGAGGGAGGAGGTGGG + Intronic
1167741036 19:51325232-51325254 CTGGGTCTGAGGGAGGAGGAGGG + Intronic
1167752122 19:51387615-51387637 CTGGGTCTGAGGGAGGAGGATGG + Intronic
1168077687 19:53990392-53990414 CTGGGTCTGAGGGAGGAGGAGGG - Intergenic
1168155763 19:54472511-54472533 CTGGGTCTGAGGGAGGAGGAAGG - Intronic
1168253561 19:55154967-55154989 CTGGGTCTGAGGGAGGAGTTGGG + Intronic
1168266229 19:55225223-55225245 CTGAGTCTGAGGGAGGAGCTGGG - Intergenic
1168277135 19:55284483-55284505 GTGGGGGTGGGGGAGGTGGTAGG - Exonic
1168277401 19:55285273-55285295 CTGAGTCTGAGGGAGGAGGGCGG + Intronic
1168325498 19:55536766-55536788 CTGGGTCGGAGGGAGGTGGGTGG - Intronic
1168325667 19:55537321-55537343 CTGAGTCTGAGGGAGGAGGAGGG - Intergenic
1168419808 19:56194158-56194180 CAGGGGCTGGGGGAGGGGGTTGG - Intronic
1168422280 19:56212417-56212439 CTGTGTCTGGAGAAGGATGTTGG - Intergenic
1168590757 19:57632814-57632836 CTGTCTCTGGGGCAAGAGGTCGG + Intronic
1168627942 19:57933850-57933872 CTGTGTTTGAGGGAGGAGGAAGG - Exonic
924999312 2:392429-392451 CTGTGGCTGGTGGAGGTGGGAGG + Intergenic
925230669 2:2231007-2231029 CTGAGTCTGGGGGTGGGGGCTGG - Intronic
925291018 2:2748788-2748810 CTGTGGCTGGAGGAGGAGCTGGG + Intergenic
925366811 2:3316260-3316282 CTGGGTGTGGTGGAGGGGGTGGG - Intronic
925648358 2:6061612-6061634 CTCTGGCTGGTGGAGGAGGTGGG + Intergenic
925675895 2:6360679-6360701 CTGTGTCTGCAGGAGGAGATCGG + Intergenic
926137640 2:10347691-10347713 CTGTGTCTGCGGGGCGGGGTTGG + Intronic
926209134 2:10856132-10856154 GTGTGTTGGGGGGGGGTGGTGGG + Intergenic
926705349 2:15833627-15833649 CTGTGTCTGGACGTGCTGGTTGG + Intergenic
927489556 2:23511821-23511843 GTGTGGCTGGTGGGGGTGGTGGG + Intronic
928230904 2:29498251-29498273 CTGGGTTTGGGGGAGGAGGTTGG + Intronic
928275682 2:29898149-29898171 CTGGGGCTGGGGAAGGTGGCAGG - Intronic
929250527 2:39749755-39749777 GTCTGTCAGGGGGAGGTGGGAGG - Intronic
929508423 2:42547094-42547116 CTGTCTCTGGGGGAGGGGCCAGG - Intronic
929536583 2:42787933-42787955 TTGTGGCTGGGGCAGGTGGGAGG - Intronic
930027563 2:47038646-47038668 CTGTGTGTCGGGGGGGTGGGTGG - Intronic
930058460 2:47269903-47269925 GTGTGTGTGGTGGGGGTGGTGGG - Intergenic
930091499 2:47534518-47534540 CTGTGTGTGGGGGCGGGGGGGGG - Intronic
931544312 2:63364545-63364567 ATGTGTCTTGGGGAAGAGGTAGG - Intronic
931869332 2:66441946-66441968 AGGAGTCTGGAGGAGGTGGTGGG + Intronic
932140566 2:69273670-69273692 GTGTGGGTGGGGGAGGAGGTGGG - Intergenic
932424125 2:71618587-71618609 GTGTGTGTGGTAGAGGTGGTGGG + Intronic
932448250 2:71793831-71793853 TTGTGTCAGGTGGAGGGGGTTGG - Intergenic
932617659 2:73244963-73244985 CTGTGTCAGTGGGTGGTGGAGGG + Intronic
932738375 2:74272186-74272208 GTGTGTCTGGGGTAGTAGGTGGG + Intronic
932751324 2:74373498-74373520 CTGGTTCTGGGGAAGGGGGTTGG - Intronic
933281096 2:80333628-80333650 TTTTTTCTGGGGGAGGTGGTGGG + Intronic
935175386 2:100644199-100644221 TTGTGTCTGCGGGAGGAGGAAGG + Intergenic
935589800 2:104835828-104835850 CAGGGTGTGGGGGAGGTGGGGGG + Intergenic
935593899 2:104864692-104864714 CTTGGTCTTGGGGAGGAGGTGGG + Intergenic
935693962 2:105754617-105754639 GTGTGTCTGTGGGAGGTTGGGGG + Intronic
935796294 2:106644603-106644625 CTGTGGCTGAGTGTGGTGGTGGG + Intergenic
936724364 2:115294888-115294910 CTGTGTCGGGAGGAGGGGTTGGG - Intronic
937227546 2:120378442-120378464 CTCTGACTGGGGTAGGGGGTAGG + Intergenic
937356160 2:121199405-121199427 TTGTGACTGGTGGAGGTGGGGGG + Intergenic
937680725 2:124641273-124641295 CTGAGGCTGGGGGAGGTGATAGG + Intronic
937815631 2:126247703-126247725 CTTTTTCTGGGGCAGCTGGTGGG + Intergenic
938287254 2:130128595-130128617 CTGTGGCTGGGTCAGGTTGTGGG - Intronic
938428342 2:131210274-131210296 CTGTGGCTGGGTCAGGTTGTGGG + Intronic
938469246 2:131544278-131544300 CTGTGGCTGGGTCAGGTTGTGGG + Intergenic
938493284 2:131776936-131776958 CTGTGCATGGGGGAGTTGTTGGG + Intergenic
938499198 2:131821717-131821739 CTGTGCATGGGGGAGTTGTTGGG - Intergenic
939019280 2:136939862-136939884 GTGTGTCGGGGGGTGGTGGTAGG - Intronic
939046864 2:137259941-137259963 GTGTGTGTGGTGGAGGTTGTAGG + Intronic
939630681 2:144523733-144523755 GTGTGTGTGGAGGAGGTGGGGGG + Intronic
940237842 2:151529967-151529989 TTCTGTCTGGGTGAGCTGGTAGG - Intronic
942813733 2:180026717-180026739 AGGGGTCTGGGGGAGGTGATTGG - Intergenic
942889133 2:180965537-180965559 CTGTGTCAGGGGGTGGGGGTAGG + Intergenic
942926154 2:181435001-181435023 CTTTTTTTGGGGGCGGTGGTGGG - Intergenic
943240917 2:185382844-185382866 CTGTGTGTGTGGGAAGGGGTGGG - Intergenic
943942840 2:194020893-194020915 CTGTGTCTAGCTGATGTGGTGGG + Intergenic
945358805 2:208870751-208870773 CTGTTTTTGGGGGTGGGGGTGGG + Intergenic
946139785 2:217680483-217680505 GTGTGTCAGGGGGAGGTGAGAGG + Intronic
946632672 2:221687679-221687701 CTGTCTCTGGGGGATGAGGAAGG + Intergenic
947024362 2:225720231-225720253 GTGTGTTTTGGGGGGGTGGTAGG - Intergenic
947049886 2:226030642-226030664 CTGTGTGTGGGGGGTGGGGTGGG + Intergenic
947446132 2:230163939-230163961 CTGTATCTTGGGCAGGGGGTGGG - Intergenic
947694107 2:232168679-232168701 CTATGTGTGGGTCAGGTGGTAGG - Intronic
947743686 2:232496882-232496904 CTGAGGCTGGGGGCGGTGGGTGG - Intergenic
947864450 2:233386539-233386561 CTGTCTCTAGGGGAGGGGGTGGG + Intronic
948465061 2:238148295-238148317 CTGGGGCTGGGGGTGGGGGTGGG + Intronic
948789514 2:240370086-240370108 CTGTGTCTGGGGGAGGAGGGTGG + Intergenic
948856121 2:240731516-240731538 CGCTGTCTGGTGGAGGTGGTGGG - Intronic
948859087 2:240744234-240744256 GTCTGTCTGGGGCACGTGGTGGG - Intronic
1169198625 20:3696957-3696979 CTGTGTGTGTGGCAGGAGGTGGG - Intronic
1169390502 20:5186624-5186646 CTGTGTCTGGGCTGGATGGTTGG + Intronic
1169569918 20:6894979-6895001 CTGTGTCTGGGGGTGGGGAGGGG + Intergenic
1169652789 20:7888347-7888369 TTGTGTTTGGGGGAGGGGTTGGG - Intronic
1170878401 20:20272595-20272617 CTGTGCCTGAGGGAGGTGTTGGG - Intronic
1171203075 20:23257272-23257294 CAGGGTCTGGGGGAAGTGGGAGG - Intergenic
1171232495 20:23498855-23498877 CTGTGTCTGGGGTAGAGGGACGG - Intergenic
1172093353 20:32448590-32448612 CTGTGCCTGAGTGAGGTGGAGGG + Intronic
1172171966 20:32941690-32941712 CTGAGGCTGGGGGAGGGAGTTGG + Intronic
1172186078 20:33031782-33031804 CGGTGCTTGGGGTAGGTGGTAGG + Intronic
1172283744 20:33726309-33726331 GTGTGTGTGGGGGTGGTGGTGGG + Intergenic
1172780995 20:37437087-37437109 CTGGGTCTGGGAGTGGGGGTGGG - Intergenic
1172812871 20:37662472-37662494 CTAAGGCTGGGGGAGGTGGGAGG - Intergenic
1172820473 20:37728838-37728860 CTGTGTGTGAGGGAGGAGGTTGG + Intronic
1172841723 20:37906039-37906061 CTGTGTCTGGGGGTGGGGGGTGG + Intronic
1172934903 20:38613167-38613189 GTGTGTGTTGGGGACGTGGTGGG + Intronic
1172944795 20:38678836-38678858 CTGGGTGCAGGGGAGGTGGTGGG - Intergenic
1172966934 20:38842690-38842712 CTGTGCCTGGGGGTGGGGGAGGG - Intronic
1174513966 20:51076931-51076953 CTGTATCTGGGGGAGCAGGGGGG - Intergenic
1174672922 20:52324692-52324714 CTGAGCGTGGGGGAGGAGGTAGG - Intergenic
1175348718 20:58302481-58302503 CTGTGTGTGAGGGAGGGAGTGGG - Intergenic
1175378841 20:58548807-58548829 CAGTGTTTGGGGGAGGGGGTTGG - Intergenic
1175679921 20:60978557-60978579 CTGTGGCTGGGGGTGGGCGTAGG - Intergenic
1175703166 20:61155156-61155178 CTGTGTCTGGGTGTGCTGCTGGG - Intergenic
1175727803 20:61331620-61331642 GTGGGTCTGGGGCAGGAGGTGGG - Intronic
1175781699 20:61686932-61686954 CTGGGTCGGGGGGCGGGGGTTGG - Intronic
1175992821 20:62797853-62797875 CTGTGGCAGCAGGAGGTGGTGGG + Intronic
1176034881 20:63031379-63031401 CTGGGGCTGGGGGAGGAGGGAGG + Intergenic
1176058745 20:63162555-63162577 CTCTGTCTGGGGTAGGGGGTGGG - Intergenic
1176233922 20:64045444-64045466 CTGTGTCTGTGGGAGTTGCCGGG + Intronic
1176312087 21:5157113-5157135 CTGTGCTTGCGGGAGGCGGTGGG - Intergenic
1176614620 21:9017451-9017473 CTGTGCATGGGGGAGTTGTTGGG - Intergenic
1176710596 21:10146422-10146444 CTGTGCATGGGGGAGTTGTTGGG + Intergenic
1177225157 21:18244703-18244725 CCGTGTTTAGGGGAGGTGCTGGG + Intronic
1178195065 21:30335322-30335344 CTTGGTATGGGGGAGGTAGTGGG - Intergenic
1178462185 21:32812369-32812391 CTGTGTCTGTGGGAGCTAATAGG - Intronic
1178690588 21:34746587-34746609 CTCTGGCTGGGGGAGGAGGGTGG + Intergenic
1179032998 21:37736274-37736296 CTGAGTCTGGGGGTGAGGGTGGG + Intronic
1179236696 21:39553822-39553844 CTGTTTAAGTGGGAGGTGGTTGG + Intergenic
1179483193 21:41691652-41691674 CTCTGCCTGGGGGAGCTGGAAGG - Intergenic
1179586301 21:42376020-42376042 CTGTGTCTGGAAGGGCTGGTGGG - Intronic
1179587755 21:42384495-42384517 CTGTGTGTGGGGGTGGGGGTAGG - Intronic
1179844961 21:44104917-44104939 CTGTGCTTGCGGGAGGCGGTGGG + Exonic
1179885943 21:44314333-44314355 CTGGGGCGGTGGGAGGTGGTTGG + Intronic
1180294675 22:10873572-10873594 CTGTGCATGGGGGAGTTGTTGGG + Intergenic
1180497481 22:15902986-15903008 CTGTGCATGGGGGAGTTGTTGGG + Intergenic
1181024989 22:20122980-20123002 TGGTGTCTGGGGGGTGTGGTGGG + Intronic
1181025001 22:20123018-20123040 TGGTGTCTGGCGGGGGTGGTTGG + Intronic
1181997158 22:26892046-26892068 GTGTGTGTGGGGGTGGGGGTGGG + Intergenic
1182367045 22:29786208-29786230 CTGTGCCTCTGTGAGGTGGTGGG - Intergenic
1182436557 22:30334523-30334545 CTGGGTCTGGGGCAGGGGGTGGG + Exonic
1183096102 22:35553212-35553234 CTGTGTGTGCAGAAGGTGGTGGG - Exonic
1183131480 22:35840652-35840674 GTGTGTAGGGGGGAGGAGGTAGG + Intronic
1183362287 22:37388977-37388999 CTCTTTCAGGGGGAGGTAGTGGG + Intronic
1183386477 22:37518327-37518349 CTGTGTCTGTGGGGGGTGTTGGG - Intronic
1183406046 22:37631159-37631181 CTCTGTCTGGGGAAGCTAGTGGG + Intronic
1183455818 22:37922490-37922512 GTGTGTCTGGGAGTGTTGGTGGG + Intronic
1183548026 22:38465710-38465732 CTCTGGCTTGGGGAGGAGGTGGG + Intergenic
1183749899 22:39713951-39713973 CTGGCTCTGGGGGAGGTGAGGGG + Intergenic
1184268893 22:43366283-43366305 GTGTGTCTGGGGTGGGTGGGCGG - Intergenic
1184467214 22:44675942-44675964 CTCTGTGTGGGCGAGGTGCTGGG + Intronic
1184854132 22:47137328-47137350 CTGAGGCTGGAGGGGGTGGTGGG + Intronic
1185328462 22:50239676-50239698 CCGTGTCTGGAGGAGTTGGGAGG - Intronic
950040793 3:9917900-9917922 CTGTGTGTGGAGGAGCGGGTGGG - Intronic
950160607 3:10757934-10757956 CTGGGTCTGGGAGGGGTGGAAGG + Intergenic
950490272 3:13300469-13300491 TTGGGTCTTTGGGAGGTGGTTGG - Intergenic
950520115 3:13493160-13493182 CTGTGGGTGGGGCAGGTGGGGGG - Intronic
950655383 3:14433200-14433222 TTCTCTCTGGGGGAGGTGGCGGG - Intronic
951204273 3:19909548-19909570 CTGGGGGTGGGGTAGGTGGTGGG + Intronic
951833127 3:26952008-26952030 GTTTCTCAGGGGGAGGTGGTTGG + Intergenic
952591065 3:34954253-34954275 CTGTGTATGGGGAAGGAGATAGG + Intergenic
952818967 3:37469382-37469404 CTGTGTGTGTGGTGGGTGGTAGG + Intronic
953413920 3:42704719-42704741 CTGTGTCTGAGGGGGGTGGCAGG + Intronic
953506478 3:43490789-43490811 GTGTGTGTGGGGGTGGTGCTGGG - Intronic
954380796 3:50218005-50218027 CTGTGGCTGGGAGTGGGGGTGGG + Intronic
954445182 3:50542486-50542508 CTGTGCCTGGGGGAGTGGGGGGG + Intergenic
954757362 3:52848586-52848608 CTGTTTGTGGGGGTGGTGGGAGG + Intronic
954945167 3:54417788-54417810 GTGTGTGTGGGGGGGGGGGTGGG + Intronic
955196739 3:56811366-56811388 CTGGGGCTGGGGCAGATGGTGGG + Intronic
955475186 3:59329126-59329148 CTGTGGATGGATGAGGTGGTAGG - Intergenic
955584536 3:60462403-60462425 CAGTGTTTGGGAGAGGAGGTAGG - Intronic
956322374 3:68011119-68011141 GTGTGTGTGTGGGGGGTGGTGGG + Intronic
956806355 3:72817075-72817097 ATGTGTGTGGTGGTGGTGGTGGG - Intronic
957079958 3:75628903-75628925 CTGTGTCAGTGTGGGGTGGTGGG + Intergenic
958744208 3:98113471-98113493 ATGTGTCTTGGGAAGGTGGAGGG - Intergenic
959676619 3:109042912-109042934 CAGAGGCTGGGGGAGGGGGTTGG + Intronic
959898085 3:111627725-111627747 CCGTGCCTGTAGGAGGTGGTTGG - Intronic
960150760 3:114246473-114246495 AGGGGTCTGGGGGAGGTGATTGG + Intergenic
960360252 3:116702492-116702514 CTGTCTCTGGGGATGCTGGTTGG - Intronic
960439167 3:117665672-117665694 ATGTGGCTGGGGGTGGTTGTAGG + Intergenic
960953015 3:123011828-123011850 CTGTGTCCTGGAGAGGTGATGGG - Intronic
961065310 3:123870178-123870200 CTTTTTCTGGGGGATGTGGTTGG - Intronic
961813247 3:129533763-129533785 CTGTGGCTGGGGGAAGGTGTAGG - Exonic
962170242 3:133094227-133094249 GTGTGTGTGGGGGGGGTGGGGGG - Intronic
962345736 3:134617995-134618017 TTGGGTCTGGGGTAGGGGGTGGG + Intronic
962362159 3:134751662-134751684 ATGTGGCTGGGGGAAGGGGTAGG + Intronic
962411336 3:135143949-135143971 CTGTGCCTGGAGGAGGAGGCAGG - Intronic
964368555 3:155974646-155974668 CTGGGTCTAGGGGTAGTGGTGGG - Intergenic
964417553 3:156463452-156463474 CTTTGCCTGGAGGAGGTGGAGGG - Intronic
964636211 3:158860456-158860478 TTGAGTCTGTGGGAGGAGGTGGG + Intergenic
965681922 3:171260445-171260467 GTGTCTCTTGGGGAGGAGGTGGG - Intronic
966678365 3:182613737-182613759 CTTTGGCTGGGGTAGGTGGGAGG - Intergenic
966940061 3:184740664-184740686 CTGTGTTTGGGGGAGGAAGAGGG - Intergenic
968082535 3:195856735-195856757 CTGTGTTTGGGGGAGTGGTTCGG - Intergenic
969068602 4:4511924-4511946 CTTTGTCTGGGGGCGGAGGTGGG + Intronic
969202657 4:5618134-5618156 CTGTGGCTGGAGGAGGGGGCAGG + Intronic
969318017 4:6393769-6393791 ATGGGCCTGGGGGAGGTGGACGG + Intronic
969449088 4:7262838-7262860 CTGTGTCTGGTGAAGGTGGAGGG + Intronic
969522171 4:7684817-7684839 CTGGGGCTGGTGGTGGTGGTGGG - Intronic
969732352 4:8964488-8964510 CGGCGTCTGGGCGCGGTGGTGGG + Intergenic
969759720 4:9173317-9173339 CTGTGTATCGGGGTGGGGGTGGG + Intronic
970594343 4:17586110-17586132 CTGTGTCAGTGGGAGGCTGTTGG + Intronic
971257784 4:25030352-25030374 CTTTGTGTGGGGGACGTGGGTGG - Intronic
972715434 4:41641258-41641280 GTGTGTCTGGGGATGGGGGTTGG - Intronic
976210492 4:82663761-82663783 TTGTCTCTGGGAGAGGTGTTGGG + Intronic
976388392 4:84484546-84484568 CTTTTCCTGGGGGAGGGGGTGGG - Intergenic
976401832 4:84615578-84615600 CTGTGGCAGGGGGAGGGGGTGGG - Intronic
976883203 4:89955517-89955539 ACGTGGCTGGGGGAGGTGGAAGG + Intergenic
976963996 4:91012503-91012525 CTGTGTCTGGGTGGGGAGGGTGG + Intronic
977222911 4:94358508-94358530 GTGTGTCTGTTGGAGGGGGTGGG + Intergenic
977310560 4:95381911-95381933 GTGTGTATGGGGCAGTTGGTGGG + Intronic
977566915 4:98589850-98589872 ATGTCTCTGTGGAAGGTGGTGGG + Intronic
978648211 4:110967416-110967438 TTTTGTTTGGGGGAGGTGGTGGG + Intergenic
981183391 4:141772352-141772374 CTGTGTGTGGGGGTGGGGGGAGG - Intergenic
981289863 4:143062037-143062059 CTGTGTCAGGGAGAGAAGGTGGG + Intergenic
981924839 4:150127806-150127828 ATATGTCTGGTGGAGTTGGTTGG + Intronic
982236972 4:153260687-153260709 GTGTGTGTGGGGGGGGGGGTGGG - Intronic
982660208 4:158197616-158197638 TTGTGTCTGAGGGAAGGGGTGGG - Intergenic
984199383 4:176698584-176698606 GTGTGTGTGGGGGAGTTGGGGGG + Intronic
984852564 4:184167041-184167063 CTGTGCCTGGGGCAGGGGTTGGG + Intronic
984991535 4:185385892-185385914 CTCTGTCTCGGGGAGGGGGGGGG + Intronic
985519425 5:366064-366086 GTGTGTGTGGGGCAGGGGGTGGG - Intronic
985551560 5:535766-535788 CTGTGCCTGGGGGAGCACGTTGG - Intergenic
985624184 5:976468-976490 CAGGGTCTGGGGGAGGTGGATGG + Intergenic
985640145 5:1059752-1059774 CTGTGTCGGGGGGTGGGGGGTGG + Intronic
985708459 5:1414895-1414917 CTGTGTCTGGGGAAGGGGGCGGG + Intronic
985718307 5:1475407-1475429 GTGTGGCTGGCGGAGGTGGGTGG - Intronic
985771140 5:1812143-1812165 CTGTGTCTGGTGAGGGTGGAAGG + Intronic
986608819 5:9547008-9547030 CAGTTTCTGGAGGAGGCGGTGGG + Intergenic
989191085 5:38670457-38670479 CTGTCTCTGGGGGAGGGGAGAGG - Intergenic
989717552 5:44482085-44482107 GGGTGTCTGTGGGAGGTGGTGGG + Intergenic
989975935 5:50587181-50587203 CTGTGTGTATTGGAGGTGGTAGG + Intergenic
990123475 5:52485088-52485110 CTGTGTTTGGGGTAGGTTTTTGG - Intergenic
990168152 5:53017920-53017942 CTGTGGCTGGGGGAGGCTGCAGG + Intronic
990936825 5:61160194-61160216 CTGGGGCTGGGGGAGGCGGGTGG + Exonic
992272669 5:75081654-75081676 GTGTGTTTGGGGTGGGTGGTGGG + Intronic
992748396 5:79840555-79840577 CTGTTTCTCAGGGAGGAGGTTGG - Intergenic
992879474 5:81091890-81091912 CTGCATTTGGGGTAGGTGGTAGG + Intronic
993294308 5:86114849-86114871 CTCTCTCTGGGAGGGGTGGTGGG + Intergenic
993879145 5:93342668-93342690 CTCTTTGTAGGGGAGGTGGTGGG - Intergenic
995271754 5:110227891-110227913 CTCTGTCTTGGGGAGGTGTAAGG - Intergenic
996700453 5:126445601-126445623 CTGTCTCTTGGGTATGTGGTGGG + Intronic
997975801 5:138440612-138440634 CTGGCTCTGAGGGAGGTGGAGGG + Intronic
998152782 5:139766487-139766509 CTGTGTATGGGGGAAATGGATGG + Intergenic
998501506 5:142636835-142636857 CTGTGGCTGGGGAAGCTGGCAGG + Intronic
999190406 5:149742886-149742908 GTGTGGCTGGGGTGGGTGGTGGG + Intronic
999319682 5:150605731-150605753 GTGTGTGTGGTGGGGGTGGTTGG - Intronic
999498038 5:152119442-152119464 CTGTGTCAGGAGCAGGTGGAGGG + Intergenic
999499881 5:152136234-152136256 CTGTGTTTGGGGAATGTGGGTGG - Intergenic
999726612 5:154443539-154443561 GTGTGTGTGGTGGTGGTGGTGGG - Intergenic
1000107353 5:158072887-158072909 CTGTGTGTGGGTGTGGTGGGGGG + Intergenic
1001226982 5:169953182-169953204 GTGTGGCTGGGTGTGGTGGTGGG + Intronic
1001444538 5:171773234-171773256 CTCAGTCTCAGGGAGGTGGTGGG + Intergenic
1001783485 5:174391102-174391124 CAGTGGCTGGTGGAGGTGATGGG + Intergenic
1001884947 5:175281196-175281218 CTGTGTGTGGGGGAAGTTGGAGG - Intergenic
1002135320 5:177104084-177104106 GTGTGTCCCCGGGAGGTGGTAGG - Intergenic
1002204535 5:177553883-177553905 CTGTGGCTGAGGGAGCAGGTGGG + Intronic
1002599361 5:180345550-180345572 ATGTGGCTGGAGAAGGTGGTGGG - Intronic
1003011331 6:2430113-2430135 GTGTTTCTTGGGGATGTGGTTGG + Intergenic
1003125374 6:3351688-3351710 GTGTGGCTGGGGGAGGAGATGGG - Intronic
1003256986 6:4483234-4483256 CTGTGTGGTGGGGAGGGGGTGGG - Intergenic
1003261017 6:4516157-4516179 CTGCGGGTGGGGGAGGCGGTGGG + Intergenic
1003350484 6:5313094-5313116 CTGTGTTAGGGGGTGTTGGTTGG - Intronic
1003644519 6:7903749-7903771 CTGTTTCTGAAGGAGGTGGAGGG - Intronic
1003891293 6:10565977-10565999 CTGTGTTTGGTGAAGGTGCTGGG - Intronic
1004080389 6:12386756-12386778 GTGTGTGTGGGGGGGGTGGTGGG + Intergenic
1004300890 6:14456122-14456144 CTGTGGTGGGGGGAGGTGGGGGG - Intergenic
1005570875 6:27144453-27144475 CTCTGTCTGGGGGGGGGGGGGGG + Intergenic
1006004094 6:30988776-30988798 CTGTGTGTGGGGGGGGAGGGGGG + Exonic
1006143242 6:31943573-31943595 CAGAGGCTGGGTGAGGTGGTAGG - Intronic
1006167270 6:32072272-32072294 CTGTGGCTGGGGCTGGTGGGAGG + Intronic
1006388305 6:33744639-33744661 CAGTGGCTGGGTGAGGAGGTGGG - Intronic
1006984039 6:38166157-38166179 CTGTGCGTGGGGGAGGTGGAGGG - Intergenic
1006984047 6:38166185-38166207 CTGTGCGTGGGGGAGGTGGAGGG - Intergenic
1006984055 6:38166213-38166235 CTGTACGTGGGGGAGGTGGAGGG - Intergenic
1006984135 6:38166462-38166484 CTGTGCGTGGGGGAGGTGGAGGG - Intergenic
1006984143 6:38166490-38166512 CTGTACGTGGGGGAGGTGGAGGG - Intergenic
1007234480 6:40380382-40380404 CTGTGCATCTGGGAGGTGGTAGG + Intergenic
1007394539 6:41570063-41570085 GTGTGTCAGGGGGTGGTGGGGGG - Intronic
1007400820 6:41601317-41601339 CTGGGGCTGGGGGAGGTGTCAGG - Exonic
1007474102 6:42107473-42107495 CTGGGCCTGGGGGAGGTGGGGGG + Exonic
1007486090 6:42181724-42181746 CTGGGTGTGGGGGAGGTGTGGGG + Intergenic
1007661487 6:43489491-43489513 CAGAGCCTGTGGGAGGTGGTGGG + Intronic
1008155563 6:48009763-48009785 CTATGTCTGAGGCAGGTGTTTGG - Intronic
1009951570 6:70402936-70402958 CTGTGTGTGGGGGGGGTGGGGGG - Intergenic
1010219442 6:73435150-73435172 TTTTTTCTGGGGGAGGTAGTGGG - Intronic
1010570003 6:77464229-77464251 AGGTGTCTGGGGGAGCTGGAGGG + Intergenic
1012313704 6:97759252-97759274 GTGTGTGTGGTAGAGGTGGTGGG + Intergenic
1013296785 6:108764717-108764739 CTGTCTCTGGGAAAGGTTGTTGG + Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013524131 6:110958882-110958904 CTGTGTGTGGGGAAGGGAGTTGG + Intronic
1014935459 6:127380437-127380459 TTGGGTGTGGGGGAGGGGGTGGG - Intergenic
1015456785 6:133435462-133435484 CTGTGTCTGGGGAAATGGGTTGG + Intronic
1016808313 6:148235208-148235230 ATGTGTATGGTGGAGGTGGATGG + Intergenic
1016827777 6:148404581-148404603 CTGGGGGTGGGGCAGGTGGTGGG - Intronic
1017718188 6:157226715-157226737 CTGGGGCTGGGGGTGGGGGTGGG - Intergenic
1018696700 6:166396574-166396596 CAGTGGCTGGGGGCGGGGGTGGG + Intergenic
1019273901 7:166053-166075 CTGTGATGGGGGGAGGTGGCTGG + Intergenic
1019563172 7:1667779-1667801 CTGGGTCTGGGGGAGGGGCAGGG + Intergenic
1019642356 7:2110862-2110884 CTGTGTTTGAGGGAGATGGTGGG - Intronic
1019665276 7:2249145-2249167 CTGTGCCTGGAGGAGGTGTAAGG - Intronic
1019774015 7:2901634-2901656 CTGTATCTTGTAGAGGTGGTGGG + Intergenic
1019776582 7:2915193-2915215 CTGTGGCTGGGAGTGGTGGGAGG + Intronic
1020376805 7:7496523-7496545 TTGTGTCTGGGTGAATTGGTAGG - Intronic
1021457662 7:20847064-20847086 CTCTGTTTCTGGGAGGTGGTTGG + Intergenic
1022095012 7:27134184-27134206 TTGTGTCTAGTGTAGGTGGTGGG - Intronic
1022109130 7:27217285-27217307 GTGTGTGTGGGGAAGGTGGTGGG + Intergenic
1022128579 7:27381077-27381099 TTGAGTCTGGGGTTGGTGGTGGG - Intergenic
1022922053 7:35025500-35025522 AGGTGGGTGGGGGAGGTGGTGGG + Intronic
1022973302 7:35536338-35536360 GTGTGTCTTGGGGTGGAGGTTGG - Intergenic
1022991965 7:35717404-35717426 CAGTGTCTGGGGGCGAGGGTGGG + Intergenic
1023168707 7:37369208-37369230 CAGTGGCTGGGGGAGATGGAAGG + Intronic
1023345729 7:39269438-39269460 CTGTATCTGGTGGGGGTGTTGGG - Intronic
1023743836 7:43303846-43303868 CTGTGTATGAGGGATGTTGTGGG - Intronic
1023896167 7:44434594-44434616 GTGTGTCTGGCTGAGGTGGCAGG - Intronic
1024356307 7:48416772-48416794 ATGGGTCTGGGGCAGGTGGGAGG - Intronic
1024405681 7:48976589-48976611 CTGACTCTGAGGAAGGTGGTGGG - Intergenic
1024637964 7:51306030-51306052 CTCTGTCTTGGGGCGGGGGTGGG + Intronic
1024714602 7:52061882-52061904 TGTGGTCTGGGGGAGGTGGTGGG - Intergenic
1024997105 7:55280237-55280259 CTGGGTCTGCAGGAGGGGGTTGG - Intergenic
1026110035 7:67451721-67451743 CTCTCTCTAGGGGAGGAGGTGGG + Intergenic
1026829286 7:73601231-73601253 CTATCTCTGGGGGATGGGGTTGG - Intronic
1027488142 7:78787287-78787309 CTGTGTCTTGGGGAGAAGGTAGG + Intronic
1027699810 7:81455991-81456013 GTGTGTGTGGGGGAGGGGGTGGG + Intergenic
1029113090 7:98223343-98223365 CTGGGGCTGGGGGTGGGGGTGGG - Intronic
1029610321 7:101623117-101623139 CGGTCCCTGGGGGAGGTGGCCGG - Intronic
1030064433 7:105648600-105648622 CTGTGTGTATGGGAGGTGGGGGG - Intronic
1030123425 7:106133034-106133056 GTGTGTGTGGGGGGGGGGGTTGG + Intergenic
1030954693 7:115837597-115837619 ATGTGGCGGGGGGAGGGGGTGGG + Intergenic
1031440152 7:121784659-121784681 GTCTGTCTGGGGGAGGTGGGGGG + Intergenic
1031636972 7:124113263-124113285 CAGACTCTGTGGGAGGTGGTAGG - Intergenic
1031898274 7:127379846-127379868 GTGTGTGTGGGGGGGGTGGGGGG - Intronic
1031972122 7:128072672-128072694 CAGGGGCTGGGGGAGGTGGCGGG - Intronic
1032156091 7:129469499-129469521 CTTTGTCAGTGGGAGGTGGGTGG + Intronic
1032285455 7:130535715-130535737 CTGGGACTGGGGGAGGGGTTGGG + Intronic
1032432283 7:131871791-131871813 CTGTCTGTGGAGGAGGTGGTGGG + Intergenic
1032475842 7:132211048-132211070 CTGGGGCTGGGGGAGGTTCTTGG + Exonic
1032739149 7:134721583-134721605 GTGTGTTTAGGGGAGGTGGGGGG + Intergenic
1033977115 7:147116239-147116261 GTGTGCCTGGAGGAAGTGGTTGG + Intronic
1034154258 7:148941954-148941976 CTCTGTCTCGGGGTGGTGGGGGG - Intergenic
1034384442 7:150727576-150727598 GTGTGTGTGTGGGAGGTTGTTGG - Intronic
1034439661 7:151080333-151080355 CTGTGGGAGAGGGAGGTGGTCGG - Intronic
1034581923 7:152050938-152050960 CTGTGTTTGGGGGAGGGAGAGGG - Intronic
1034748739 7:153548295-153548317 GTGTGTGTGCGGGAGGTGGGTGG + Intergenic
1034930975 7:155163933-155163955 CTGGCTCTGGTGGAGGTGGAAGG - Intergenic
1035404657 7:158589081-158589103 CTGTGCCCGGAGGGGGTGGTGGG + Intergenic
1036040695 8:5077090-5077112 CTGTGTGTGGGGGGGGTGGGGGG - Intergenic
1036638205 8:10565609-10565631 GTGTGTCGGGGGCAGGTGGGAGG - Intergenic
1037931134 8:22880965-22880987 CTCTGCCTGGGGGAAGAGGTGGG + Intronic
1038570362 8:28657078-28657100 CTGGGTGTGGTGGTGGTGGTGGG - Intronic
1038813844 8:30880784-30880806 GTGTGTTTTGGGGAGGGGGTGGG + Intronic
1039081735 8:33740291-33740313 TGGCGTCTGGGGGAGGTGTTTGG - Intergenic
1039189254 8:34953414-34953436 CTGTGTCTTGGGGAAGGGATGGG - Intergenic
1040552703 8:48450748-48450770 CTGTGTCTGGATGAGGGGGAAGG + Intergenic
1041289589 8:56296313-56296335 CTGTCTCTGGTAGATGTGGTGGG - Intergenic
1041607658 8:59802194-59802216 GTGTGTGTGAGGGAGGTGGAAGG - Intergenic
1041739507 8:61143143-61143165 ATTTGTCTGGTGGATGTGGTAGG - Intronic
1042691932 8:71509105-71509127 CAGTTACTGGGGGAGGTGGAGGG + Intronic
1044275521 8:90295253-90295275 CTGTGTCTTAGGGATGTGTTAGG + Intergenic
1044469714 8:92552517-92552539 GTGTGTGTGGGGGGGGTGTTGGG - Intergenic
1044727932 8:95208176-95208198 GTGTGTGTGGGGGAGGGGGGGGG + Intergenic
1044835661 8:96293066-96293088 GGGTGTCTGGGGCAGGAGGTGGG - Intronic
1045723293 8:105139674-105139696 ATGTGTGTGGGGAGGGTGGTGGG + Intronic
1046064477 8:109180589-109180611 CTGGATCTGAAGGAGGTGGTGGG - Intergenic
1046148089 8:110188385-110188407 GTGGGTTTGAGGGAGGTGGTAGG + Intergenic
1046974465 8:120258468-120258490 CTGTATCTGGTGGTGGTGGCTGG + Intronic
1047005918 8:120620649-120620671 GTGTGTGTGGGGGTGGGGGTGGG - Intronic
1048266946 8:132995660-132995682 TTGTGTTTGGGGAAGTTGGTGGG + Intronic
1048415896 8:134227347-134227369 CTCTGACTGGGGGAGATGATGGG - Intergenic
1048577907 8:135707307-135707329 CTCAGGCTGGGGGAGGTGGGAGG + Intergenic
1048997639 8:139804283-139804305 TTGTGTGTGGTGGCGGTGGTGGG - Intronic
1048997696 8:139804511-139804533 TTGTGTGTGGTGGCGGTGGTGGG - Intronic
1049071010 8:140356136-140356158 CCGTGCCTGGGAGTGGTGGTGGG - Intronic
1049474006 8:142788521-142788543 CTGGGTCTGGTGGAGCTGGAGGG + Intergenic
1049958666 9:716980-717002 CTGTGGGTGGGGGTGGTGGGGGG + Intronic
1050441193 9:5665854-5665876 ATGTGCCTGGAGGAGGTGGCTGG + Intronic
1050568364 9:6911825-6911847 CTGGGGCTCGGGGAGGTGGCAGG + Intronic
1050727856 9:8672839-8672861 CTCTGTGTGGGGGGGGTGGGTGG + Intronic
1052041050 9:23739542-23739564 GTGTGTGTGGGGGTGGGGGTAGG - Intronic
1052249545 9:26381271-26381293 CTATGTATGGGGGTGGAGGTAGG - Intergenic
1052728500 9:32258852-32258874 CTGGGTATGGGGTAGGTGGGTGG - Intergenic
1053417181 9:37954000-37954022 CTGAGTCTGGGGGTGGGAGTGGG + Intronic
1053647576 9:40132118-40132140 CTGTGCATGGGGGAGTTGTTGGG + Intergenic
1053758155 9:41331725-41331747 CTGTGCATGGGGGAGTTGTTGGG - Intergenic
1054148622 9:61582828-61582850 GTGTGTGTGGGGGGGGGGGTGGG - Intergenic
1054328553 9:63730072-63730094 CTGTGCATGGGGGAGTTGTTGGG + Intergenic
1054537003 9:66244052-66244074 CTGTGCATGGGGGAGTTGTTGGG - Intergenic
1054953497 9:70881374-70881396 TTTTGTATGGGGGTGGTGGTAGG - Intronic
1055303457 9:74905375-74905397 CTGAGGCTGGGCGAGGTGGCTGG + Intergenic
1055327503 9:75146334-75146356 CTGTCACTGGGAGAGGAGGTTGG + Intronic
1055562158 9:77531778-77531800 GTGTGTTTGGGGCTGGTGGTGGG - Intronic
1055564707 9:77556725-77556747 GTGTGTCTGGGGGTGGTGGTAGG - Intronic
1055689651 9:78815939-78815961 GTGTGTGTGGGGGGGGGGGTGGG - Intergenic
1056137308 9:83642923-83642945 CAGTGTCTGGGGGAGTTGCCAGG - Intronic
1056193394 9:84206398-84206420 TTGTGTGTGTGGGGGGTGGTTGG + Intergenic
1056688829 9:88788564-88788586 GTGTGTTTATGGGAGGTGGTGGG - Intergenic
1057048337 9:91902941-91902963 CAGGGTCTGGGGGAGGAGATGGG + Intronic
1057212259 9:93206589-93206611 GCGTGACTGGGGGAGGTGGGAGG + Intronic
1057270052 9:93645503-93645525 CTGTGGCTGTGGGAGGTGGGTGG + Intronic
1057282027 9:93720159-93720181 CTGGGGCTGTGGGAGGTGGCAGG - Intergenic
1057310672 9:93941037-93941059 CTGTGTCTGGGGGTGGGAGGAGG - Intergenic
1057316105 9:93969382-93969404 CTGGGGCTGGGGGAGGAGGCTGG + Intergenic
1057592138 9:96381825-96381847 CTGTGCCTGGGCGGGGAGGTAGG - Intronic
1057662434 9:97014872-97014894 GTGTGTTTGGGGGTGGTGGGTGG - Intergenic
1057793934 9:98142662-98142684 CTGAGTCTGTGGGAGGTGGGAGG - Intronic
1057909478 9:99006522-99006544 GTGTGGCTGGGGGTGGAGGTGGG + Intronic
1058152251 9:101476167-101476189 ATGGGTCTGGTGGAGCTGGTGGG - Exonic
1058420641 9:104829984-104830006 CTGTGGTTGGTGGTGGTGGTGGG - Intronic
1058657838 9:107240570-107240592 CTTTGTGAGGGGGAGGTGGGTGG + Intergenic
1058789616 9:108429720-108429742 ATGTGTGTGGGGGTGGGGGTGGG - Intergenic
1058988257 9:110229561-110229583 GTGGGTTTGGGGGAGGGGGTAGG - Intergenic
1059311847 9:113393629-113393651 CTCTGTCTGTGGGGGGTGATGGG + Exonic
1059332087 9:113542106-113542128 CTGTGTGTGGGGGTGGGGATGGG + Intronic
1059424156 9:114210454-114210476 GGCTGTCTGGGGAAGGTGGTGGG + Intronic
1059621540 9:116011181-116011203 GTGTGTGTGGGGGTGGGGGTGGG + Intergenic
1059734589 9:117088510-117088532 CTGTGTGTGTTGGAGGTGGGAGG + Intronic
1060594419 9:124839865-124839887 CTGTGTCTGGGGGTAGGGGTGGG - Intergenic
1060894117 9:127206725-127206747 CTGTTTCTGGGCTAGGAGGTTGG - Intronic
1061371791 9:130201541-130201563 CTGGGCCTGGGGGAGGAGGGCGG + Intronic
1061416099 9:130447650-130447672 CCCTTTCTGGGGGATGTGGTGGG + Intronic
1061676233 9:132217349-132217371 CTGTGTCTGGGGGAGCTGTGGGG + Intronic
1061864507 9:133485422-133485444 CCGTGTCTTGGGAAGGTGGGAGG + Intergenic
1061917505 9:133762987-133763009 TTGTGGCTGGGGGAGGTAATGGG + Exonic
1062002861 9:134225571-134225593 CTGAGGCTGGGGGAGGTGACAGG - Intergenic
1062372752 9:136248557-136248579 CTGGGCCTGGGGGTGGTGGCGGG + Intergenic
1062712433 9:137983887-137983909 GTGTGTCTGGGGTGGGGGGTGGG + Intronic
1202795357 9_KI270719v1_random:115417-115439 CTGTGCATGGGGGAGTTGTTGGG + Intergenic
1185670350 X:1804568-1804590 CTGTGTCTCTGAGCGGTGGTAGG - Intergenic
1186038451 X:5449565-5449587 CTGTGTGTGGGGAGGGAGGTGGG - Intergenic
1186181656 X:6979307-6979329 ATGTGTGTGGAGGAGGTGGTGGG - Intergenic
1186206459 X:7205530-7205552 CTGTGTCTGGAGGGGTTGGCTGG + Intergenic
1186389820 X:9147937-9147959 CTGTGGCTGGGGGTGGGGGAGGG - Intronic
1186394685 X:9195759-9195781 CTGTGTGTTGGGGAGGGGCTGGG + Intergenic
1186439269 X:9571234-9571256 CTGTGTATGGGTGGGGTGGAGGG + Intronic
1186502192 X:10060416-10060438 GTGTGTGTTGGGGAGGGGGTGGG + Intronic
1187934392 X:24321662-24321684 CTGACTCTGGGGGAATTGGTGGG + Intergenic
1188421946 X:30000770-30000792 GTGTGTGTGGTGGTGGTGGTGGG + Intergenic
1188842100 X:35028850-35028872 CTGTGTCTGAGGGAGGTACCTGG - Intergenic
1189159977 X:38801499-38801521 CGGGGTCTGGGGGAGCTGGGAGG + Intronic
1189173699 X:38933414-38933436 CTTACTCTGGTGGAGGTGGTTGG + Intergenic
1189202599 X:39210351-39210373 GTGTGTTTGTGGAAGGTGGTGGG + Intergenic
1189240201 X:39518994-39519016 CTGTGTCACGGGCAGGAGGTCGG - Intergenic
1189975838 X:46460768-46460790 CTGTGGCTGGGTGTGGTGGCTGG - Intronic
1189983229 X:46530932-46530954 CTGTGGCTGGGTGTGGTGGCTGG + Intronic
1190286950 X:48967607-48967629 CTGTCTCTGTGGGAGGTGGGTGG - Intronic
1190439444 X:50462980-50463002 GTGCGTGTGGGGGGGGTGGTGGG - Intronic
1190597015 X:52060908-52060930 CTGGGGCTGGGTGAGGGGGTGGG + Intergenic
1190611809 X:52193165-52193187 CTGGGGCTGGGTGAGGGGGTGGG - Intergenic
1190777336 X:53563526-53563548 GCCTGTGTGGGGGAGGTGGTGGG - Intronic
1191164048 X:57368225-57368247 CTGGGTTTGGGGGTGGGGGTGGG - Intronic
1191714561 X:64185445-64185467 CTGTATATGGGGGTGGGGGTGGG - Exonic
1192265153 X:69532562-69532584 CTGTGGCTTGGGGAGGGGGTGGG + Intergenic
1192553342 X:72070738-72070760 GTGTGTGTGGTGGTGGTGGTGGG - Intergenic
1192783982 X:74320437-74320459 CTATGTATGGGGGTGGTGGTGGG - Intergenic
1193525686 X:82585581-82585603 TTGTGTGTGGTGGAGGTGGGAGG + Intergenic
1194024534 X:88735640-88735662 CTGTGTCTGGGGAGGGTGGGTGG + Intergenic
1195006040 X:100686959-100686981 CTGTTTCTGGGGGAGCAGGGAGG - Intronic
1195030663 X:100924471-100924493 ATTTGTATGGGGGAGGTGGGAGG - Intronic
1195405564 X:104509209-104509231 GTGTGTGTGTGGGAGGGGGTTGG + Intergenic
1195688490 X:107605390-107605412 CTGTGTGTTGGGGAGGTGGGAGG - Intergenic
1197543521 X:127794741-127794763 CTGGGTTTGGGGGAGGGGGGAGG + Intergenic
1197773813 X:130107354-130107376 CTGTGTGTGGGGAGGGTGGGAGG + Intronic
1198531365 X:137551683-137551705 GTGTGTTTGGGGCAGGGGGTGGG + Intergenic
1198533944 X:137568706-137568728 CTGGGTTTGGGAGTGGTGGTCGG - Intronic
1198683623 X:139205577-139205599 CTGCGTGTGGGGGTGGGGGTGGG - Intronic
1198791786 X:140354349-140354371 CTGTGTCTGTGGGGAGTGGGGGG - Intergenic
1198869532 X:141161190-141161212 CTCTGTCTGGGGGCGGGGGTGGG + Intergenic
1199036641 X:143058400-143058422 GTGTGTGTGTGGGTGGTGGTGGG + Intergenic
1199096597 X:143749190-143749212 GTGTGTGTGGGGGAGGTTGAAGG - Intergenic
1199951107 X:152706771-152706793 CAGTGTCTGGGGTAGGGGGCTGG + Intergenic
1199958577 X:152761690-152761712 CAGTGTCTGGGGTAGGGGGCTGG - Intergenic
1200124963 X:153808883-153808905 CAGTGTCTGGAGGACGTTGTAGG - Intronic
1200253052 X:154564036-154564058 CTGGGCCTGCGGGAGGAGGTGGG + Intronic
1200264715 X:154640379-154640401 CTGGGCCTGCGGGAGGAGGTGGG - Intergenic
1200842152 Y:7793421-7793443 CAGAGATTGGGGGAGGTGGTGGG - Intergenic
1201539171 Y:15087805-15087827 CTGTGGTGGGGGGAGGTGGGAGG - Intergenic
1201633035 Y:16091256-16091278 CTGTGTGTGGGGAGGGAGGTGGG + Intergenic