ID: 1085048539

View in Genome Browser
Species Human (GRCh38)
Location 11:73367622-73367644
Sequence GGGGCGGGGCCTCGGTGCCA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 482
Summary {0: 1, 1: 0, 2: 4, 3: 59, 4: 418}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085048539_1085048553 16 Left 1085048539 11:73367622-73367644 CCTTGGCACCGAGGCCCCGCCCC 0: 1
1: 0
2: 4
3: 59
4: 418
Right 1085048553 11:73367661-73367683 CTGGTTATCAGTGGAGGTGATGG 0: 1
1: 0
2: 2
3: 22
4: 264
1085048539_1085048547 -3 Left 1085048539 11:73367622-73367644 CCTTGGCACCGAGGCCCCGCCCC 0: 1
1: 0
2: 4
3: 59
4: 418
Right 1085048547 11:73367642-73367664 CCCTGCCAGGCCTAAAATGCTGG 0: 1
1: 0
2: 0
3: 16
4: 147
1085048539_1085048554 24 Left 1085048539 11:73367622-73367644 CCTTGGCACCGAGGCCCCGCCCC 0: 1
1: 0
2: 4
3: 59
4: 418
Right 1085048554 11:73367669-73367691 CAGTGGAGGTGATGGCTATGAGG 0: 1
1: 0
2: 3
3: 44
4: 278
1085048539_1085048551 7 Left 1085048539 11:73367622-73367644 CCTTGGCACCGAGGCCCCGCCCC 0: 1
1: 0
2: 4
3: 59
4: 418
Right 1085048551 11:73367652-73367674 CCTAAAATGCTGGTTATCAGTGG 0: 1
1: 0
2: 3
3: 35
4: 481
1085048539_1085048552 10 Left 1085048539 11:73367622-73367644 CCTTGGCACCGAGGCCCCGCCCC 0: 1
1: 0
2: 4
3: 59
4: 418
Right 1085048552 11:73367655-73367677 AAAATGCTGGTTATCAGTGGAGG 0: 1
1: 0
2: 1
3: 29
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085048539 Original CRISPR GGGGCGGGGCCTCGGTGCCA AGG (reversed) Exonic
900116125 1:1028629-1028651 GGGGCTGGGGCTCGGTTCCTTGG - Intronic
900116146 1:1028690-1028712 GGGGCTGGGGCTCGGTTCCTTGG - Intronic
900116250 1:1028995-1029017 GGGGCTGGGGCTCGGTTCCTTGG - Intronic
900116272 1:1029056-1029078 GGGGCTGGGGCTCGGTTCCTTGG - Intronic
900176525 1:1293735-1293757 GGGGCGGGGCCTCCAGGGCAGGG - Intronic
900176535 1:1293755-1293777 GGGGCGGGGCCTCCAGGGCAGGG - Intronic
900178372 1:1300590-1300612 GGGCCGGTGCCTCGGGGCCTGGG + Exonic
900505952 1:3029811-3029833 GGTGGGGTGCCCCGGTGCCACGG + Intergenic
900558044 1:3289859-3289881 GGAGTGGGGTCTCGGTGCCCTGG - Intronic
900558071 1:3289957-3289979 GGAGTGGGGTCTCGGTGCCCTGG - Intronic
900923737 1:5690320-5690342 GGGGTGGGGCCTGGGTCCCCTGG - Intergenic
900974420 1:6008219-6008241 GGGGCGGGTCCTTTCTGCCATGG - Intronic
901791307 1:11654864-11654886 GGGGCGGGGCCTCGCTTTCCAGG + Exonic
901796295 1:11681273-11681295 GGGGCCGGGCCTCGGCGTCCGGG + Exonic
901874562 1:12159914-12159936 GGGGCGGGGGCGGGGTGCCAGGG + Intergenic
903233172 1:21934069-21934091 GGGGCTGGGCCTGGGTGACTCGG - Intronic
903628231 1:24745984-24746006 GGGGCCGGGCCCCGGCGCCCGGG - Intronic
903649903 1:24916107-24916129 GGGGCTGGTCCTGGGAGCCAAGG - Intronic
904239426 1:29134397-29134419 GGGGCGCGGCCTCACGGCCAGGG - Intergenic
904289934 1:29478453-29478475 GGGGCGGCGGCTCGGTCCCAGGG + Intergenic
904413859 1:30342898-30342920 GGGGCGGCGGCTCGGTCCCAGGG - Intergenic
905531772 1:38685522-38685544 GGGGCTGGGCTTGGGTACCATGG - Intergenic
905626104 1:39491537-39491559 GGGGCGGGGCCTGGGCGCGGAGG - Intergenic
905670808 1:39788930-39788952 GGGGCGGGGCCTGGGAGCGGGGG + Intergenic
905890557 1:41516172-41516194 GGGGCGGGGCCGCCCAGCCAGGG - Intronic
906299976 1:44674597-44674619 GGGGCGGGGCATGGTTGCTAGGG - Intergenic
907242916 1:53090560-53090582 GGGGCGGGGGCTGGGGGCCTTGG - Intronic
907501729 1:54886397-54886419 GGAGAGGGGCCTTGATGCCAAGG - Intronic
911664703 1:100539499-100539521 GGCGCCGGGCCGCGGTGCCCAGG - Exonic
912471693 1:109911100-109911122 GGGGCGGGGGCTCGGCGGCCAGG + Intronic
912967586 1:114249847-114249869 GGGCCGGGGCTGGGGTGCCAGGG - Intergenic
915128098 1:153679534-153679556 GGCGCTGGGCTTCGGTGTCAAGG + Exonic
917962301 1:180154773-180154795 GGGGCGGGGGCTCGGGGGCGGGG + Intergenic
919075585 1:192808976-192808998 GGGGCGGGGCCTCGCGGCTCCGG - Intergenic
919795729 1:201320404-201320426 GGGGCTGGGCCTAGGGGTCAGGG - Intronic
920398906 1:205664998-205665020 GGGGTGGCACCTCGGTGACAGGG - Intronic
920630188 1:207644999-207645021 GGGGCGGGGCCTCGGCGCGCAGG - Intergenic
922124908 1:222712520-222712542 GGGGCGGGGCCTCGGGGGCGGGG - Exonic
922505175 1:226121993-226122015 GGGGCGGGGCCTCGGCGTCCGGG - Intergenic
922539405 1:226407764-226407786 GGGGCGGGGACGCGGCGCCCCGG - Intronic
922722224 1:227904953-227904975 GAGGAGGGGCCTGGGTGCCCTGG - Intergenic
923086286 1:230705803-230705825 AGGGCAGGGCCGCGGTGGCACGG - Intronic
924741306 1:246795548-246795570 GCGGCGGGTCTGCGGTGCCAGGG + Intergenic
1062874395 10:932406-932428 GGGCCGGGGCCTTGGTCCCGGGG - Intergenic
1064712344 10:18140478-18140500 GGGGCGCGGCTGCGGTGCCTGGG - Intergenic
1065625546 10:27625429-27625451 TTGGCCAGGCCTCGGTGCCACGG - Intergenic
1067063615 10:43090811-43090833 AGGGCCAGCCCTCGGTGCCAGGG - Intronic
1069781246 10:70957099-70957121 GGGGCAGGGGGTGGGTGCCAGGG - Intergenic
1069836818 10:71314523-71314545 GGGGCGGGGGGGCGGTGCGACGG - Intergenic
1070288039 10:75097960-75097982 GGTGCAGTGCCTAGGTGCCACGG + Intronic
1070327386 10:75397405-75397427 GGGCCGGGGCCTCGGGGACGTGG - Intergenic
1072613436 10:97034428-97034450 GGTGGGGGGCCCCGGGGCCATGG - Intronic
1072742407 10:97917443-97917465 GGGGCTGGGGCTGGGGGCCAGGG - Intronic
1073295555 10:102436255-102436277 GGGGAGGGGGCTCAGGGCCATGG - Intergenic
1073392768 10:103193081-103193103 GGAGAGGGGCCTTGGGGCCATGG + Intronic
1074923860 10:118046945-118046967 GGGGCGGGGCCTCGAGGTCAGGG + Intergenic
1075343247 10:121663786-121663808 GGAGAGGAGCCTGGGTGCCAGGG - Intergenic
1075615667 10:123889465-123889487 GGGGCGGGGGCTGGGGGGCAGGG + Intronic
1075802443 10:125161286-125161308 GCGCGGGGGCCTCGGTGGCAGGG + Intergenic
1076059187 10:127400345-127400367 CGGGTGGGGGCTCAGTGCCATGG + Intronic
1076059426 10:127401903-127401925 CGGGTGGGGGCTCAGTGCCAAGG + Intronic
1076130813 10:128012485-128012507 GGGTGGGTGCCTCGCTGCCATGG - Intronic
1076887748 10:133270331-133270353 GTGGCGCGGCCTCTGAGCCAGGG + Intronic
1076905269 10:133358037-133358059 GGGGCGGGGCTTGGGGGCCGGGG + Intergenic
1077124447 11:926160-926182 GGGGCGGGGCCTCGAGGCGGGGG + Intronic
1077162863 11:1121568-1121590 GGGGCGCGGACTCCGTGACAGGG - Intergenic
1077192195 11:1260222-1260244 GGGGCGGGGCCTCCCAGGCAGGG - Intronic
1077315858 11:1919140-1919162 GGGGCCTGGCCTCAGTTCCATGG + Intergenic
1077324330 11:1957197-1957219 GGGGCTGGGCCTAGGGGACAGGG + Intronic
1077385881 11:2269308-2269330 GGGGCGGGCGCTCGGAGCCGCGG + Intronic
1077443004 11:2577463-2577485 GGCCTGGGGCCTGGGTGCCATGG + Intronic
1079172055 11:18105844-18105866 GAGGCGGAGCCCCGGTGCCTGGG + Intronic
1080641426 11:34160698-34160720 GGGGGGGGGCCTGGGTGCTGGGG + Intronic
1081488266 11:43547920-43547942 GGGGCGAAGCCTCGGAGCCCAGG - Intergenic
1081566610 11:44264634-44264656 GGGTCAGGGCCTCAGTGCCAGGG + Exonic
1083301202 11:61740399-61740421 TGGCCTGGCCCTCGGTGCCAGGG - Intronic
1083595636 11:63917272-63917294 GGGGCGGGGCCAGGGGGCCGGGG + Intergenic
1083667647 11:64284580-64284602 GGGGCGGGGCCTGGGTCCACCGG - Exonic
1083857785 11:65401552-65401574 GGGGTGGGGTCTGGCTGCCAAGG - Intronic
1083876054 11:65525032-65525054 GGGGCGGGGCCCGGGGGCCAGGG - Intergenic
1083955162 11:65978825-65978847 GGAGCAGGGCCACGGTGCCCAGG - Exonic
1084266312 11:68007145-68007167 GGGCCAGGGCCTCAGGGCCAAGG + Intergenic
1084295817 11:68213077-68213099 GGGGGGCGGCCTCGGTGACGGGG - Intronic
1085048539 11:73367622-73367644 GGGGCGGGGCCTCGGTGCCAAGG - Exonic
1085637351 11:78168952-78168974 GGGTGGGGTCCTGGGTGCCATGG + Intergenic
1089349894 11:117816311-117816333 GGGCCTGGGCCTCGGAGCCAGGG - Intronic
1089927205 11:122271201-122271223 GGGGCGGGGCCTCCATGGCTAGG - Intergenic
1090264406 11:125344980-125345002 GGAGTGGGGCCTGGGAGCCAGGG - Intronic
1090954547 11:131502771-131502793 CGGGCTGGTCCTGGGTGCCAAGG - Intronic
1091236450 11:134025309-134025331 CGAGCCGGGCCTCAGTGCCAGGG + Intergenic
1091236464 11:134025395-134025417 CGAGCCGGGCCTCAGTGCCAGGG + Intergenic
1202807311 11_KI270721v1_random:12374-12396 GGGGCTGGGCCTAGGGGACAGGG + Intergenic
1091473764 12:752907-752929 GGGCCGGAGCCTCGGAGCCTCGG - Exonic
1092409526 12:8243041-8243063 GGGGCGGGGCCTGGGGGGTAGGG + Intergenic
1092915630 12:13186553-13186575 GGGGTGGGGCCAGTGTGCCATGG + Intergenic
1095642434 12:44500727-44500749 GTCGAAGGGCCTCGGTGCCACGG - Intergenic
1096191695 12:49623757-49623779 GGGGCGGGGACTGGGGGCGAAGG + Intronic
1097019175 12:56007770-56007792 GGGGCGGGGCCTCGGTAGCCGGG + Intronic
1100992588 12:100267065-100267087 GGGGCGGGGCTATGGTGCCAGGG - Exonic
1102569793 12:113820483-113820505 GAGGTGGGGCCTCGGTGCTGGGG + Intronic
1103568711 12:121830299-121830321 GGGGCCGGGCCCCGGGGCCAGGG - Exonic
1103940030 12:124496448-124496470 GGCGCTGGGTCCCGGTGCCAGGG - Intronic
1103949299 12:124542489-124542511 GGGTCTTGGCCTCGGTGCCCAGG - Intronic
1104008881 12:124915023-124915045 GGGGAGGGGCCGCGGAGCCGCGG - Exonic
1104633753 12:130425199-130425221 TGGGTGTGGCCACGGTGCCAGGG + Intronic
1105788296 13:23770874-23770896 AGGGCAGGCCCTCGCTGCCACGG - Intronic
1107548886 13:41457468-41457490 GGGGCGGGGCTGCGGAGCCGGGG - Intergenic
1112716495 13:102192061-102192083 GGGGTGGGGCCTTGGAGACAGGG - Intronic
1113201071 13:107867608-107867630 GCGGCGGGGCCGCGGGGCCCGGG + Intergenic
1113969815 13:114180367-114180389 GGGGTGGGGGCTGGGTGCTATGG - Intergenic
1114070215 14:19099498-19099520 GGAGCGGGGCCTCGGAGGCTGGG + Intergenic
1114092049 14:19300504-19300526 GGAGCGGGGCCTCGGAGGCTGGG - Intergenic
1114401430 14:22414547-22414569 GGGCCCGGCCCTCCGTGCCAGGG - Intergenic
1114620575 14:24094073-24094095 GGGGCGGGGCCTCGAAGTCGGGG + Intronic
1116849315 14:49892925-49892947 GGGGCGGGGCTACGGCGCCTCGG - Intergenic
1118030417 14:61812843-61812865 GGGGGGAGGCCGCGGTGCCCAGG + Intergenic
1118747072 14:68781901-68781923 GGGGCTGGGCCTCCGTCACATGG - Intergenic
1119199890 14:72744472-72744494 GGAGCTGGGCCTGGGTGACATGG - Intronic
1119685602 14:76628571-76628593 CTGGTGGGGCCTGGGTGCCATGG - Intergenic
1121252995 14:92513617-92513639 GGGGCCGGGCCTCGGGGCGGGGG - Intergenic
1122517677 14:102320008-102320030 GGCGCGGGGGCTCGGTGCCCCGG - Exonic
1122622456 14:103067532-103067554 GGGGTGGGGTGTTGGTGCCAAGG - Intergenic
1122688681 14:103521650-103521672 GGGGCTGGGCCTCCGTCCCTCGG + Intronic
1122940392 14:104978520-104978542 GGGGCGGGGCCTGGCTGGGAGGG - Intergenic
1122953918 14:105061178-105061200 GGAGCTGGACCTCGGTGCGAGGG - Intronic
1123047605 14:105526515-105526537 GGGGCGGGGCCTCTGGGTCGGGG + Intergenic
1123684274 15:22786506-22786528 GGGGCGGGACGGGGGTGCCAGGG - Intronic
1124594233 15:31080604-31080626 GGGGCGGGGCCTGGGGGCTAGGG - Intronic
1128161045 15:65422976-65422998 GGGGCGCGGCCTCGGGGGCCCGG + Exonic
1129896933 15:79115419-79115441 GGGGAGGCCCCTGGGTGCCAGGG - Intergenic
1130086033 15:80779204-80779226 GGGGCGGGGGCCCTGTGCCCGGG - Intergenic
1130997641 15:88912729-88912751 GGGCCGGGGAGTCGGTGCAATGG - Intronic
1131056315 15:89377444-89377466 GGGGCTGGGGCTGGGAGCCAAGG + Intergenic
1131383017 15:91980205-91980227 GGGGAGAGGCCTCGCTGCCCCGG + Intronic
1132344683 15:101101119-101101141 GGCTGGGGCCCTCGGTGCCAGGG + Intergenic
1132372350 15:101307631-101307653 GGGGTGGGGGCTGGGTGCCAGGG - Intronic
1132544741 16:527972-527994 GGGCCGGGGCCGCGCTGCCCGGG + Exonic
1132572931 16:651840-651862 CGGGAAGGGCCTGGGTGCCAAGG - Exonic
1132573122 16:652656-652678 GGGACGGGACCGCTGTGCCAGGG - Intronic
1132778871 16:1612323-1612345 GGGGCGGGGCCGGGGTGCGCGGG - Exonic
1132871760 16:2118561-2118583 TGGGGGGGGCCTCCGGGCCAAGG - Intronic
1132883041 16:2170781-2170803 GGGAAGGTGCCTCCGTGCCACGG - Intronic
1133024186 16:2980523-2980545 GGGGCGGAGCCTCGGAGCCCGGG - Exonic
1133058348 16:3158612-3158634 GAGGCGGCGCCGCGGTGCCCAGG + Intergenic
1133209908 16:4257807-4257829 AGGGCGGGGCCTCGGCCCCGGGG - Exonic
1134520767 16:14918334-14918356 TGGGGGGGGCCTCCGGGCCAAGG + Intronic
1134708439 16:16316985-16317007 TGGGGGGGGCCTCCGGGCCAAGG + Intergenic
1134715654 16:16357018-16357040 TGGGGGGGGCCTCCGGGCCAAGG + Intergenic
1134951163 16:18351660-18351682 TGGGGGGGGCCTCCGGGCCAAGG - Intergenic
1134959103 16:18395141-18395163 TGGGGGGGGCCTCCGGGCCAAGG - Intergenic
1136554795 16:31001425-31001447 GGGGCTGGGGCTGGGTGCCGGGG + Intronic
1138630561 16:58291147-58291169 GGTGCGGGGCCTCACTGCCGGGG + Intronic
1139388246 16:66588344-66588366 AGGGCAGGGCCTGGGAGCCAAGG + Intergenic
1139437104 16:66942609-66942631 GGGGAGGGGCCACCGTGTCATGG + Intronic
1139547709 16:67657413-67657435 GGGGCAGAGGCTCGGTTCCAAGG - Exonic
1139656011 16:68387587-68387609 GGGGGCGGGCCCCGGAGCCAAGG - Intronic
1139694862 16:68666647-68666669 GGGGCTGAGCCCTGGTGCCAAGG - Intronic
1141118992 16:81336174-81336196 GGGGTGTGGACTGGGTGCCAGGG - Intronic
1142147198 16:88497553-88497575 AGGGCGGGGGCTCAGTGCCAGGG + Intronic
1142403656 16:89874002-89874024 GGGGCCGTGCGTCGGGGCCAGGG + Intronic
1142403718 16:89874186-89874208 GGTGCGGGGCCTTGATGCCAAGG + Intronic
1142434488 16:90047800-90047822 GGGGCGGGGCCGCGGTGAGAAGG + Intergenic
1142434496 16:90047821-90047843 GGGGCGGGACCGCGGTGAGAGGG + Intergenic
1142434509 16:90047849-90047871 GGGGCGGGGCCGCGGTGAGATGG + Intergenic
1142434520 16:90047870-90047892 GGGGCGGGGCCGCGGTGAGGGGG + Intergenic
1142434527 16:90047889-90047911 GGGGCGGGGCCGCGGTGAGAGGG + Intergenic
1142434535 16:90047910-90047932 GGGGCGGGACCGCGGTGAGAGGG + Intergenic
1142434543 16:90047931-90047953 GGGGCGGGACCGCGGTGAGAGGG + Intergenic
1142434551 16:90047952-90047974 GGGGCGGGACCGCGGTGAGAGGG + Intergenic
1142434559 16:90047973-90047995 GGGGCGGGACCGCGGTGAGAGGG + Intergenic
1142623768 17:1180021-1180043 GGGGCGGGGCTTTGGTGCGGGGG + Intronic
1142623776 17:1180040-1180062 GGGGCGGGGCTTTGGTGCGGGGG + Intronic
1142684949 17:1572247-1572269 GGGGGGGGGCCTCTGTGGCAGGG - Intronic
1142848130 17:2691927-2691949 GGGGCGGGGCCGCGGGGGCACGG - Intronic
1143100127 17:4500012-4500034 GGGGCGGGTCCGCGGCGCCTGGG + Intronic
1143223600 17:5282196-5282218 GGGGCGGGGCCTCGGGAGCGCGG - Intergenic
1143258699 17:5582885-5582907 GGGGCAGGGGCAAGGTGCCAGGG + Intronic
1143493101 17:7294941-7294963 GGGCCGGGGCCGCAGTGCCAAGG + Intergenic
1143503560 17:7352094-7352116 GGGGCGGGGGCGGGGCGCCAAGG + Intronic
1143756715 17:9072805-9072827 GAAACGGGGCCTCCGTGCCAAGG - Intronic
1143780443 17:9226163-9226185 GGGGGGGGGCCTCAGTGCCAAGG + Intronic
1144775600 17:17783202-17783224 GGGCCCGGTCCTCGGTGCCCCGG - Intronic
1144971258 17:19111157-19111179 GGGGCGGGACCTCGGGGGCGGGG + Intergenic
1144991557 17:19237320-19237342 GGGGCGGGACCTCGGGGCCTCGG + Exonic
1146907522 17:36627301-36627323 GCGGCTGGGCCACGTTGCCATGG - Intergenic
1147427415 17:40352521-40352543 GGGGCAGTGCCTGGGGGCCAGGG - Intronic
1148129827 17:45256135-45256157 GGGGCAGGGACTCGGTGCCAGGG - Intronic
1148162896 17:45461740-45461762 GGGGCAGGGCCTGGCTGCCTGGG - Intronic
1150394126 17:64808394-64808416 GGGGCAGGGCCTGGCTGCCTGGG - Intergenic
1150728146 17:67668129-67668151 GGGGTGGGGGCTTGGTGCAAAGG - Intronic
1151340116 17:73465758-73465780 GGGAAGGGGGCTGGGTGCCAGGG + Intronic
1151698508 17:75730504-75730526 GGTGCGGGGCCCAGGTCCCACGG + Exonic
1152070018 17:78129736-78129758 GGGGCTGGGTCTCCATGCCAGGG - Intronic
1152128142 17:78459754-78459776 GGGGCTGGGCCTCGTAGCCGGGG - Intronic
1152175173 17:78782378-78782400 GGGGCGGGGCCTCGGGCCGGGGG - Intergenic
1152205690 17:78973385-78973407 GGGGCGGGGCCTCAGGGTCCAGG - Intronic
1152264711 17:79287615-79287637 GGGGAGGGGCCCTGGTGCCCTGG - Intronic
1152924143 17:83079858-83079880 GGGGCGGGGGGTCGCGGCCACGG - Exonic
1154070113 18:11146451-11146473 GGGGCGGTGACTCGCAGCCAGGG - Intronic
1157354109 18:46917530-46917552 GGGGCGGGGCTTCGGCGCGTCGG - Intronic
1158549511 18:58423205-58423227 GAGGGAGGGCCTCTGTGCCAAGG + Intergenic
1160374149 18:78398192-78398214 GGGGCGGGGCCTGGGGGCCATGG - Intergenic
1160629799 18:80238916-80238938 GTGGGAGGGCCTCGGTGCCCAGG + Intronic
1160698229 19:494729-494751 AGGGCAGGGCCTGGGTGCAAAGG - Intronic
1160744446 19:704092-704114 GGGGCGGGGCCATGGTGCAGGGG + Intergenic
1160805727 19:991544-991566 GGGGCGGGGCCTGGCTGGGACGG + Intronic
1160805782 19:991692-991714 GGGGCGGGGCCTGGCTGGGACGG + Intronic
1160805792 19:991713-991735 GGGGCGGGGCCTGGCTGGGACGG + Intronic
1160865052 19:1252724-1252746 GGGTGCGGGCCTCGGGGCCAGGG - Intronic
1160876825 19:1300346-1300368 GGGGCGGGGTCCCTGTGCCCTGG + Intergenic
1160907213 19:1456999-1457021 CGGCCGCGGCCTCGGTGCCGTGG - Exonic
1160991685 19:1862885-1862907 AGGGCGGGGCCTCGGTGGGTGGG - Intronic
1161249825 19:3274590-3274612 GGGGCTGGACCTTGGTGTCAGGG + Intronic
1161594413 19:5143894-5143916 GGGCCGGGGACTCCGTTCCAGGG + Intronic
1161680360 19:5676999-5677021 GGGGCTGGGGCTGGGTGCCTGGG + Intronic
1161726711 19:5933524-5933546 GGGGCTGGGCCTGGGGGGCAAGG + Intronic
1161793249 19:6373217-6373239 GGGGCGGGGCTACGGTGCTGGGG + Intronic
1162238090 19:9324108-9324130 GGGGCGGGGCCTCGGGTTCCCGG - Exonic
1162291739 19:9785730-9785752 GGGGCGGGGACTCGGTGAGAGGG - Intronic
1162291758 19:9785786-9785808 GGGGCGGAGCCTCGGTGAGGGGG - Intronic
1162292944 19:9792672-9792694 GGGGCGGGGACTCGGTGACGGGG - Intronic
1162315460 19:9936030-9936052 GGGGTGGGGGCTCGGGGCCATGG + Intronic
1162373291 19:10291380-10291402 GGGGCGGGGCCTGGGAGGGAGGG - Intronic
1162432062 19:10635073-10635095 GGTGGGGGGCCAGGGTGCCAGGG + Exonic
1162490417 19:10987928-10987950 AGGGCGGGGCCCAGTTGCCAAGG + Intronic
1162532406 19:11243476-11243498 GGGGCGGGGCTACGGGGCGAGGG - Intronic
1162561880 19:11421915-11421937 GGGGCGGGGCCTAGGAGGTAAGG + Intronic
1162744239 19:12790022-12790044 GGAGCGGGGCCTGGTCGCCATGG - Intronic
1162909238 19:13840519-13840541 GATGTGGGGCCTCGGTGCCTGGG - Intergenic
1163242078 19:16070454-16070476 GGGCTGGGCACTCGGTGCCATGG - Intronic
1163427178 19:17245990-17246012 GGGGCGGGCGCTCGTTGCCCCGG + Intronic
1163466143 19:17469710-17469732 GGGGCGGGGCCTAGGTCCTAGGG + Intronic
1163556898 19:17998312-17998334 GGGGCCGGGCCTGGGAGGCAGGG - Exonic
1163582551 19:18147053-18147075 GGGGCGGGGCCACGGGGACTGGG + Intronic
1163641916 19:18466854-18466876 GAGACGGGGCTTGGGTGCCAAGG - Intronic
1163786445 19:19277255-19277277 GGGGGGGGGCCTAGGCCCCAGGG + Intronic
1163829615 19:19541404-19541426 GGGGCGGGGCCTCGTGGACGGGG + Intronic
1163845056 19:19633964-19633986 GGGGCGGGGGCTCAGTGGCCTGG + Exonic
1163845805 19:19637590-19637612 GGGGCGGAGCCTGGGAGCCTGGG + Intronic
1164523974 19:29000188-29000210 GGGGCAGAGCCATGGTGCCAGGG + Intergenic
1164680726 19:30132154-30132176 GGGACAAGGCCTCGGAGCCAGGG + Intergenic
1165879252 19:39031434-39031456 GGGGCGGGGCCTCGGTGGGAAGG - Intronic
1165924918 19:39320865-39320887 GGGGAGGGGGCGCGGTGCCGCGG + Intergenic
1166032572 19:40143793-40143815 GGGGCTGGGCCTGGGCGCCTGGG + Intergenic
1166087744 19:40488100-40488122 GAGGCGGGGCTTCGGTGGAAGGG + Intronic
1166367159 19:42283807-42283829 GGGGCGGGGCCGCGGTAGGAGGG - Intronic
1166836530 19:45670883-45670905 GGGGCGGGACCACGGTTCCTGGG + Intronic
1167040543 19:47020589-47020611 GGGGCGGGTCCTCGGGGCAGAGG + Intronic
1167268248 19:48493875-48493897 GCGGCGGGGCCGCGGGGCCCCGG - Exonic
1167379073 19:49128232-49128254 TGGGCGGGGCCTGAGTGGCAAGG + Intronic
1167688626 19:50971518-50971540 GGGGCTGGGACTTGGTCCCAAGG - Intergenic
1167794963 19:51703104-51703126 GGGGCGGGGCCTCGGGGTGCAGG + Intergenic
1167888715 19:52522801-52522823 AGGGCGGGGCCTGGCTGCGATGG + Intergenic
1168468546 19:56622850-56622872 GGGGTGGGGACTCGGGGTCAGGG + Exonic
925922172 2:8645400-8645422 GCGGCTGCCCCTCGGTGCCAGGG + Intergenic
926027352 2:9556295-9556317 GGGGCGGGGGGTCCGTGCCCAGG - Intergenic
931321478 2:61177692-61177714 TGTGCGGGGCCGCGGGGCCAGGG + Exonic
932053911 2:68425696-68425718 TGGGAATGGCCTCGGTGCCAGGG + Intergenic
932217489 2:69976276-69976298 GGGGCTGGGCCTGGCTTCCAAGG - Intergenic
933157620 2:78992955-78992977 GGGGCGGGGACTCAGCGCCTCGG - Intergenic
935691110 2:105733281-105733303 GGGGCAGGGCAGCAGTGCCAGGG - Intergenic
937996000 2:127695567-127695589 CGCGCGGGGCCGAGGTGCCAGGG + Intergenic
940748480 2:157597321-157597343 GGGGGCGGGCCGGGGTGCCAAGG - Intronic
945833213 2:214809990-214810012 GGGGCGGGGCCTAGGAGCCTCGG + Intergenic
945833239 2:214810059-214810081 GGGGCGGGGCCTAGGGGCCTCGG + Intergenic
946017714 2:216617413-216617435 TTGGCAGGGCCTCGGGGCCACGG - Intergenic
946336189 2:219038308-219038330 AGGGCGGGGCATGGGTGGCAGGG - Intronic
946339443 2:219058482-219058504 GGGGCGGGGCACCGGTGCAGAGG - Intronic
947549671 2:231037470-231037492 GGGGCGTGTCCTCTGTGCCGGGG + Exonic
947811677 2:233008535-233008557 GGGGCGGGACCTGGGGGTCAAGG + Intronic
948127348 2:235574050-235574072 GAGGCAGGGCCTGGGTGCCTTGG + Intronic
948402086 2:237691960-237691982 GGGGCGGGGCCTGGGTGGGGCGG + Intronic
948477815 2:238231705-238231727 GGGGCGTGGCCTCCGGGCCGCGG + Intergenic
948884942 2:240877747-240877769 GTGGTGTGGCCTCGGTGCCAGGG + Intronic
948921500 2:241067989-241068011 GGGGTGGGGGCTCGGGGACACGG + Intronic
948953898 2:241272631-241272653 GGGGAGGGGCCCGGGTGCCGCGG - Intronic
949000559 2:241610562-241610584 AGGGCGGGGCCTCCGGGCCGAGG - Intronic
949043356 2:241859270-241859292 GGGGCCGGGCCTCCCTGCCTGGG + Intergenic
949046112 2:241873408-241873430 GGGGCGGGGCCTCAGAGGCGGGG - Exonic
949046172 2:241873581-241873603 GGGGCGGGGCTTCAGAGGCAGGG - Exonic
949046196 2:241873642-241873664 GGGGCGGGGTCTCGGAGGCGGGG - Exonic
949067918 2:242004660-242004682 TGGGCTGGGCCACGGTGCCCGGG + Intergenic
1168891954 20:1300595-1300617 GGGTCGGGGGCTTGATGCCATGG - Exonic
1171452826 20:25248007-25248029 GGGGCGGGGCCTCGGGGGGCGGG - Intergenic
1172245739 20:33443830-33443852 GGGGCGGGGCCCGGGAGCCGAGG + Exonic
1172528685 20:35616459-35616481 GGGGCGGAGCCTCGGTGTCCTGG + Intronic
1172549769 20:35789831-35789853 GGGGCGGGGGCTGGGCGCCATGG - Intronic
1172661739 20:36573465-36573487 GGGGCGGGCCGTCGGCGCCGAGG - Intergenic
1173221763 20:41137484-41137506 GGGGCGGGGCCTCAGCGCGGCGG - Intronic
1173279949 20:41618708-41618730 GGGGCGGGGCCGGGGTCCCGCGG + Intergenic
1173736233 20:45363466-45363488 CGGGCGGGGCGACGTTGCCATGG + Intronic
1174072070 20:47906238-47906260 GAGGAGGGGGCTCTGTGCCATGG - Intergenic
1174147180 20:48460088-48460110 GAGGAGGGGGCTCTGTGCCATGG + Intergenic
1174151972 20:48492431-48492453 GAGGAGGGGGCTCTGTGCCATGG + Intergenic
1174436549 20:50510880-50510902 GGGGCGGGGTCGGGGTGCGAGGG - Intronic
1175195984 20:57243722-57243744 GGGGAGGGGCTGCGGTGCCCGGG - Intronic
1175237462 20:57524864-57524886 GGGGCGGGGCGTGGGGGGCAGGG - Intronic
1175298106 20:57923306-57923328 GTGGCTGGGCCTTGGTGCCGCGG + Intergenic
1175424640 20:58855662-58855684 GGGGAGGGGCCCCGGGGCCCCGG + Intronic
1175453842 20:59094808-59094830 GAGGCGGGGCCTCCGTGTGAGGG - Intergenic
1175715444 20:61252203-61252225 GGGGCGGGGCCTCGGCGGGGCGG + Intergenic
1175837787 20:62007393-62007415 GGGCCGGGGACTCAGTGCCTGGG - Intronic
1175876605 20:62233083-62233105 CTGGCTGGGCCTCAGTGCCAGGG - Intronic
1176132442 20:63502033-63502055 GGGGCGGGGCCTGGGGGCTCTGG - Intergenic
1176178575 20:63739620-63739642 GGGGCGGGGCCTCGAAGCGCTGG + Intronic
1176313873 21:5223555-5223577 GGAGAGTGGCCTCCGTGCCAGGG - Intergenic
1176387025 21:6143227-6143249 GGGGCAGAGCCTCGGGGCCATGG + Intergenic
1178103971 21:29298755-29298777 AGGGCGGGGCTTCGGCGCCGGGG + Intronic
1179641063 21:42747485-42747507 CTGGTGGGGCCTCGGAGCCAGGG + Intronic
1179736448 21:43395025-43395047 GGGGCAGAGCCTCGGGGCCATGG - Intergenic
1179790753 21:43754670-43754692 GGGGCAGGGCAGGGGTGCCATGG + Intronic
1180064559 21:45405773-45405795 GGGGCGGGGCCGCGGGGTCTCGG + Intronic
1180236002 21:46459483-46459505 GGGCCGGGGTCTCGGGGCGAGGG - Intronic
1180488685 22:15822060-15822082 GGAGCGGGGCCTCGGAGGCTGGG + Intergenic
1180791606 22:18578057-18578079 GGGGCGGGGCCTCGGGGGCGGGG + Intergenic
1180876791 22:19178506-19178528 GGGGCGGGGCCTCAGCGTCCCGG + Intronic
1181805858 22:25374130-25374152 GGGGCGGGGCCTGGCAGCAATGG - Intronic
1183295114 22:37024782-37024804 GGGGCTCGGGCTCGGTGCCGCGG - Exonic
1183323895 22:37181045-37181067 GGGACGGGGTCCCGGTGGCAGGG - Exonic
1183385036 22:37509708-37509730 AGGGCTGGGCCTCGTGGCCATGG - Intronic
1183395507 22:37568821-37568843 GGGGCTGGGGCACGGTCCCAGGG + Exonic
1183401691 22:37608821-37608843 GGGGCGGGGGGGCGGTGCCGAGG + Exonic
1183483011 22:38075190-38075212 GGGGCGGGGCCGCCGCGCAAGGG + Exonic
1183736331 22:39646817-39646839 GGGCCGGGGCCTCCGGGCCCAGG - Exonic
1183780310 22:39995024-39995046 GGGCCGGGGCCGGGGCGCCATGG + Exonic
1184557491 22:45241032-45241054 GGGGCGGGGCCAGGGAGCCGGGG - Intergenic
1184561811 22:45268250-45268272 GGGGCGGGGCCTGGCAGCCCAGG - Intergenic
1184727218 22:46354179-46354201 AGGGCATGGCCTCAGTGCCAAGG + Intronic
1184966198 22:47973920-47973942 GGGGAGGGGGCTCAGTGGCAGGG - Intergenic
1185381306 22:50508495-50508517 GGGGCGGGGGCTCCGGGCCCGGG + Intronic
1185383039 22:50518857-50518879 GGGGCGAGGCCTCACTCCCATGG - Intronic
950519077 3:13485504-13485526 GGTGGGGGGCCTAGGTTCCAGGG + Intronic
950759330 3:15206477-15206499 GGCGCGGGGCCACTGCGCCATGG + Exonic
950940385 3:16885093-16885115 GGGCCCGGCCCTCGGCGCCAAGG + Intronic
953692625 3:45132805-45132827 GGGGCAAAGCCTCTGTGCCACGG + Intronic
954367820 3:50155532-50155554 GCGGCGGGGCCTGGGCGCCCGGG - Exonic
955387565 3:58491847-58491869 GGGGCGGGGCTTCGGGGCTGCGG + Intergenic
960747671 3:120908154-120908176 GGGGCGGGGCCTGCCTCCCACGG + Exonic
960864377 3:122184588-122184610 GTGGCGGGGTCTGGGGGCCAAGG + Intronic
960988800 3:123297253-123297275 TGGGAGGGGCCTTGGTGGCAAGG - Intronic
961863676 3:129938078-129938100 GGGGAGGGGCTGGGGTGCCAGGG - Intergenic
964021822 3:152022064-152022086 GGGGTGAGGCCTCTCTGCCAGGG + Intergenic
966915161 3:184580646-184580668 GGGGCGGGGCCTATCAGCCAGGG + Intronic
968453075 4:684177-684199 GGGGCGGGGCCTTGCTGGGAAGG + Intronic
968470929 4:781994-782016 CGGGCGGGGCCTCCGGGCCTGGG - Intergenic
968508924 4:986965-986987 GGGGCGGGGCCTTGGTGAGGGGG - Intronic
968574628 4:1359881-1359903 GAGGTGGGGCCTCGATCCCAGGG - Intronic
968610609 4:1555266-1555288 GGGGAGGGGCCTCTCTGCCCAGG + Intergenic
968815067 4:2817883-2817905 TGGGCGGGGCCTCAGAGCCGAGG + Intronic
969040237 4:4290170-4290192 GGGGCGTGGCCGCGGTGCGCAGG - Intergenic
969498579 4:7540002-7540024 GGGGCGGGGCCTCCATAACAGGG - Intronic
969597482 4:8157570-8157592 GGGGCGGGGGCTAAGGGCCAGGG - Intronic
970394978 4:15655961-15655983 GGCGCGGGGCCTGGGTGCGAGGG + Intronic
982133247 4:152248615-152248637 GGGGCGTGGGGTCGGTTCCATGG - Intergenic
984601056 4:181727231-181727253 GCGGTGGGGGCTGGGTGCCAGGG - Intergenic
985283655 4:188312216-188312238 GGTGAGGGGCCTGAGTGCCAAGG + Intergenic
987050382 5:14143482-14143504 GGGGCGGAGGCGCGGAGCCACGG - Intergenic
987235477 5:15937512-15937534 GGGGTGGGGCCTGTGTGCGAGGG - Exonic
990008192 5:50966504-50966526 GGGGTGGGGGCTCGGGGCCAGGG + Intergenic
990148396 5:52788352-52788374 GGCGCGGGGCCGAGGGGCCATGG - Exonic
992078976 5:73216411-73216433 GCGGCAGAGCCTGGGTGCCAAGG - Intergenic
992962769 5:81972243-81972265 AGGGCGGGGCGACGGGGCCAGGG - Exonic
995759128 5:115544888-115544910 GGGGCGGGGCGTCGCGGCCGGGG + Exonic
997099662 5:130955225-130955247 GGGGTGGGGGCTGGTTGCCAAGG - Intergenic
997521503 5:134526771-134526793 GGTGCGGAGCCTCGGCGCCAGGG + Intronic
998092303 5:139378519-139378541 GGGGCGGGGCCTGCGGCCCACGG + Intronic
998368307 5:141645050-141645072 GGGGAGGGCCCTCGTGGCCAGGG + Exonic
998912495 5:146975161-146975183 GGGGCTGGGGGTCGGTGCAATGG - Intronic
999177151 5:149639655-149639677 GGGGCTGGGTCTTGGTGCTATGG + Intergenic
999223542 5:150000975-150000997 CGGGCGGGGCCGCGGGGCCGGGG + Exonic
999241945 5:150132962-150132984 GGGGCGGGGCCCTGGGGGCAGGG + Intronic
1000210059 5:159100372-159100394 GGGGCGGGGCCTCGATGCGCGGG - Intergenic
1002000342 5:176193481-176193503 CGCGTGGGGCCTGGGTGCCAGGG - Intergenic
1002059700 5:176619260-176619282 GGGGCGGGGCCTCTGCGGGACGG + Intergenic
1002184288 5:177447053-177447075 GGGGCGGCGACCCGGGGCCAGGG - Intronic
1002253994 5:177945503-177945525 CGCGTGGGGCCTGGGTGCCAGGG + Intergenic
1002576851 5:180178909-180178931 GGGGAGGGGCGCAGGTGCCAAGG + Intronic
1002593424 5:180306519-180306541 GGGGCAGGGACAGGGTGCCAGGG - Intronic
1003218390 6:4135683-4135705 GGGGCGGGGCCTAGGCTCCCGGG + Intergenic
1003345363 6:5261261-5261283 GGGGCGGGGCGTCGGTGCGGCGG - Exonic
1004114102 6:12749801-12749823 GGGGCGGGGGCGCGGCGCCAGGG - Intronic
1004216783 6:13711256-13711278 GCGGCGGGGCCGCGGTGGCCGGG + Exonic
1004614958 6:17281079-17281101 GGGGCGCGGCGGCGGGGCCAGGG - Intergenic
1005886604 6:30102176-30102198 GGGGCGGGGCCTGCGTGCCGGGG - Intergenic
1005965102 6:30721424-30721446 GGGGCGGGGCCGGGGCGCCGTGG + Intronic
1006136073 6:31897232-31897254 GGGGCGGGGCCTCCGCGCCCCGG + Intronic
1006665340 6:35689081-35689103 GGGGCGGGGCCTCATTTGCATGG - Intronic
1006669980 6:35724198-35724220 GGGGCTGAGCCTGGGTTCCAGGG - Intronic
1007451338 6:41941872-41941894 GGGGCGGGGCTGCGGCGCCCCGG + Intronic
1008119299 6:47592643-47592665 GGGGAGGGGCCTTGTTGCCAGGG + Intronic
1011137834 6:84118459-84118481 GGGGCGGGACCTCCCAGCCAGGG - Intergenic
1011258680 6:85450046-85450068 AGGGCCGGGGCTCGGTGCCCCGG - Intronic
1011587286 6:88940364-88940386 GGGACTGGGGCTGGGTGCCATGG - Intronic
1013425854 6:110012063-110012085 GGTGTGGGGCCTCGGAGCCATGG - Intergenic
1015244787 6:131063370-131063392 GGGGCGGGGCCTGGGCGTCGGGG - Intergenic
1015935698 6:138404389-138404411 GGAGCGGGGACTCGGGGCCTCGG + Exonic
1017146933 6:151242700-151242722 GGGACGGGTCCATGGTGCCACGG - Intronic
1019191846 6:170255916-170255938 GAGACGGGGGCTCGGTTCCATGG - Intergenic
1019191864 6:170255985-170256007 GAGACGGGGGCTCGGTTCCATGG - Intergenic
1019323268 7:425139-425161 GGGCCGGGGGCTCTGTGCCAGGG - Intergenic
1019447257 7:1077823-1077845 AAGGGCGGGCCTCGGTGCCACGG + Intronic
1019626262 7:2017458-2017480 AGGACAGGGCCTCGGTGCCCTGG + Intronic
1019659845 7:2218171-2218193 GGGGCGGGGGGTCTGTGCCGTGG - Intronic
1020004565 7:4775503-4775525 GGGGCGGGGCGTAGGTGCCGCGG - Intronic
1021452789 7:20798107-20798129 GGGGCTGGGCCGGGCTGCCACGG - Intergenic
1022094397 7:27130058-27130080 GGGGCTGGGCCTGGGTTCGAGGG - Intronic
1022524598 7:31028947-31028969 GGGGTGGGGCGCCGGAGCCAGGG + Intergenic
1022734429 7:33062819-33062841 GGGGCGGGGCGTCGCTGCGCGGG - Intergenic
1022868867 7:34454603-34454625 GTGGGAGGGCCTCGGTGCAAAGG - Intergenic
1025673502 7:63628206-63628228 GAGGCGGGGCCTGGGATCCAGGG + Intergenic
1025850510 7:65239801-65239823 GGGGCGGGGCGTCCATGGCAGGG + Intergenic
1026850366 7:73719732-73719754 GGGGCGGGGCCGGGGTCCCGGGG - Intergenic
1029270412 7:99374199-99374221 GGGGCGGGGCCGGGCTGCCCTGG + Intronic
1029366454 7:100119582-100119604 AGGGTGGGGCCTCGTTGCTACGG - Intronic
1029506515 7:100966572-100966594 GGGGCGGGGCCGGGGGGCGAGGG + Intronic
1031353801 7:120766062-120766084 AGGGTGGGGCCTGGTTGCCAGGG - Intergenic
1032787384 7:135211545-135211567 GGGGCGGGGCCTGGGAGAAATGG + Intergenic
1034255124 7:149720614-149720636 GGGGCGGGGCCTGGGTAACAGGG - Intronic
1035169936 7:157011478-157011500 GGAGCGGGTCCTCGGTGACAAGG + Intergenic
1035303930 7:157917475-157917497 GGGGCGGGGCTTCGGTGGAAAGG + Intronic
1035444663 7:158932181-158932203 GGGACGGGGCCTCGCTGCAGGGG - Intronic
1035766875 8:2113467-2113489 GGGGTGGGGCTTCTGTGCCCAGG + Intronic
1037825306 8:22156838-22156860 GGCGCGGGGCCTGGGAGTCACGG + Intronic
1037828887 8:22176880-22176902 GGGGCGGGGCCAGGCTGCCGGGG - Intronic
1037891330 8:22625268-22625290 AGGGCTGGCCCTCGGTGCAATGG + Intronic
1038575837 8:28702286-28702308 GGAGCTGGGCCTGGGAGCCAGGG - Intronic
1039484324 8:37899342-37899364 GGCGCGGGGCCTGCGGGCCAAGG - Exonic
1039860557 8:41453429-41453451 GGGGCGGGGGGTGGGGGCCAGGG + Intergenic
1039884929 8:41649338-41649360 TGGGCAGGGCTTCGGTGGCACGG + Intronic
1042962911 8:74321629-74321651 GGGGCCGGGCCTCGGCGCCCGGG - Intronic
1045336266 8:101206171-101206193 GGGCCGGGGCCGCGGTGTCCTGG - Intronic
1045472991 8:102529021-102529043 GGGGCGGGGCCTGGGGGCGACGG - Intronic
1047300436 8:123609365-123609387 GGGGCAGGGCCTTGCTGGCAGGG + Intergenic
1049411352 8:142475351-142475373 GGGGAGGGGCCGCAGTGCCGGGG - Intronic
1049414904 8:142490721-142490743 GGGGCTGGTCCTGGCTGCCAGGG + Intronic
1049416434 8:142497615-142497637 TGGGTGGGGCCTCGGGGACAGGG + Intronic
1049577957 8:143398287-143398309 GGGGCGGGGCCAAGGCCCCAGGG + Intergenic
1049580661 8:143409105-143409127 GGGGCAGGGCCTGGGGGCCCAGG + Intergenic
1049687531 8:143944908-143944930 GCAGCGGGGCCTGGGTGCCCTGG - Intronic
1049742581 8:144248203-144248225 GGGGAGGGGACGCGGTGCCCAGG - Intronic
1049761001 8:144332030-144332052 GGGGCGGGGCCTGGGTCTCAGGG + Exonic
1049761010 8:144332050-144332072 GGGGCGGGGCCTGGGTCTCAGGG + Exonic
1049769875 8:144374795-144374817 GAGAGGGGGCCTCGGAGCCATGG - Intronic
1051217118 9:14810047-14810069 GGGGCAGGGCATACGTGCCAAGG + Intronic
1052286245 9:26789080-26789102 GGGGAGGGCCCTGGGTACCACGG + Intergenic
1055265989 9:74497160-74497182 GGGGCGGGGGCTGGGGACCAGGG - Intergenic
1055514919 9:77024188-77024210 GGGGCGGGGCTTTTCTGCCAAGG + Intergenic
1056643420 9:88389019-88389041 GGGGCGGGACCCCGGCGCGACGG + Intronic
1057557516 9:96099708-96099730 GAGGCAGGGCCTGGGTACCATGG + Intergenic
1057720605 9:97528817-97528839 GGGCAGTGGCCTAGGTGCCAAGG - Intronic
1059208248 9:112486768-112486790 GGGGCGGGGGCTCGGACCCCGGG - Intronic
1060229347 9:121815151-121815173 GGGGCAGGGCCTCCGTTCCGAGG + Intergenic
1060235384 9:121858982-121859004 AGGGCGTGGCGTGGGTGCCAGGG + Intronic
1061000517 9:127899666-127899688 TGGGCGGAGCCTCGGGGCCGCGG + Intronic
1061003847 9:127917210-127917232 GGGGCGGGGCCTCAGGGCCGGGG + Intergenic
1061003856 9:127917230-127917252 GGGGCGGGGCTTCAGAGCCGGGG + Intergenic
1061749868 9:132770269-132770291 GGGGCTGGGCCTCCGGGCCCGGG - Intronic
1062178262 9:135176326-135176348 GGGGCGGGGCCGCAGAGCCCAGG + Intergenic
1062427573 9:136512969-136512991 GGGGCGGGGCCTATGTGGGAGGG - Intronic
1062574718 9:137200775-137200797 GGGGCGTGGCCGCGGCGCCCAGG - Exonic
1062579611 9:137223463-137223485 GGGGCGGGGCCTCGTGGCGGGGG - Intergenic
1062609935 9:137369145-137369167 GGGGCGGGGCCTCAGGGCCGTGG + Intronic
1062653419 9:137590104-137590126 GGGGCGGGGGCGCGGAGCCCGGG - Intronic
1062725883 9:138073230-138073252 GGGGAGGGGCCTTAGAGCCAAGG + Intronic
1203736637 Un_GL000216v2:144144-144166 GGGGCTGGGCCGGGGTCCCAAGG + Intergenic
1185892754 X:3835429-3835451 GGCACGGGGGCTCGGCGCCAGGG + Intronic
1185897862 X:3873849-3873871 GGCACGGGGGCTCGGCGCCAGGG + Intergenic
1185902981 X:3912280-3912302 GGCACGGGGGCTCGGCGCCAGGG + Intergenic
1188482916 X:30653193-30653215 GGGGCGGGGCCTGGGCGCGGTGG - Intergenic
1189328657 X:40129525-40129547 GGGGCCAGGCCTCAGTGGCAGGG + Intronic
1190520652 X:51276619-51276641 GGGGCGGGGGGTCGGGGGCAGGG - Intergenic
1190598696 X:52068866-52068888 GGGGTGGGGCCTCAGGTCCAAGG + Intronic
1190610128 X:52185207-52185229 GGGGTGGGGCCTCAGGTCCAAGG - Intronic
1190881717 X:54496228-54496250 GGGGCGGGGCCCCGGTAACTGGG - Intergenic
1192123296 X:68476940-68476962 GGGGCTGGGCCCCGGCACCAAGG - Intergenic
1192209980 X:69121777-69121799 GGGGCTGGGCCACTGTGCCTGGG - Intergenic
1199724571 X:150568334-150568356 TGGGCGGGGCCAAGATGCCAGGG - Intergenic
1199744917 X:150766464-150766486 GGGGCTGGGGTTCAGTGCCAGGG - Exonic
1200000377 X:153056819-153056841 GGGGCGGGGCCTGGCTGCAGAGG + Intronic
1200003309 X:153072805-153072827 GGGGCGGGGCCTGGCTGCAGAGG + Intronic
1200004414 X:153077204-153077226 GGGGCGGGGCCTGGCTGCAGAGG - Intergenic
1200218338 X:154378648-154378670 GGGGCGGGGCCTGCGCGCGAGGG - Intergenic