ID: 1085051416

View in Genome Browser
Species Human (GRCh38)
Location 11:73382102-73382124
Sequence GAACCCTGGTGGGTTGCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 151}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085051409_1085051416 17 Left 1085051409 11:73382062-73382084 CCCAAGGCCATCGATCTGCGAAG 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1085051416 11:73382102-73382124 GAACCCTGGTGGGTTGCTCCAGG 0: 1
1: 0
2: 1
3: 12
4: 151
1085051410_1085051416 16 Left 1085051410 11:73382063-73382085 CCAAGGCCATCGATCTGCGAAGT 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1085051416 11:73382102-73382124 GAACCCTGGTGGGTTGCTCCAGG 0: 1
1: 0
2: 1
3: 12
4: 151
1085051411_1085051416 10 Left 1085051411 11:73382069-73382091 CCATCGATCTGCGAAGTGACAGA 0: 1
1: 0
2: 0
3: 2
4: 26
Right 1085051416 11:73382102-73382124 GAACCCTGGTGGGTTGCTCCAGG 0: 1
1: 0
2: 1
3: 12
4: 151
1085051408_1085051416 21 Left 1085051408 11:73382058-73382080 CCTGCCCAAGGCCATCGATCTGC 0: 1
1: 0
2: 0
3: 9
4: 113
Right 1085051416 11:73382102-73382124 GAACCCTGGTGGGTTGCTCCAGG 0: 1
1: 0
2: 1
3: 12
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085051416 Original CRISPR GAACCCTGGTGGGTTGCTCC AGG Intronic
900120623 1:1047235-1047257 GCACCCTTGTGGCTTGCTGCTGG + Intronic
900131614 1:1089620-1089642 GAACCCAGAAGGGCTGCTCCTGG - Intronic
902287321 1:15414918-15414940 CCACCCAGCTGGGTTGCTCCAGG + Intronic
902402420 1:16165544-16165566 GCATCCTGGTGGGTTTATCCAGG - Intergenic
902553086 1:17230705-17230727 AAACCCTGGTTGGGTCCTCCTGG + Intronic
903847740 1:26288529-26288551 GAACCCTGGTGGGGTGGTGGGGG - Intronic
904495205 1:30882557-30882579 CAGCCCTGATGGGGTGCTCCTGG - Intronic
905824266 1:41017138-41017160 GAACCATGGTGGCTTGCCCTGGG + Intronic
906207124 1:43992692-43992714 GCCCACTGGTGGGTTGCACCTGG + Intronic
907221349 1:52909146-52909168 GAACCCTGGTGCATTGCTGGTGG + Intronic
908462734 1:64361621-64361643 GAACCCTTGTGCGTTGCTGGTGG + Intergenic
909480532 1:76125174-76125196 GAAACCTTGTTGGCTGCTCCTGG - Intronic
910252757 1:85215405-85215427 GAAACCTAGAGGGTTTCTCCTGG - Intergenic
912166299 1:107045619-107045641 GAACCTTTGTGGGTAGCTCAGGG + Intergenic
921048258 1:211492416-211492438 GCTGCCTGGTGGGTGGCTCCTGG + Exonic
1063893805 10:10657731-10657753 AAAACCTTGTGGGATGCTCCTGG - Intergenic
1066004564 10:31134355-31134377 GACCCGCGGTGGGTTGCGCCAGG + Intergenic
1067084628 10:43231296-43231318 GAAACCTGGTGTCTTGCCCCTGG + Intronic
1068597606 10:58919934-58919956 GAACACTGGTGGGTTGGTCCTGG - Intergenic
1069995926 10:72342207-72342229 GGGCCCTGGTGGGAGGCTCCAGG - Intronic
1074180696 10:111060170-111060192 CAGCCCTGGAGGGCTGCTCCTGG + Intergenic
1078466671 11:11555171-11555193 GATCCCTGATGGGCTGCTCAGGG + Intronic
1078872227 11:15358406-15358428 GAACCCTGGTGGGCTGTTGATGG + Intergenic
1079129945 11:17741493-17741515 GAACCATGGTGGCTTGAGCCAGG - Intronic
1079452635 11:20610364-20610386 GAACCCTGCTGCATTGCTGCAGG + Intronic
1083001073 11:59291168-59291190 GCAACCTGGTGGTCTGCTCCAGG + Intergenic
1084408407 11:68992093-68992115 GAACCCTGATGGGTTGCAAAGGG + Intergenic
1084652669 11:70498387-70498409 GGACCCTGGTGGACTGGTCCTGG + Intronic
1084938149 11:72598266-72598288 GAACCCAGGTAGGTGGCACCAGG + Intronic
1085051416 11:73382102-73382124 GAACCCTGGTGGGTTGCTCCAGG + Intronic
1089397768 11:118146873-118146895 GAGCCCTGGTGGGTAGATCTGGG - Intronic
1090498031 11:127233675-127233697 GAACTCAGGCGAGTTGCTCCAGG - Intergenic
1093596913 12:20973035-20973057 TAACCCTGCTGGGTTTCTCATGG + Intergenic
1096405669 12:51342445-51342467 GAAACCTGGTCCGTGGCTCCTGG - Intronic
1097879133 12:64671296-64671318 GAACCCTGCTGGGGTGACCCAGG - Intronic
1102028054 12:109724599-109724621 GAACCCTGGCAGGTTGCTTCAGG - Intronic
1102030799 12:109739077-109739099 GAAGCCAGGTGGGTAGCTCTAGG + Intronic
1103941371 12:124503072-124503094 GCACCCTTGTGGGTGGCACCCGG - Intronic
1104045022 12:125155813-125155835 GAACCCTGGTGTCTTGCTGGTGG + Intergenic
1106410715 13:29509371-29509393 GAATCCTAGTGGGTCTCTCCTGG - Intergenic
1108918936 13:55653700-55653722 GAATCCTGGAGGTTTGCTCTAGG + Intergenic
1108953807 13:56124738-56124760 GAACCCTGGAGAGTTGCTAGTGG - Intergenic
1109261572 13:60150735-60150757 GAAGCCTGCCAGGTTGCTCCAGG + Intronic
1118614073 14:67563220-67563242 CAACCCTAGTGGTTTGCTTCTGG - Intronic
1119454115 14:74739549-74739571 GAACCCTTGTGCGCTGTTCCTGG + Intergenic
1120521559 14:85532192-85532214 GATCCCTGGGGGGTTGGTCCTGG + Intronic
1121328137 14:93033743-93033765 GAACCAGGGAGGGTTTCTCCTGG + Intronic
1121495059 14:94386374-94386396 GCACCCTGCCGGGTTGCTCTTGG - Intronic
1121890400 14:97584775-97584797 GAACCCTGGATGGTGACTCCTGG + Intergenic
1122619014 14:103042812-103042834 GAACCCTTGTGGGCTGCTGGTGG + Intronic
1124094683 15:26638152-26638174 GAACCCTGGTGGGCTGATGAGGG - Intronic
1126760991 15:51969998-51970020 GAACCCTGGTGCATTGCTGGTGG + Intronic
1129038239 15:72664001-72664023 GGACCCTGGTCCCTTGCTCCAGG - Intronic
1129211649 15:74073230-74073252 GGACCCTGGTCCCTTGCTCCAGG + Intronic
1129398754 15:75267854-75267876 GGACCCTGGTCCCTTGCTCCAGG - Intronic
1129402362 15:75292130-75292152 GGACCCTGGTCCCTTGCTCCAGG - Intronic
1130541940 15:84826756-84826778 GAAACATGGTTGGCTGCTCCAGG - Intronic
1131621983 15:94078217-94078239 AAAGACTGCTGGGTTGCTCCTGG + Intergenic
1132906007 16:2283171-2283193 GGACACTGGTGAGTGGCTCCGGG - Exonic
1133234557 16:4381876-4381898 GAACGCTGGCCGGCTGCTCCTGG + Exonic
1134325125 16:13200560-13200582 GAACCCTGGTGGGTTGGCTTTGG + Intronic
1134614737 16:15642731-15642753 GACCCCTGGTGGGGCCCTCCAGG - Intronic
1135875743 16:26198454-26198476 GAACCTTGTTGGATTGCCCCAGG + Intergenic
1137550171 16:49432090-49432112 GAGCGCTGGTGGCTGGCTCCCGG - Intergenic
1138455290 16:57117401-57117423 TAGCCCTGGAGGATTGCTCCTGG + Intronic
1139287685 16:65830139-65830161 GAACCCAGGTGCTTTCCTCCTGG - Intergenic
1141506857 16:84483626-84483648 GAGCCCTGTTGGCTTGCTCGGGG - Intronic
1141512258 16:84519977-84519999 AAACCCCTGTGGGTTGGTCCGGG - Intronic
1141710891 16:85698392-85698414 GACCCCAGGTGGGCTGCTCCGGG + Intronic
1145273687 17:21417845-21417867 GAACTCTGCTGTGCTGCTCCAGG - Exonic
1145311873 17:21705287-21705309 GAACTCTGCTGTGCTGCTCCAGG - Intergenic
1146314516 17:31796659-31796681 CAACCCTGGTCGCTTGCACCTGG + Intergenic
1146528153 17:33584597-33584619 CAGCCCTGGTTGGCTGCTCCAGG - Intronic
1146612563 17:34320599-34320621 GGACCCTGGAGGGTTTCACCTGG + Intronic
1150017218 17:61570278-61570300 GAACCCTTGTGTATTGCTTCTGG - Intergenic
1150618044 17:66787196-66787218 GAACCTTGTAGTGTTGCTCCTGG + Intronic
1151816446 17:76473704-76473726 GAAGCCTGTGTGGTTGCTCCTGG + Exonic
1152750743 17:82061377-82061399 GACACCTCGTGGGTTGCTCCAGG + Intronic
1158609426 18:58925227-58925249 GATCCCTCGTGTGTTGCTCCTGG - Intronic
1160406833 18:78652210-78652232 GAACCCAGGAGGGCAGCTCCGGG + Intergenic
1162462181 19:10819764-10819786 GAACCCAGGTGGGATACTCAGGG + Intronic
1167811605 19:51837354-51837376 GAACTCTGATTGGTTGCTTCAGG + Intergenic
925057164 2:864377-864399 GAGCCCTGGTGGGTTCTTCTGGG + Intergenic
925367166 2:3318358-3318380 GAGCCGTCGTGGGCTGCTCCAGG + Intronic
925913478 2:8588073-8588095 GAGGCCAGGTGGGTTTCTCCAGG - Intergenic
925913493 2:8588123-8588145 GAGGCCAGGTGGGTTTCTCCAGG - Intergenic
928226770 2:29456098-29456120 GAACCCTCGTGCATTGCTGCTGG + Intronic
935315571 2:101830353-101830375 GAACCCTTGTGAGTAACTCCAGG - Intronic
935792965 2:106611055-106611077 GATCCCAGGCGGGTTCCTCCGGG + Intergenic
936650478 2:114420917-114420939 GAACCCTTTTGGGCTTCTCCAGG + Intergenic
938100392 2:128494011-128494033 GAACCCTGGTGGCAGGCTCCAGG - Intergenic
940005733 2:149008037-149008059 GAACTTTGGTGAGCTGCTCCAGG - Exonic
941860418 2:170273266-170273288 AAATGCAGGTGGGTTGCTCCAGG - Intronic
946459100 2:219853230-219853252 GAACCCTGGTGTGTTGCTGGTGG - Intergenic
946628425 2:221640373-221640395 GAACCCTGGTACACTGCTCCTGG - Intergenic
1169094466 20:2884340-2884362 GAACCTTTGTGAGTTGCTACTGG - Intronic
1169330033 20:4709097-4709119 GCACCCTGGTGGCTTCCTGCAGG - Intergenic
1169692334 20:8345619-8345641 TCACCCTGGTGGGATGCTGCTGG - Intronic
1170138889 20:13105305-13105327 GAATCCTGGTGTGTTGACCCTGG + Intronic
1173566735 20:44044657-44044679 GAACCCTTGTGTGTTGCTGGTGG + Intronic
1175577294 20:60069950-60069972 GAACCCTGATGGGTTCTTCCAGG - Exonic
1178259952 21:31089504-31089526 GAACCCTTGTGGCTTGCTTGTGG - Intergenic
1178803725 21:35820719-35820741 GAACCCTAATAGGGTGCTCCTGG + Intronic
1181081762 22:20420304-20420326 GACCCCTGGTTGTGTGCTCCTGG - Intergenic
1184017889 22:41799904-41799926 GCACCCTCGTGGGTAGATCCTGG + Intergenic
1184621082 22:45677841-45677863 GAACCCTTGTGTGTTGCTAGTGG + Intronic
1184744506 22:46448352-46448374 TACCCCTGGGGGGCTGCTCCAGG + Intronic
954845262 3:53550318-53550340 GAACCCTGCTTGGTGGTTCCAGG - Intronic
956188722 3:66587364-66587386 GAACCCTGGTGCATTGCTTGTGG + Intergenic
956710497 3:72034962-72034984 GATCCCTGGTTTGTGGCTCCTGG + Intergenic
960231833 3:115237524-115237546 GAACCCTTGTGCATTGCTGCTGG - Intergenic
961671980 3:128539544-128539566 GAACCCTCTTGCGTTGCTTCTGG - Intergenic
962800075 3:138882878-138882900 GAACCCGGGAGGGTTGAACCCGG - Intergenic
964026638 3:152081807-152081829 AAACCCTGATGGTTTGATCCAGG - Intergenic
966192131 3:177280985-177281007 GGGCCCTGGTGGGTGTCTCCAGG + Intergenic
968610667 4:1555531-1555553 GAGCCCTGGCAGGGTGCTCCTGG + Intergenic
968660218 4:1795725-1795747 GCACCCTGGGGGGTCACTCCAGG - Intronic
969217515 4:5734139-5734161 GAACCCCGGTGGGTTTATTCAGG + Intronic
969430407 4:7150631-7150653 GAACGATGCTGGGTTTCTCCCGG + Intergenic
975666586 4:76740221-76740243 GAACCCAGGAGGGTTACCCCGGG + Exonic
975995734 4:80311578-80311600 GTAACTTAGTGGGTTGCTCCTGG - Intronic
978159222 4:105526565-105526587 GACTCCTGGGGGGTTCCTCCAGG + Intergenic
982259312 4:153480586-153480608 GAACCCTGGTGAGATACTTCAGG - Intronic
984802237 4:183725859-183725881 GAACCCAAGTGGGTTGCCACAGG - Intergenic
984865215 4:184275111-184275133 AAACCCAGGTGGGTTTCTCATGG + Intergenic
987221120 5:15791605-15791627 GTTCCCTGGTGGGTAGCTCCTGG + Intronic
991711187 5:69410265-69410287 GAACCCTTGTGCATTGCTCATGG - Intronic
995489201 5:112672399-112672421 GAACCCTTGTGCATTGCTTCTGG - Intergenic
997080376 5:130731659-130731681 CAACTCTGGTTGGTTGCTACTGG - Intergenic
997736111 5:136213707-136213729 CAACCCTGGTGGGCTGGCCCAGG - Intronic
999391586 5:151196752-151196774 GAACTCTTGTGGGTTGCTGATGG + Intronic
1001635128 5:173204623-173204645 GAACCCTGGTCCCTTGCTGCTGG - Intergenic
1003639648 6:7865842-7865864 GATCCCTGGTGGGCTGCTTCTGG - Intronic
1003832712 6:10032085-10032107 CAACCCTGGTGGATTGCGTCTGG + Intronic
1003968907 6:11279929-11279951 GAAACATCGTGGGTGGCTCCCGG + Intronic
1007763573 6:44148410-44148432 GAGCCCTGGAGGGCTGCTCAGGG - Intronic
1010569216 6:77457933-77457955 GCCCCCTGGTGGATTGTTCCAGG + Intergenic
1013146664 6:107400717-107400739 GCTCCCTGGAGTGTTGCTCCAGG + Intronic
1015078666 6:129195786-129195808 GAATCCTGCTGGTTTGCTGCAGG + Intronic
1015120576 6:129697044-129697066 GAAGCCTGGTAGCTTCCTCCTGG + Intronic
1017101901 6:150856157-150856179 GGACCCAAGTGGGTTGCTGCTGG - Intergenic
1019528349 7:1491286-1491308 GCACCCATGTGGGTTGTTCCTGG - Intronic
1021534693 7:21689934-21689956 GGACCCAAGTGGGTTGCTGCTGG - Intronic
1021556484 7:21923842-21923864 AAACCCTGCTGAGTTGCTGCTGG + Intronic
1028572075 7:92301304-92301326 GAACCCTGGTACATTGCTCATGG - Intronic
1033523106 7:142182191-142182213 AAACCCTGGTGGGTTGGTACTGG + Intronic
1035526038 8:314153-314175 GCACACGGGAGGGTTGCTCCAGG + Intergenic
1036617678 8:10401443-10401465 GAACCCTTGTGCATTGCTACTGG + Intronic
1036776038 8:11613704-11613726 GGACCCTGGGCGGCTGCTCCGGG - Intergenic
1037603268 8:20416902-20416924 GAGCAGTGGTGGGTTGCTCCAGG + Intergenic
1039742448 8:40395069-40395091 AAACCCTGGGAGGATGCTCCTGG + Intergenic
1041555103 8:59145001-59145023 GAACCCTTGTGTATTGCTGCTGG - Intergenic
1048944889 8:139435993-139436015 GAACCCTGGTGGGTGCCAGCTGG - Intergenic
1050311248 9:4355035-4355057 GAACCCTGGAGGCTTGAACCCGG + Intergenic
1052863348 9:33450282-33450304 GAACCCAGGTGGGGTGATCTTGG - Intergenic
1053030690 9:34774937-34774959 GAACCCTGGTGCATTGCATCTGG + Intergenic
1053034457 9:34812321-34812343 GAACCCTGGTGCATTGCTGGTGG + Intergenic
1053115873 9:35501692-35501714 GAACCATGGTTGGCTGCTACTGG - Intronic
1057842554 9:98497760-98497782 GAACCCTTGTGTGTTGCTGGTGG + Intronic
1058842543 9:108924047-108924069 GAAGCCTGGGGGTTTGCACCAGG - Intronic
1059254305 9:112914737-112914759 CAATGCTTGTGGGTTGCTCCTGG - Intergenic
1190259560 X:48789592-48789614 GAACTCTGGTGGGCCTCTCCAGG + Intronic
1192413568 X:70956651-70956673 GAACCCTTGTGCATTGCTGCTGG + Intergenic
1195348304 X:103973365-103973387 GAGCTCTGGTTGGTTGCTTCAGG - Intergenic
1195359138 X:104065476-104065498 GAGCTCTGGTTGGTTGCTTCAGG + Intergenic