ID: 1085051483

View in Genome Browser
Species Human (GRCh38)
Location 11:73382330-73382352
Sequence TGCCCCCAATCACCCTGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 137}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085051483_1085051492 21 Left 1085051483 11:73382330-73382352 CCAGGTCAGGGTGATTGGGGGCA 0: 1
1: 0
2: 3
3: 12
4: 137
Right 1085051492 11:73382374-73382396 GGGACTTGGGATCAGTTTTATGG 0: 1
1: 0
2: 0
3: 18
4: 239
1085051483_1085051494 26 Left 1085051483 11:73382330-73382352 CCAGGTCAGGGTGATTGGGGGCA 0: 1
1: 0
2: 3
3: 12
4: 137
Right 1085051494 11:73382379-73382401 TTGGGATCAGTTTTATGGCCGGG 0: 1
1: 0
2: 2
3: 13
4: 129
1085051483_1085051490 7 Left 1085051483 11:73382330-73382352 CCAGGTCAGGGTGATTGGGGGCA 0: 1
1: 0
2: 3
3: 12
4: 137
Right 1085051490 11:73382360-73382382 TGCTGAGCACATTAGGGACTTGG 0: 1
1: 0
2: 0
3: 11
4: 122
1085051483_1085051495 27 Left 1085051483 11:73382330-73382352 CCAGGTCAGGGTGATTGGGGGCA 0: 1
1: 0
2: 3
3: 12
4: 137
Right 1085051495 11:73382380-73382402 TGGGATCAGTTTTATGGCCGGGG 0: 1
1: 0
2: 0
3: 5
4: 76
1085051483_1085051486 0 Left 1085051483 11:73382330-73382352 CCAGGTCAGGGTGATTGGGGGCA 0: 1
1: 0
2: 3
3: 12
4: 137
Right 1085051486 11:73382353-73382375 GGGCCCATGCTGAGCACATTAGG 0: 1
1: 0
2: 2
3: 9
4: 124
1085051483_1085051487 1 Left 1085051483 11:73382330-73382352 CCAGGTCAGGGTGATTGGGGGCA 0: 1
1: 0
2: 3
3: 12
4: 137
Right 1085051487 11:73382354-73382376 GGCCCATGCTGAGCACATTAGGG 0: 1
1: 0
2: 0
3: 8
4: 121
1085051483_1085051491 8 Left 1085051483 11:73382330-73382352 CCAGGTCAGGGTGATTGGGGGCA 0: 1
1: 0
2: 3
3: 12
4: 137
Right 1085051491 11:73382361-73382383 GCTGAGCACATTAGGGACTTGGG 0: 1
1: 0
2: 1
3: 9
4: 115
1085051483_1085051493 25 Left 1085051483 11:73382330-73382352 CCAGGTCAGGGTGATTGGGGGCA 0: 1
1: 0
2: 3
3: 12
4: 137
Right 1085051493 11:73382378-73382400 CTTGGGATCAGTTTTATGGCCGG 0: 1
1: 0
2: 0
3: 7
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085051483 Original CRISPR TGCCCCCAATCACCCTGACC TGG (reversed) Intronic