ID: 1085051836

View in Genome Browser
Species Human (GRCh38)
Location 11:73383976-73383998
Sequence CTGGAAACACAGCTGGACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 233}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085051836_1085051848 16 Left 1085051836 11:73383976-73383998 CCTGTGTCCAGCTGTGTTTCCAG 0: 1
1: 0
2: 1
3: 30
4: 233
Right 1085051848 11:73384015-73384037 GAGGCCAGAGGGAGGTCCACAGG 0: 1
1: 0
2: 1
3: 25
4: 282
1085051836_1085051841 -3 Left 1085051836 11:73383976-73383998 CCTGTGTCCAGCTGTGTTTCCAG 0: 1
1: 0
2: 1
3: 30
4: 233
Right 1085051841 11:73383996-73384018 CAGGCAACCCTAGCCTCTGGAGG 0: 1
1: 0
2: 3
3: 19
4: 141
1085051836_1085051850 22 Left 1085051836 11:73383976-73383998 CCTGTGTCCAGCTGTGTTTCCAG 0: 1
1: 0
2: 1
3: 30
4: 233
Right 1085051850 11:73384021-73384043 AGAGGGAGGTCCACAGGCTCAGG 0: 1
1: 0
2: 5
3: 35
4: 294
1085051836_1085051839 -6 Left 1085051836 11:73383976-73383998 CCTGTGTCCAGCTGTGTTTCCAG 0: 1
1: 0
2: 1
3: 30
4: 233
Right 1085051839 11:73383993-73384015 TTCCAGGCAACCCTAGCCTCTGG 0: 1
1: 0
2: 3
3: 8
4: 146
1085051836_1085051843 4 Left 1085051836 11:73383976-73383998 CCTGTGTCCAGCTGTGTTTCCAG 0: 1
1: 0
2: 1
3: 30
4: 233
Right 1085051843 11:73384003-73384025 CCCTAGCCTCTGGAGGCCAGAGG 0: 1
1: 0
2: 1
3: 22
4: 297
1085051836_1085051845 5 Left 1085051836 11:73383976-73383998 CCTGTGTCCAGCTGTGTTTCCAG 0: 1
1: 0
2: 1
3: 30
4: 233
Right 1085051845 11:73384004-73384026 CCTAGCCTCTGGAGGCCAGAGGG 0: 1
1: 0
2: 0
3: 18
4: 239
1085051836_1085051846 8 Left 1085051836 11:73383976-73383998 CCTGTGTCCAGCTGTGTTTCCAG 0: 1
1: 0
2: 1
3: 30
4: 233
Right 1085051846 11:73384007-73384029 AGCCTCTGGAGGCCAGAGGGAGG 0: 1
1: 0
2: 4
3: 53
4: 489

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085051836 Original CRISPR CTGGAAACACAGCTGGACAC AGG (reversed) Intronic
900102892 1:970392-970414 CTGGAACCGCAGCTGGACCTTGG - Exonic
900226646 1:1536218-1536240 CTTGGAGCAGAGCTGGACACAGG + Intronic
900485659 1:2921440-2921462 CTGGATGGACAGATGGACACAGG - Intergenic
900485683 1:2921566-2921588 CTGGATGGACAGATGGACACAGG - Intergenic
900485691 1:2921608-2921630 CTGGATGGACAGATGGACACAGG - Intergenic
900485699 1:2921650-2921672 CTGGATGGACAGATGGACACAGG - Intergenic
900485769 1:2921986-2922008 CTGGATAGACAGATGGACAGAGG - Intergenic
900542923 1:3212967-3212989 CTGGCAGCAGAGCTGGACACAGG + Intronic
900827283 1:4936935-4936957 GGGGAAACACAGCTGTACAATGG + Intergenic
900963878 1:5944207-5944229 CTGTAAGCACAGCTGAAAACAGG - Intronic
902200467 1:14829791-14829813 CTGGAAAGACAGGCAGACACTGG + Intronic
902724491 1:18325746-18325768 CTGGGAAAACAGATGGAGACAGG - Intronic
903909712 1:26714163-26714185 CTGAAAAGACAGCTGGTGACTGG + Intronic
906380366 1:45328563-45328585 ATAGAATCACAGCGGGACACAGG - Intergenic
907272603 1:53299618-53299640 CTGGGCACACAGGTGGGCACAGG - Intronic
908321818 1:62986039-62986061 CTGGGAACACTGCAGGACCCAGG + Intergenic
908696514 1:66848732-66848754 CTGGGAACACTGATGGGCACAGG + Intronic
909018279 1:70403511-70403533 CAGGAACCACAGCTGGGCCCTGG + Intergenic
913530174 1:119728377-119728399 CTGGAAGGACAGATGGACAATGG - Intronic
917033443 1:170720382-170720404 AAAGAAACACAGCTGGAAACAGG - Intronic
921883540 1:220280331-220280353 CTGGGAACACATCTTGACTCCGG - Intergenic
923247446 1:232146159-232146181 CTGCAAACATAGTGGGACACTGG - Intergenic
923493119 1:234501773-234501795 CTGGAAGGACACCTGGAAACGGG + Intergenic
923544557 1:234914700-234914722 CTGGAGATACAGCTGTAAACAGG + Intergenic
1063318953 10:5034369-5034391 CAGGAGACACACCTGGTCACTGG + Intronic
1064620308 10:17208879-17208901 CTGCAAAGACAGCTTGATACAGG + Intergenic
1065247802 10:23776460-23776482 CTGAAAGCACAGCTTGACATAGG - Intronic
1065287159 10:24197083-24197105 CTGAACACACAGCTAGGCACAGG + Intronic
1065378209 10:25063702-25063724 GTGGGAACAAAGATGGACACGGG - Intergenic
1065814419 10:29471193-29471215 CTGGAAACACTGCAGGAAACAGG + Exonic
1067036694 10:42926042-42926064 CTAAAAACACAGCTGGAATCAGG - Intergenic
1067158708 10:43804141-43804163 CTGGAAACTCACCTGGAAAACGG + Intergenic
1068424430 10:56840275-56840297 CTGGAAACAAAACTGGCTACTGG + Intergenic
1070183191 10:74034334-74034356 CAGGAAACATAGCTGGAAAATGG - Intronic
1071596096 10:86927041-86927063 TTAGAAACACTTCTGGACACTGG - Exonic
1072350994 10:94556922-94556944 CAGGAAACACATCTGGAGACAGG - Intronic
1076150989 10:128161861-128161883 CTGGCATCTCAACTGGACACAGG - Intergenic
1076601945 10:131663039-131663061 CTGGACACCCAGCAGGACACAGG + Intergenic
1076647385 10:131962593-131962615 CCTGAAACTCAGCTGGAGACTGG + Intergenic
1077036376 11:496829-496851 CTGGAAAAACATCCTGACACAGG + Intronic
1077209828 11:1364783-1364805 CTGGAAACACTGCTGGTACCAGG + Intergenic
1079282071 11:19096566-19096588 CTAGAAACACAGCTGGAGACTGG + Intergenic
1085051836 11:73383976-73383998 CTGGAAACACAGCTGGACACAGG - Intronic
1085136492 11:74093895-74093917 CTGGAACCTCAGCTGGCAACAGG + Exonic
1086334415 11:85785322-85785344 CAAGCAACACAGCTGGACCCAGG + Intronic
1086740682 11:90364312-90364334 CTGGAATAAAAGCTGGAGACTGG - Intergenic
1089127061 11:116183991-116184013 CTGGTGTCACAGCTGGACAGAGG + Intergenic
1089191083 11:116653770-116653792 CTGCATACACTGCTGGGCACAGG - Intergenic
1089907599 11:122058494-122058516 CGGGAAACACAGCTTCACATGGG + Intergenic
1090411425 11:126512400-126512422 CTGGAAGCCCCGCTGGCCACTGG - Intronic
1091092226 11:132782263-132782285 ATGGAAACCCAGCTGGCAACAGG - Intronic
1095534275 12:43227660-43227682 CAGGAAACAGAGATGGATACGGG + Intergenic
1097996722 12:65896004-65896026 CAGGAAACTCAGCAGGACAAAGG + Intronic
1099472866 12:83073105-83073127 CTGGAAACACATCAAAACACAGG - Intronic
1100575663 12:95889710-95889732 CTGCAAACTCAGATGGATACAGG + Intronic
1101486882 12:105173494-105173516 CTTGAAGCACAGCTGGTCATGGG - Intronic
1101870054 12:108558680-108558702 CAGCAAACACAGCGTGACACTGG - Intronic
1103186922 12:118966226-118966248 CTGAGAACACACATGGACACAGG - Intergenic
1104803048 12:131567841-131567863 CTGGGGACTCAGCTGGACCCTGG - Intergenic
1105705147 13:22963708-22963730 CTGGAAATGCAGGTGGAAACAGG + Intergenic
1105858060 13:24388724-24388746 CTGGAAATGCAGGTGGAAACAGG + Intergenic
1106157210 13:27170853-27170875 CTGGACACACGGCTGGAAACGGG + Intronic
1106177316 13:27342454-27342476 CTGTGGACACAGCTGGTCACAGG + Intergenic
1108672966 13:52710470-52710492 GGGGAATGACAGCTGGACACAGG - Intronic
1109024300 13:57140336-57140358 CGGGAAACACAGCAGGACGCTGG - Intergenic
1109025205 13:57146441-57146463 CGGGAAACACAGCAGGACGCTGG - Intronic
1109026195 13:57153014-57153036 CGGGAAACACAGCAGGACGCTGG - Intronic
1109027187 13:57159585-57159607 CGGGAAACACAGCAGGACGCTGG - Intergenic
1109028173 13:57166150-57166172 CGGGAAACACAGCAGGACGCTGG - Intergenic
1109029160 13:57172721-57172743 CGGGAAACACAGCAGGACGCTGG - Intergenic
1109953049 13:69527624-69527646 CTGTTGAAACAGCTGGACACAGG + Intergenic
1110337258 13:74346748-74346770 CTGGAAAGACAGCTGAAGCCAGG + Intergenic
1111168273 13:84491558-84491580 GAGGAAAAACAGCTGGACATTGG + Intergenic
1111590397 13:90340278-90340300 GAGGAAACACAGCAGAACACTGG + Intergenic
1112015063 13:95324898-95324920 CTGGATACAGAGCTCCACACAGG + Intergenic
1112563003 13:100530120-100530142 CTGGAGACACAGTTGGAGAAGGG + Exonic
1112668983 13:101613336-101613358 CTGGGAACACAGGAGGACCCTGG - Intronic
1113507453 13:110827016-110827038 CTGGACAATGAGCTGGACACTGG - Intergenic
1113816370 13:113174257-113174279 CTTCAAACACAGCTGGGCAGAGG + Intergenic
1115417226 14:33149978-33150000 ATGAAAACACACATGGACACAGG - Intronic
1115508494 14:34116190-34116212 GGGGAAACACTGCAGGACACTGG - Intronic
1115718422 14:36131751-36131773 CTAGAAATACAGCTTGAAACAGG - Intergenic
1116787289 14:49301609-49301631 CTGAAAACACAGAGGGACTCAGG + Intergenic
1118566419 14:67145989-67146011 AGGGAGACACAGCTGGTCACTGG + Intronic
1122405902 14:101500891-101500913 CTGGACTCGGAGCTGGACACAGG + Intergenic
1124577383 15:30921858-30921880 CTGGGAACACAGCAGGTCACAGG - Intronic
1126067044 15:44833971-44833993 CTGGAAAGATGGCTGGAAACAGG + Intergenic
1128638689 15:69319595-69319617 TTGGAAACACAGCTGGGCTTGGG + Intronic
1129031738 15:72623655-72623677 CTGGAAACACATCTGAATTCTGG + Intergenic
1129167209 15:73785394-73785416 CTGGCCCCACAGCTGCACACAGG + Intergenic
1129218199 15:74113809-74113831 CTGGAAACACATCTGAATTCTGG - Intronic
1129678595 15:77645420-77645442 CTAGAAAGAGAGCTGGGCACTGG - Intronic
1130558330 15:84939128-84939150 CTGGAAACAAAGCAAGACCCTGG + Intronic
1131101303 15:89691980-89692002 CTGGAAACACAGCTGGAATATGG + Intronic
1132228687 15:100165265-100165287 CTCAGAGCACAGCTGGACACAGG + Intronic
1132638074 16:963105-963127 CTGGACACAAGGCTGGACACAGG + Intronic
1133512586 16:6474106-6474128 CTGCATACACAAATGGACACTGG - Intronic
1134518763 16:14908062-14908084 CTGGAGGCAGAGCTGGAGACAGG - Intronic
1134706434 16:16306715-16306737 CTGGAGGCAGAGCTGGAGACAGG - Intergenic
1134961106 16:18405395-18405417 CTGGAGGCAGAGCTGGAGACAGG + Intergenic
1134965408 16:18487998-18488020 CTGGAGGCAGAGCTGGAGACAGG + Intronic
1136458203 16:30394451-30394473 CTGGAAACACAGCTCCAGCCAGG + Intronic
1137456695 16:48623167-48623189 ATGGGAACACACCTGGACACAGG - Intergenic
1137669712 16:50272056-50272078 CAGGAAACACAACTGGAAACGGG - Intronic
1137947034 16:52743427-52743449 CTTGCAACACAGCTTGACCCAGG + Intergenic
1138490848 16:57375655-57375677 CAGGACACACAGCTGGGCAATGG + Intronic
1138614975 16:58158033-58158055 CTGGAAAAACAGGCGGCCACGGG + Exonic
1139668111 16:68472437-68472459 TGGGAAAGACAGCTGGACATGGG + Intergenic
1139740968 16:69034500-69034522 CTGTAACCACAGCTGGAGCCTGG - Intronic
1141159641 16:81620569-81620591 CTGCACACACAGCTGGACTTAGG - Intronic
1141649564 16:85385782-85385804 GTGGAGACAGAGCTGGACAGGGG + Intergenic
1143009981 17:3860916-3860938 CTGGAAACATGGATGGACAAGGG - Intronic
1144516364 17:15919786-15919808 CTGTACACCCAGCTGGCCACTGG - Intergenic
1145007019 17:19343858-19343880 CTGGGAACACAGAAGAACACAGG + Intronic
1145154717 17:20535277-20535299 CTGGAAACACAGCTGTGAAAAGG + Intergenic
1145311955 17:21705775-21705797 CAGAAAACACATCTCGACACAGG - Intergenic
1146217350 17:30988200-30988222 GTGGTAATACAGCTGGACTCTGG - Intronic
1147299825 17:39517455-39517477 CAGGCCACACAGCTGGACAAGGG - Exonic
1153444112 18:5153026-5153048 CTTGAAACACAGATGGACTTTGG + Intronic
1153595530 18:6721340-6721362 CTGGAGACAAAGCTGGAGACAGG - Intergenic
1154058733 18:11037659-11037681 CTGGAAAGAGGGCTGGAAACAGG - Intronic
1157156044 18:45267145-45267167 CTGACAACACATCCGGACACAGG + Intronic
1157175051 18:45443977-45443999 CTGGAAACACACATGGAGAGTGG + Intronic
1157809369 18:50683795-50683817 CTGGCAACACAGCTGGATGTAGG + Intronic
1158041843 18:53103900-53103922 CTAGAAACACAGCTGGACTAGGG + Intronic
1160870888 19:1277345-1277367 CTGGAGACTCAGCAGGACCCTGG + Intronic
1162439534 19:10683871-10683893 CCGGAGACACTGCTGGACCCCGG + Intronic
1163428397 19:17251793-17251815 ATGTAAACACACCTGTACACCGG + Intronic
1163500076 19:17671088-17671110 TTGGAAACAGGGCTGGACACAGG + Intronic
1163721582 19:18900450-18900472 CTGGAGACACAGGCAGACACGGG + Intronic
1164434992 19:28221366-28221388 CTGGACATACAACTGGACAGTGG - Intergenic
1164781063 19:30893253-30893275 CTGAAAACACAGATGGAGAATGG + Intergenic
1165846060 19:38818398-38818420 CTGGGGACACAGGTGGAAACAGG - Intronic
1166342340 19:42146222-42146244 CTGGAGACACAGATGGAACCAGG + Intronic
1166720447 19:44993094-44993116 CTGGAAACACAGAGGGACAGAGG - Exonic
1168094618 19:54107618-54107640 CTGGAAGAACATCTGGACCCAGG - Intronic
1168522492 19:57063400-57063422 GAGGCAACACAGGTGGACACGGG + Intergenic
925521109 2:4746851-4746873 CTGGCTACACAGGTGGGCACAGG + Intergenic
926966722 2:18423171-18423193 CTGGCTACACAGCTTGGCACGGG - Intergenic
927061319 2:19424946-19424968 CTGGATATACAGATGGAGACTGG - Intergenic
928666903 2:33558696-33558718 CTGGAGTCACTGCTGGACACAGG + Exonic
929693179 2:44091490-44091512 CTGGAGACTCTGCAGGACACGGG - Intergenic
929977475 2:46649100-46649122 ATGGAACCACAGTTAGACACAGG + Intergenic
931287080 2:60841222-60841244 CTGGAGAGACACCTGGGCACAGG + Intergenic
933700795 2:85254077-85254099 CAGGAAGCCCAGCTGGGCACGGG + Intronic
934735820 2:96689341-96689363 CTGGCAGGACAGCTGGACAGTGG + Intergenic
937510490 2:122589483-122589505 CTGGTAACACAGCAAGACTCTGG + Intergenic
938374856 2:130798458-130798480 CTGGGTACACAGCAGGACAATGG + Intergenic
938689837 2:133777286-133777308 CTAGAAAAGCCGCTGGACACTGG - Intergenic
939107955 2:137971556-137971578 CTGGAAAGGTAGATGGACACAGG + Intronic
942960477 2:181824497-181824519 CAGAAAACTCATCTGGACACTGG - Intergenic
943926148 2:193782937-193782959 ATGGGAACACACATGGACACAGG - Intergenic
945039406 2:205731518-205731540 ATGGAACCACAGCTGGTGACAGG + Intronic
945431771 2:209772525-209772547 CTGGAAAAACAACAGGTCACTGG - Intronic
946064142 2:216971947-216971969 ATGGAAGCAGAGCTGGACAATGG + Intergenic
948046555 2:234950676-234950698 CAGGAGACACAGGTGGACAGAGG - Intergenic
948262361 2:236613605-236613627 CTGGACACAGAGCTGGAGACAGG - Intergenic
948580481 2:238984398-238984420 CTGACTACACAGATGGACACTGG - Intergenic
948759133 2:240179677-240179699 ACAGAAACACAGGTGGACACAGG + Intergenic
1170056576 20:12211524-12211546 ATGAAAACACAGATGCACACTGG + Intergenic
1171023462 20:21607961-21607983 CTGGAAACCCACCTGCACAGAGG - Intergenic
1172480465 20:35268295-35268317 CTGGCCACACTGCTGGCCACTGG + Intronic
1172752078 20:37258178-37258200 ATGGAAACACGGCTGGCCTCGGG + Intronic
1172840734 20:37901701-37901723 CTGTACACACGGCTGGACGCGGG + Intergenic
1173728519 20:45313108-45313130 CTGGAAAAACAGCTGTGAACTGG + Intronic
1174007168 20:47419949-47419971 CTGGGAACACAGCAGCAAACTGG + Intergenic
1175335076 20:58190418-58190440 CTGGAACCACAGGTGTCCACGGG + Intergenic
1175644488 20:60659192-60659214 CCGGAGACCCTGCTGGACACAGG + Intergenic
1176055174 20:63141438-63141460 CTGCAACCCCAGCTGGACATGGG - Intergenic
1176382770 21:6121349-6121371 CTGGACACACACCTGCACATTGG + Exonic
1179711981 21:43268777-43268799 CTGGCAACTCAGCTGGAAATGGG - Intergenic
1179721134 21:43316535-43316557 CTGGGGACTCAGCTGGACTCAGG - Intergenic
1179740699 21:43416890-43416912 CTGGACACACACCTGCACATTGG - Exonic
1180196314 21:46196511-46196533 CTGCAGACACAGCTGCAAACAGG + Intronic
1182108169 22:27704165-27704187 CTGGACACACAGGCGCACACTGG + Intergenic
1182373773 22:29830967-29830989 ATGGAAACACTGATGGAGACTGG - Intronic
1183772477 22:39938787-39938809 CGGGGAACACACCTGCACACAGG + Intronic
1184738548 22:46413268-46413290 CAGGACACACAACTGGAAACAGG + Intronic
1185224080 22:49643239-49643261 CTGGACACACAGTTTGACCCAGG + Intronic
1185420630 22:50732424-50732446 CTGGGCAAACAGCTGGACCCAGG - Intergenic
950227291 3:11246331-11246353 ATGGAAACAGTGCTGGACAGAGG - Intronic
950718912 3:14868578-14868600 CTAGATTCACAGCTGCACACTGG + Intronic
951744632 3:25963522-25963544 CCAGAAACAGAGCTGAACACTGG - Intergenic
953449955 3:42997598-42997620 CTGGAATAACAGCTGCACAATGG + Intronic
953750836 3:45607267-45607289 CAGGGAAACCAGCTGGACACAGG + Intronic
955707171 3:61739757-61739779 GTGCAAACACAGATGGCCACAGG + Intronic
956850014 3:73220295-73220317 TTGTAAACCCAGCTGGTCACTGG + Intergenic
956912035 3:73828135-73828157 CTTGAAACTAAGCTGGGCACTGG + Intergenic
957891836 3:86369311-86369333 CTGTACACACAGCTGCACACAGG - Intergenic
960520337 3:118647306-118647328 CTGGAAATGTAGCTGGACAGGGG - Intergenic
961695628 3:128702293-128702315 CTATAAACAAAGCTGGAGACTGG - Intergenic
963110380 3:141683330-141683352 CTGGTAACACTGCAGGATACTGG + Intergenic
963773064 3:149409172-149409194 CTGGAAACACAGGTGTGAACTGG - Intergenic
964047102 3:152342093-152342115 TTGGCCTCACAGCTGGACACAGG + Intronic
965401874 3:168222132-168222154 CTGAAAACAGAGCTTTACACTGG + Intergenic
965564468 3:170098672-170098694 ATGGACACACAGCTGTACACAGG - Intronic
969119827 4:4899933-4899955 CTGGAAACAAAGCAGGTCAAGGG - Intergenic
969694916 4:8729108-8729130 CTAGACAGACAGATGGACACTGG + Intergenic
970350037 4:15193128-15193150 GTGGACACAAAGCTGGACTCCGG + Intergenic
972548257 4:40102993-40103015 TTGTAACCACAGCTGCACACTGG + Exonic
975348204 4:73318393-73318415 CTGGTGACACAGCTGGGCATTGG - Intergenic
978502590 4:109424821-109424843 AAGGAAACACAGCTGGGCCCAGG - Intergenic
980144732 4:128967928-128967950 GTGGAAACACTTCTGGACATAGG - Intronic
985551269 5:534749-534771 CTGGACAAGCAGCTGGACTCGGG - Intergenic
986720340 5:10556614-10556636 CTGTAAACAGAGCTGGAAAGTGG - Intergenic
988282069 5:29162492-29162514 CTGTAAACACAGCAGCACAGAGG + Intergenic
989090559 5:37725878-37725900 CTGGAAAGACAATTGGACAGTGG - Intronic
992751713 5:79868536-79868558 CTGGAAACGAGGCTGGAGACAGG + Intergenic
993265070 5:85716238-85716260 CTCAAAACACAGATGGAAACAGG - Intergenic
993870512 5:93248153-93248175 GAGGAAACAGAGCTGGAGACAGG - Intergenic
997144793 5:131421191-131421213 CTGGGACCACAGCTGTGCACTGG + Intergenic
998531806 5:142892039-142892061 CTGGACACACACCTGCACAGAGG + Intronic
1000397103 5:160787474-160787496 ATGGAAACCTAGCTGGACCCAGG - Intronic
1002591739 5:180295362-180295384 CTGCATACACAGCTGGCCTCCGG - Intergenic
1003556789 6:7147004-7147026 CTCCAAAAACAGCTGGAGACTGG - Intronic
1008215505 6:48783040-48783062 TTGGAACTACAGCTGGACATTGG - Intergenic
1010899748 6:81411904-81411926 ATGGAAAGACAGCTAGAGACTGG + Intergenic
1011073174 6:83408281-83408303 GTGGAATCACAGCAGGTCACAGG - Intronic
1012019414 6:93898314-93898336 CTGGAGACACAGAGAGACACAGG - Intergenic
1013072947 6:106745467-106745489 CTGAATTCACAGCTGAACACAGG - Intergenic
1013187170 6:107769772-107769794 CTCCATACACAGCTGGACACTGG - Intronic
1015205435 6:130632860-130632882 ATGTAAATACTGCTGGACACAGG - Intergenic
1015936686 6:138411815-138411837 CTGGAACCACAGGTGCACATCGG - Intronic
1017477827 6:154816202-154816224 GTGGAGACACAGCTGGACTTAGG + Intronic
1018266864 6:162034368-162034390 CTGGTAAAACAGCTAGAAACTGG + Intronic
1018955226 6:168405216-168405238 CTGGAAACAAACCATGACACAGG + Intergenic
1019347428 7:537919-537941 CTGGGAACAGCGCTGGGCACAGG + Intergenic
1019911440 7:4102685-4102707 CTGGAAAAACTGGTGGAAACTGG - Intronic
1025098747 7:56117531-56117553 CTGGGGCCACAGGTGGACACAGG - Intergenic
1026009799 7:66628266-66628288 CGGGACACACAGATGGAGACAGG - Intergenic
1027559946 7:79717181-79717203 AGGGAAACACAGATGGACTCAGG + Intergenic
1031692882 7:124812651-124812673 CTGAAAGCACAGATGAACACAGG - Intergenic
1033886050 7:145947107-145947129 GTGGAAACACTTCAGGACACTGG + Intergenic
1039032538 8:33325915-33325937 CTGGAAACACAGGTGGGCGCGGG - Intergenic
1041075557 8:54166472-54166494 CAGGACACAATGCTGGACACTGG + Intergenic
1042150807 8:65781468-65781490 CAGGGAACACAGGTAGACACAGG + Intronic
1044291837 8:90481074-90481096 CTGGAAACACTTCAGGACATTGG + Intergenic
1046194731 8:110846478-110846500 CAGAAAACACTACTGGACACTGG - Intergenic
1047447180 8:124929995-124930017 CTGGAAAGACAGTTGGGCTCTGG - Intergenic
1048302894 8:133264724-133264746 CTCAAAACACAGTTGGAAACAGG - Intronic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1049681045 8:143918401-143918423 CTGGATGCCCAGCTGGCCACCGG - Exonic
1050148927 9:2599690-2599712 CTGGTAACACAGCTGTGCAAAGG + Intergenic
1050451518 9:5786593-5786615 CTGAAGAAACAGCTTGACACAGG + Exonic
1051439957 9:17073216-17073238 CTAGATACAGAGCTAGACACAGG - Intergenic
1052382352 9:27785161-27785183 CTGGAAACAGAGCTGAAGCCAGG - Intergenic
1052834674 9:33241527-33241549 CTGGAAACAGACCTGGGCACAGG + Intronic
1053549795 9:39064460-39064482 CTGGAGAAACAGCTAGACACAGG - Intergenic
1053813906 9:41884555-41884577 CTGGAGAAACAGCTAGACACAGG - Intergenic
1054616690 9:67302885-67302907 CTGGAGAAACAGCTAGACACAGG + Intergenic
1055717052 9:79129213-79129235 CAGGACACACAGAAGGACACAGG + Intergenic
1056210831 9:84363712-84363734 TTGGAAACACAGTGGGACATGGG - Intergenic
1056630130 9:88286657-88286679 CTGTAATCACAGCAGGAGACGGG + Intergenic
1057274649 9:93669890-93669912 CTGGTAACAGAGGTGGGCACAGG + Intronic
1057408155 9:94792466-94792488 CTGTAAACACAGAAGGCCACAGG - Intronic
1060994719 9:127869427-127869449 TTGGTTACACAGCTGGACAGAGG - Intronic
1061398946 9:130358010-130358032 CTGGCAAGCCAGCTGGGCACAGG + Intronic
1061964430 9:134005052-134005074 CTGGGGACACAGCTGGGCATGGG - Intergenic
1061995088 9:134179140-134179162 CTGGAAAGACAGAGGAACACGGG - Intergenic
1062088260 9:134659808-134659830 GTGCACACACAGCTGGGCACAGG - Intronic
1189847268 X:45149161-45149183 GTGGAAACACACCTGGATGCAGG + Exonic
1191726032 X:64282308-64282330 TTGGAACCACATGTGGACACAGG + Intronic
1192568829 X:72185420-72185442 GTGGAAGCACAGAGGGACACTGG - Intronic
1200775493 Y:7166846-7166868 ATGCAACCACAGCTGGAAACTGG - Intergenic
1201597971 Y:15693584-15693606 CTGTGAACACAGCTTGACAAGGG + Intergenic