ID: 1085051962

View in Genome Browser
Species Human (GRCh38)
Location 11:73384600-73384622
Sequence ACCCCATACTTTGTATCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 83}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085051960_1085051962 7 Left 1085051960 11:73384570-73384592 CCAGTGCAAGACAGAGCAGAGCA 0: 1
1: 0
2: 3
3: 31
4: 266
Right 1085051962 11:73384600-73384622 ACCCCATACTTTGTATCCCCAGG 0: 1
1: 0
2: 1
3: 4
4: 83
1085051958_1085051962 29 Left 1085051958 11:73384548-73384570 CCTCTGCAGGCAGGCCACAGAGC 0: 1
1: 0
2: 2
3: 52
4: 546
Right 1085051962 11:73384600-73384622 ACCCCATACTTTGTATCCCCAGG 0: 1
1: 0
2: 1
3: 4
4: 83
1085051957_1085051962 30 Left 1085051957 11:73384547-73384569 CCCTCTGCAGGCAGGCCACAGAG 0: 1
1: 0
2: 1
3: 33
4: 401
Right 1085051962 11:73384600-73384622 ACCCCATACTTTGTATCCCCAGG 0: 1
1: 0
2: 1
3: 4
4: 83
1085051959_1085051962 15 Left 1085051959 11:73384562-73384584 CCACAGAGCCAGTGCAAGACAGA 0: 1
1: 0
2: 4
3: 26
4: 317
Right 1085051962 11:73384600-73384622 ACCCCATACTTTGTATCCCCAGG 0: 1
1: 0
2: 1
3: 4
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085051962 Original CRISPR ACCCCATACTTTGTATCCCC AGG Intronic
901578969 1:10224847-10224869 TCCCCATTCTTTTTAGCCCCAGG + Intronic
902648763 1:17822963-17822985 ACCCCATCCTTTGCTTCCGCAGG + Exonic
904783924 1:32971386-32971408 CCTCCATCCTTTGTGTCCCCAGG + Intergenic
907594443 1:55706327-55706349 ACCCAATACGTTCTTTCCCCAGG - Intergenic
908905271 1:69001302-69001324 GACCCATACTTTGCAGCCCCTGG - Intergenic
909051996 1:70777276-70777298 AACCCATACATTGCAGCCCCTGG + Intergenic
910863285 1:91764381-91764403 GCTCCATATTTTGTATGCCCTGG + Intronic
911953671 1:104209360-104209382 TCCCCAAACCTTGTATCCACTGG + Intergenic
913073762 1:115323970-115323992 ACCCCAGAATTTGTATAACCTGG + Intronic
918276283 1:182956206-182956228 ACCACATACTGTGCATCTCCTGG - Intergenic
921151506 1:212406780-212406802 ACCCCAGGCTTTGCAGCCCCAGG + Intronic
1071238773 10:83680670-83680692 ACCTCAGAGTTTGTAACCCCAGG + Intergenic
1076151424 10:128164987-128165009 CCTCCATCCTTTGTATTCCCTGG - Intergenic
1082248599 11:49954984-49955006 AACAAATACTTTTTATCCCCAGG + Intergenic
1083029713 11:59581090-59581112 TCATCAGACTTTGTATCCCCAGG + Intronic
1083749076 11:64751466-64751488 ACCCCAGACTTTGTCCCCTCAGG - Exonic
1085032846 11:73283200-73283222 TCCTCACATTTTGTATCCCCAGG + Intronic
1085051962 11:73384600-73384622 ACCCCATACTTTGTATCCCCAGG + Intronic
1087183822 11:95164508-95164530 ACCCTGTTCTTTGTCTCCCCTGG + Intergenic
1088065894 11:105718920-105718942 ACTCCCTACCTTGTTTCCCCTGG - Intronic
1089384874 11:118060842-118060864 CCCTCATCCTTTGGATCCCCAGG + Intergenic
1094682789 12:32680411-32680433 ACCCTATACTATGTACCTCCTGG - Intronic
1095073901 12:37893265-37893287 ACTCCAGACTTTGTATGCCTGGG - Intergenic
1099068834 12:78019509-78019531 ACTTCATACTTAGTATTCCCTGG - Intronic
1103316884 12:120063393-120063415 GCCACATACTTTGTTTCCCCAGG + Intronic
1106003546 13:25747628-25747650 TCCCCACGCATTGTATCCCCAGG - Intronic
1106239742 13:27901547-27901569 CCCCCACACATTTTATCCCCTGG - Intergenic
1108755425 13:53495628-53495650 AAACCATAGTTTGTATTCCCCGG + Intergenic
1111749448 13:92309909-92309931 ACCTACTACTTTTTATCCCCTGG + Intronic
1117514587 14:56488180-56488202 GTCCCACTCTTTGTATCCCCAGG + Intergenic
1120385630 14:83841956-83841978 ACCCCACTCTTTGTATGCCTGGG - Intergenic
1122904860 14:104796981-104797003 AGCTCAGACTTTGTAACCCCAGG + Intergenic
1124707603 15:31978390-31978412 GCCCCATACCCTGTGTCCCCAGG - Intergenic
1124966561 15:34436835-34436857 ACCCCACACCTTGTTGCCCCTGG - Intronic
1124983180 15:34582947-34582969 ACCCCACACCTTGTTGCCCCGGG - Intronic
1126136532 15:45397569-45397591 ATCTCACCCTTTGTATCCCCTGG + Intronic
1128001619 15:64198164-64198186 ACTCCCTACTTGGTATCCACAGG + Intronic
1133463771 16:6010123-6010145 GCCCCACACCTCGTATCCCCAGG + Intergenic
1137267529 16:46881349-46881371 ACTCCATCCTTTTTATCCCGAGG + Intergenic
1138319340 16:56098537-56098559 ACTCCTCCCTTTGTATCCCCAGG - Intergenic
1139034780 16:62930870-62930892 ACCACATACTTAGTGTCACCTGG - Intergenic
1140322534 16:73967115-73967137 TCCCACTACTTTGTATCCCATGG + Intergenic
1145921287 17:28612084-28612106 ACCCCATACTTGTTATCCACAGG - Exonic
1149151229 17:53566319-53566341 CCCCTATACTTTGTAGCCTCTGG - Intergenic
1150302770 17:64060077-64060099 ACCCCCTACTTAGTAGCCTCGGG + Intronic
1150858788 17:68779170-68779192 CCCCCATACTTAGTAACCTCTGG - Intergenic
1151119014 17:71771529-71771551 ATCCCATATTTTGTATCCCCAGG - Intergenic
1152657482 17:81526798-81526820 ACCCCAGACTGCGTCTCCCCAGG + Intergenic
1153994415 18:10427576-10427598 GACCCATACTTTTTATCCCAAGG + Intergenic
1157161431 18:45317745-45317767 ACCCCACACTCTGAATGCCCTGG + Intronic
1167957350 19:53076870-53076892 TTCCCATACTTTCTCTCCCCAGG - Intronic
929379958 2:41337809-41337831 ACTTAATACTGTGTATCCCCAGG - Intergenic
931356476 2:61541270-61541292 AACCCATACTTTATCTTCCCAGG - Intergenic
932105206 2:68935857-68935879 ACTCCAAACTTTGAATCCCTGGG + Intergenic
934694116 2:96386286-96386308 ACAAGAAACTTTGTATCCCCTGG + Intergenic
938070994 2:128308311-128308333 ACCCCCTACATGGTATCTCCAGG - Intronic
941015027 2:160345896-160345918 ACACCATACTTTGTATAGCCTGG - Intronic
942836714 2:180307669-180307691 ACCACAGCCTTTGGATCCCCAGG + Intergenic
946408536 2:219505381-219505403 ACCCCAAAATTTCAATCCCCAGG - Intronic
1182088475 22:27577758-27577780 ACCCCTTACTGTGTGTCCTCTGG + Intergenic
1185203547 22:49523332-49523354 GACCCAGACTTTGTATCCCCTGG + Intronic
973823905 4:54685999-54686021 AGCCCCTTCTTTGTATTCCCAGG + Intronic
974681754 4:65173731-65173753 TTCCCATCCTTTGTATCTCCAGG + Intergenic
980756470 4:137170752-137170774 ACCTCATTCTTTATATCTCCTGG + Intergenic
982893163 4:160881825-160881847 ACCCCACCCTTTATTTCCCCAGG + Intergenic
984446987 4:179849400-179849422 GCACCATACTCTGTGTCCCCTGG - Intergenic
986166237 5:5273662-5273684 ACACCTTACTGTGTCTCCCCTGG + Intronic
1000957108 5:167556555-167556577 AACCCACACTTTGTTTCCACGGG + Intronic
1005871943 6:29980908-29980930 ACCCCATTCTCTGCATCCCACGG - Intergenic
1008471406 6:51889197-51889219 GCCCCATAGTTTGTGTTCCCGGG - Intronic
1008550675 6:52627056-52627078 ACCAGAAACTTTGTATTCCCTGG + Intergenic
1009903915 6:69844825-69844847 TCCCGATATTTTGTATTCCCAGG - Intergenic
1010002897 6:70966014-70966036 AACCCACAGTTTGTATCCCACGG - Intergenic
1010499665 6:76581759-76581781 ACCCCATACTTCGGATACCACGG - Intergenic
1011344650 6:86355481-86355503 CACCCATCCTTTGTAACCCCAGG - Intergenic
1012256325 6:97036808-97036830 AGCCCATGCCTTGCATCCCCTGG - Intronic
1014502126 6:122204419-122204441 CCTCCATACTTAGTATCCCAAGG + Intergenic
1015134712 6:129854440-129854462 ACCTCTTCCTTTTTATCCCCAGG - Intronic
1020603680 7:10307931-10307953 ACACCCTACTTTGTAACCGCTGG + Intergenic
1026059426 7:67012973-67012995 AGCCTGTATTTTGTATCCCCGGG + Intronic
1039784976 8:40826628-40826650 ACCCCATACTTTGCAACACGGGG + Intronic
1040504360 8:48034018-48034040 ACCTGCTACTTTGTATCCCTTGG + Intronic
1040902407 8:52430313-52430335 ACCCCTTACTTAGGATCCTCAGG + Intronic
1050726185 9:8651927-8651949 AGTCCCTAATTTGTATCCCCAGG + Intronic
1057108764 9:92447099-92447121 ACCCCAGACTTTTTGTCACCAGG + Intronic
1057526102 9:95803203-95803225 ACCCCATGCTCTGTACCCACAGG - Intergenic
1058987226 9:110219583-110219605 ACCCCATACCTCATATCCCATGG + Intergenic
1059207973 9:112484323-112484345 ACTCCAAATTTTGTATCTCCAGG + Intronic
1190500994 X:51078335-51078357 ACAACATCTTTTGTATCCCCTGG - Intergenic