ID: 1085052573

View in Genome Browser
Species Human (GRCh38)
Location 11:73387424-73387446
Sequence ACTTTGGGGCAGAAACTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 0, 3: 36, 4: 295}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085052568_1085052573 -4 Left 1085052568 11:73387405-73387427 CCTGACAAGGGCACAGGACACTT 0: 1
1: 0
2: 0
3: 15
4: 161
Right 1085052573 11:73387424-73387446 ACTTTGGGGCAGAAACTGGAAGG 0: 1
1: 0
2: 0
3: 36
4: 295
1085052559_1085052573 30 Left 1085052559 11:73387371-73387393 CCATGGGGAGACAGGCTCGAGGT 0: 1
1: 0
2: 2
3: 17
4: 158
Right 1085052573 11:73387424-73387446 ACTTTGGGGCAGAAACTGGAAGG 0: 1
1: 0
2: 0
3: 36
4: 295
1085052567_1085052573 -3 Left 1085052567 11:73387404-73387426 CCCTGACAAGGGCACAGGACACT 0: 1
1: 0
2: 0
3: 17
4: 157
Right 1085052573 11:73387424-73387446 ACTTTGGGGCAGAAACTGGAAGG 0: 1
1: 0
2: 0
3: 36
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085052573 Original CRISPR ACTTTGGGGCAGAAACTGGA AGG Intronic
901817611 1:11803708-11803730 ACTCAGGGGCAGAGACTGCAGGG + Intronic
903083198 1:20829745-20829767 ACAATGGGGAAAAAACTGGATGG + Intronic
903678342 1:25080723-25080745 ACTTTTGGGCAGAAGCTTTAGGG - Intergenic
903896743 1:26611359-26611381 ACTTTAGGGCACAAGTTGGAAGG - Intergenic
905348624 1:37328770-37328792 ACTCTGGGCCAGAAATTGGCTGG + Intergenic
906200707 1:43958439-43958461 TCTGTGGGGCAGAACATGGATGG - Exonic
906409387 1:45566783-45566805 ACTCTGGGAGAGGAACTGGAAGG - Intronic
906682267 1:47736784-47736806 ACTTTGGGCAAGAAACTGCTTGG - Intergenic
906750469 1:48254101-48254123 TCCTTGGGGCAGGAAGTGGATGG + Intergenic
907379783 1:54076981-54077003 ACATTTGAGCAGAAACTTGAAGG + Intronic
908845795 1:68323137-68323159 ACTGAGGGGCAGAAAAGGGATGG - Intergenic
909688449 1:78377393-78377415 ACTGTGGGTCAGACACTGCAGGG + Intronic
909874308 1:80783447-80783469 GCTTTGGGGCAGATACTGTACGG - Intergenic
911379014 1:97088964-97088986 ACTATGGAGCATAAACAGGAGGG - Intronic
914452488 1:147805084-147805106 ACATTGGAGCAAAAACTGGAGGG + Intergenic
914995206 1:152537526-152537548 ACGTTGGGGCAGGAAGAGGAGGG - Intronic
915252312 1:154599451-154599473 TGTTTGGGGTAGAGACTGGATGG - Intronic
915943572 1:160134411-160134433 ACTTTGGGAGAGGAACAGGAGGG + Intronic
917624919 1:176835885-176835907 TCTTGGGGGCAGAACCTGGGGGG - Intronic
917725064 1:177820520-177820542 GCTTGGGGGCAGAAAATGGCAGG - Intergenic
918265776 1:182840030-182840052 GCTTAAGGGCAGAAACTGGGCGG + Intronic
919509582 1:198445110-198445132 ACTTTGGGGTAAAAACAGGAAGG + Intergenic
919857655 1:201716768-201716790 ACTTTGGGGCTGAGGCAGGAGGG + Intronic
920166182 1:204037573-204037595 AATTTGGGGCAGAAACCTGGTGG + Intergenic
920572224 1:207025806-207025828 AGGTTGGTGGAGAAACTGGATGG + Intronic
921300400 1:213746282-213746304 ACATTTGGGCAGAGACTGCAGGG + Intergenic
923467303 1:234260806-234260828 ACTTTGGTGGAGGAAATGGAGGG - Intronic
924541101 1:244981569-244981591 CCTTTTGAGCTGAAACTGGAAGG - Intronic
1064861079 10:19826431-19826453 TGTTTGGAGCAGAAACAGGAGGG + Intronic
1065247787 10:23776229-23776251 CCTTTGGGGAAGAATCTTGAGGG - Intronic
1065883405 10:30057635-30057657 CCTTTGCTGCAGAGACTGGAAGG - Intronic
1067479506 10:46585750-46585772 ACTGTGGTGCAGAACATGGAAGG + Exonic
1067547608 10:47205744-47205766 ACCATGGGACAGAACCTGGAAGG + Intergenic
1067615232 10:47756048-47756070 ACTGTGGTGCAGAACATGGAAGG - Intergenic
1070140439 10:73734077-73734099 GCTTTGGGGCAGAGCCTGAAGGG - Intergenic
1071257952 10:83890812-83890834 ACTTTGGGTCAAAAGCTGAATGG - Intergenic
1071328188 10:84536975-84536997 CTTTGGGGTCAGAAACTGGATGG - Intergenic
1071978688 10:90981331-90981353 TCTTTGGGGCAGTAACAGGATGG - Intergenic
1073848196 10:107583730-107583752 AATCTGGGGCAGTAACTAGATGG - Intergenic
1074096743 10:110319916-110319938 ACTTTGGGGCTGAGACCTGAAGG + Intergenic
1074184018 10:111085851-111085873 ACTTTGGGGAACAGGCTGGAGGG + Intergenic
1076091449 10:127689821-127689843 GCTGTGGGGAAGTAACTGGATGG - Intergenic
1076331422 10:129673067-129673089 ACTTGGGGGAAGAATCTGAATGG - Intronic
1076799769 10:132815332-132815354 AGTCGGGGGCAGAAACAGGAGGG - Intronic
1077357364 11:2124676-2124698 GCGTGGGGGCAGAGACTGGAAGG - Intergenic
1077357374 11:2124723-2124745 GCGTGGGGGCAGAGACTGGACGG - Intergenic
1077882155 11:6359601-6359623 ACTTTGGGACAGACACTGGCTGG + Intergenic
1078738182 11:14041191-14041213 ACTTTGGGGAAGAAGGAGGATGG - Intronic
1079255431 11:18824133-18824155 GCTTTGGGGCAGAAACTATGGGG + Intergenic
1079415033 11:20226090-20226112 AGTTAGGGGCAGAAAGTTGAGGG + Intergenic
1079515837 11:21267824-21267846 ACTTTAAGTCAGAAACTGGTAGG - Intronic
1080566146 11:33511224-33511246 ACTTTGGGTGAGATCCTGGAAGG + Intergenic
1080748174 11:35127549-35127571 ACTTTGGGGCATCAGCTGGCTGG + Intergenic
1081571963 11:44297380-44297402 ACTTTGGGGAAGCCACTGGAGGG - Intronic
1082895277 11:58183562-58183584 TGTTTGGGGCAGAAAATGGTGGG - Intergenic
1085052573 11:73387424-73387446 ACTTTGGGGCAGAAACTGGAAGG + Intronic
1088555925 11:111060698-111060720 GCTTTGGGGCATGAAATGGAGGG - Intergenic
1089218555 11:116851478-116851500 ACTTAGGGGCAGAGGCAGGATGG + Intronic
1091821871 12:3481433-3481455 AGTTAGGGCCAGAAACTGAAAGG + Intronic
1093767569 12:22982460-22982482 ACTTTGGAGAAGAATCTGGCCGG + Intergenic
1093850234 12:24027595-24027617 GCTTTGGGGCAGCAAGTAGAGGG - Intergenic
1093905847 12:24691116-24691138 ACTTGGGGGGAGAAAGGGGAGGG + Intergenic
1094323776 12:29213888-29213910 ACTTTGTGGCAGTTAATGGAAGG + Intronic
1095787921 12:46131220-46131242 ACTTTGGGGGAGAAGAGGGAAGG - Intergenic
1096718935 12:53507020-53507042 CCTCTGGGGCTGAAACAGGAAGG + Exonic
1098648689 12:72938710-72938732 ACTTTGGGGAAGTCATTGGAAGG - Intergenic
1098658990 12:73069111-73069133 ACTTTTGGGCAGAAACTATGAGG + Intergenic
1101611606 12:106297892-106297914 ACTTTGGGGCAGGAAGTGGGAGG - Intronic
1103867143 12:124062316-124062338 ACTTGGGGGCAGAAGAGGGAAGG - Intronic
1104812111 12:131625660-131625682 ACTTTGGTTTAGAAAGTGGAAGG - Intergenic
1106289159 13:28344481-28344503 ACAGTGGGGCAGATGCTGGAGGG - Intronic
1106397797 13:29397787-29397809 ACTTGTGGAGAGAAACTGGAAGG - Intronic
1106476460 13:30102466-30102488 TCTTTTAGGCAGAATCTGGAAGG - Intergenic
1107646141 13:42496115-42496137 ACTTTTGAGCAAAGACTGGAAGG - Intergenic
1108248593 13:48542391-48542413 ACTTTGGAGAAGAATCTGGCTGG + Intergenic
1109268706 13:60229993-60230015 ACTATGTGGCAGATACTGCAAGG - Intergenic
1109959307 13:69610260-69610282 AGACTGAGGCAGAAACTGGAGGG + Intergenic
1110451398 13:75641008-75641030 ACTGTGTGCCAGAAACTTGACGG + Intronic
1111775246 13:92653275-92653297 GCTTTGGGGAAGGAAGTGGAAGG + Intronic
1113958648 13:114113057-114113079 ACTTGGGGGCAGGAGCTGGAGGG + Intronic
1114235183 14:20817184-20817206 AGTTTGGGGCAGAACCAGAATGG - Intergenic
1114530359 14:23391623-23391645 ACTTTGGGGCAGACTGTGGCTGG - Intronic
1114667144 14:24385487-24385509 ATTTTGGGGCAGATACTTGAAGG - Intergenic
1114683805 14:24508495-24508517 AGTTGGGGGCAGGAAATGGAGGG + Exonic
1114827380 14:26097794-26097816 AGTTTGGTGCAGAAAATTGAAGG - Intergenic
1115148585 14:30256470-30256492 GCTTTGGGGCAGAGACTGTAGGG + Intergenic
1116103627 14:40472436-40472458 ACTTTGGGGAGAAAGCTGGAGGG + Intergenic
1116796610 14:49397687-49397709 ACTTTTGGGCAGAGACTGTAGGG - Intergenic
1117240181 14:53824321-53824343 GCTTTTGTGCAGAAACTGGCTGG - Intergenic
1117289001 14:54314618-54314640 ACCTTGTGGCAGGGACTGGAGGG - Intergenic
1119631465 14:76235928-76235950 ACATTGGAGAAGAAACTGCAGGG - Intronic
1120205695 14:81585139-81585161 ACTTTGGGGCTGGAACACGAAGG - Intergenic
1120987151 14:90344109-90344131 GCTTTGGGGGAGACAGTGGATGG - Intergenic
1121047094 14:90796155-90796177 CCTCTGGGGCAGAGGCTGGATGG + Intronic
1121511583 14:94516712-94516734 TCTTGGGGACAGAAACTGTAAGG - Intronic
1122621368 14:103059261-103059283 CCTTTGGGGTATCAACTGGAAGG + Intergenic
1122834890 14:104425741-104425763 ACTCTGGGGCAGAATCATGAAGG - Intergenic
1122902222 14:104786654-104786676 AAGTTGGGGCAGAAACAAGATGG - Intronic
1124351400 15:28958171-28958193 ACTTGTGGGTAGAAGCTGGAAGG + Intronic
1126212091 15:46111418-46111440 ACTTTGGAGAAGAATCTGGCCGG + Intergenic
1128907387 15:71479598-71479620 AATTTGGGGAAGAAACAGGCTGG + Intronic
1129698124 15:77752212-77752234 ACCTTGGGGGAGACAATGGAAGG - Intronic
1130098941 15:80877366-80877388 ACTCTGGGGCAGGTACTGGAAGG - Intronic
1130123093 15:81069224-81069246 ACATTTGCGCAGAGACTGGAAGG + Intronic
1131117126 15:89802484-89802506 ACAGTGGGGTAGAAGCTGGACGG + Intronic
1132190276 15:99849433-99849455 GCTTTGGGGAAGGAAATGGAAGG - Intergenic
1132598662 16:764398-764420 CCCTTGGGGCAGAGCCTGGAGGG - Intronic
1133536534 16:6707702-6707724 GCTATGGAGCAGAAACTGGGAGG - Intronic
1135674881 16:24406856-24406878 CCTTGTGGGCAGAAACTGGAGGG - Intergenic
1135928238 16:26714087-26714109 ACTTTGGGAAAGAAAAGGGAAGG + Intergenic
1137723006 16:50638883-50638905 ACTTTGTGGGAGACAGTGGAGGG - Exonic
1139400002 16:66673951-66673973 ACTTGGGGGCAAAAACTGGCTGG - Intronic
1139425794 16:66879293-66879315 ACTTTAGGGCAGGAATTTGAGGG + Intronic
1141072925 16:80974317-80974339 AGTTTGGGGGATAAATTGGAGGG - Exonic
1141397025 16:83714070-83714092 ACTCTGGGGCAGTGAGTGGAGGG + Intronic
1143457817 17:7079032-7079054 AGTTTGGGAGTGAAACTGGAGGG + Intronic
1144293679 17:13853031-13853053 ACATTTGAGCAGAAACTTGAAGG + Intergenic
1144613999 17:16751888-16751910 CCCTGGGGGCAGACACTGGAGGG - Intronic
1144898713 17:18563783-18563805 CCCTGGGGGCAGACACTGGAGGG + Intergenic
1144970772 17:19108177-19108199 ACTTTGGGGGAAAGACTGGCAGG - Intergenic
1144991074 17:19234339-19234361 ACTTTGGGGGAAAGACTGGCAGG - Intronic
1145133662 17:20381940-20381962 CCCTGGGGGCAGACACTGGAGGG - Intergenic
1146776381 17:35621228-35621250 ACTTTGAGACAGCAACTGGGTGG - Intronic
1147186308 17:38715155-38715177 AGTTTGGGGTAGTAGCTGGAGGG + Intronic
1147293094 17:39459510-39459532 ACTTTGGGGGCCAAAGTGGATGG + Intergenic
1147307041 17:39571171-39571193 ACTGAGGGGCTGAAACAGGAAGG - Intergenic
1147638297 17:41977538-41977560 CCTTTGGGGCAGCAGTTGGAAGG - Exonic
1148282738 17:46361591-46361613 TCTGCGGGCCAGAAACTGGAGGG - Intronic
1148304956 17:46579516-46579538 TCTGCGGGCCAGAAACTGGAGGG - Intronic
1148461773 17:47843224-47843246 ACTGTGGGGCGGAAACAGGCAGG + Intergenic
1149160096 17:53682735-53682757 GCTTTTGGGCAGAAACTGTGGGG + Intergenic
1149322715 17:55497793-55497815 AGTCTGGGGGAGAAACTTGAAGG - Intergenic
1150980432 17:70135893-70135915 ATTTTGGGGGAAAAAGTGGATGG - Intergenic
1151896457 17:76983786-76983808 ACTTTAGAGGAGAAACTGGTGGG + Intergenic
1155286480 18:24293858-24293880 GATTTGGGGCAGAAGCTGTAGGG + Intronic
1156535899 18:37864231-37864253 AATTTGTAGCAGAAAGTGGAAGG + Intergenic
1156790187 18:40963182-40963204 ACTTTTGGGCAGAGACTATAAGG - Intergenic
1157490455 18:48120221-48120243 ACTCTGGGGGAGAAACTGTGTGG + Intronic
1157818333 18:50747346-50747368 ACTCTGGGGCAGAAACTTGCAGG + Intergenic
1158146504 18:54320231-54320253 ACAGTGGGGGAGAAGCTGGAAGG - Intronic
1159409371 18:68051695-68051717 AGTTTGGGACAGAAACTATATGG - Intergenic
1160980066 19:1812566-1812588 ACTTTGGGGAAGGGACTAGAAGG + Intergenic
1161109987 19:2463613-2463635 ACTTTGTGGCAGGCACTGGGGGG + Intergenic
1161219647 19:3112544-3112566 CCTTTGGGGCAGACACTGTGGGG - Intronic
1162971263 19:14182723-14182745 GCTATGGGGCAGGACCTGGATGG + Intronic
1163241280 19:16065375-16065397 ACTTTGAGCCATAAGCTGGAGGG - Intergenic
1163468738 19:17484881-17484903 ATTTTGATGCAGAAGCTGGAGGG + Intronic
1164048429 19:21563002-21563024 ACTTTGGAGTAGAGAGTGGAAGG + Intergenic
1164208964 19:23081176-23081198 ACTTTGTTGCAGAGGCTGGAGGG + Intronic
1165282488 19:34809224-34809246 ACTTTTGGGCAGGAACTGGGGGG + Intergenic
1165322503 19:35094782-35094804 ACTTTGGAGCAGAGACTTGCTGG + Intergenic
1168629567 19:57946628-57946650 ACAGTGGGGCACAAACTGGGGGG - Intronic
925071307 2:969754-969776 GCTTTTGGGCAGAGACTGTAAGG + Intronic
925990421 2:9250147-9250169 CCTTGGGGGCAGAAACTGCCAGG + Intronic
926309642 2:11666228-11666250 CCTCTGGGGCAGCAGCTGGAAGG - Intronic
927403812 2:22745304-22745326 AATTTGAGTCAGAAACAGGATGG + Intergenic
927571319 2:24163250-24163272 ACAGTGTGGCAGAAGCTGGAGGG + Intronic
928157261 2:28888027-28888049 AGATTGGGACAGTAACTGGAGGG + Intergenic
928705346 2:33943850-33943872 GCTTTGGAGCAGAAACCAGAGGG + Intergenic
933849676 2:86355838-86355860 ACCTTTGGGCAGGAAATGGAGGG + Intergenic
933971385 2:87472779-87472801 AATATGGGCCAGAAACAGGAAGG + Intergenic
935406443 2:102715118-102715140 ACTTTGGGGCAGTAACTTTAGGG - Intergenic
936322345 2:111477420-111477442 AATATGGGCCAGAAACAGGAAGG - Intergenic
936868630 2:117107432-117107454 ACTTTGGAGAAGAATCTGGCTGG + Intergenic
937358470 2:121212961-121212983 ACTGTGGTTCTGAAACTGGAGGG - Intergenic
937552998 2:123117984-123118006 GCTTTTGGGCAGAGACTGTAAGG + Intergenic
937782962 2:125860335-125860357 ACTTGGGGGCAGAGAGTGGGAGG - Intergenic
938144288 2:128821111-128821133 AGCCTGGGGCAGAAGCTGGAGGG - Intergenic
940323308 2:152399712-152399734 ACCTTGGGGCAGAATTTGTAAGG + Intronic
943829593 2:192443255-192443277 CATTTGGAGCAGAACCTGGACGG + Intergenic
944670384 2:201989449-201989471 ACTGTGGAGGATAAACTGGAAGG + Intergenic
945617149 2:212086114-212086136 ATTATGGGGCAGAAACTGGGGGG + Intronic
945911529 2:215655356-215655378 AATTTGGGCAAGAAACAGGAGGG + Intergenic
946073256 2:217052544-217052566 ACTTTTGGGGAGACACTAGAAGG + Intergenic
947198233 2:227590826-227590848 GCTTTGGGGCAGAGACTGTGGGG + Intergenic
947490563 2:230591270-230591292 ACTGTGGGGCAGAGACAGGGAGG + Intergenic
1169523665 20:6400140-6400162 ATTATGGGACAGAAAGTGGAGGG + Intergenic
1170468079 20:16641036-16641058 GCTTTGGGGCAGATAAGGGAAGG + Intergenic
1172579672 20:36036950-36036972 CCTTGGGGACAGACACTGGAGGG + Intergenic
1173368860 20:42416546-42416568 ACTTAGGGGCAGCAAATAGAAGG - Intronic
1174120244 20:48259636-48259658 CCTTTGGGGCAGAGACTGGGAGG - Intergenic
1175140036 20:56854153-56854175 ACATTTGAGCAGAAACTGGAAGG - Intergenic
1175221892 20:57421953-57421975 ACTTTGTGCCAGACACTGGACGG - Intergenic
1176256356 20:64155077-64155099 ATCTTGGGACAGAGACTGGAGGG + Intronic
1177286970 21:19064357-19064379 AGGTTGGGGGAGAAACTGGAGGG + Intergenic
1177493947 21:21864311-21864333 AGTTGAGGGCAGAAGCTGGAAGG + Intergenic
1178509003 21:33186580-33186602 CCTTTGGGGGACACACTGGAAGG - Intergenic
1179256225 21:39718239-39718261 GCTTTGGGGCTGAAACTATAGGG + Intergenic
1180797705 22:18614871-18614893 ACTTTGGGGCAGCTGCTGGATGG - Intergenic
1181224012 22:21380389-21380411 ACTTTGGGGCAGCTGCTGGATGG + Intergenic
1181254621 22:21554428-21554450 ACTTTGGGGCAGCTGCTGGATGG - Intronic
1183215231 22:36475025-36475047 ACCTTTGGGCAAAAACAGGAAGG - Intronic
1183271938 22:36867769-36867791 CCTTGGGGGCAGACACTGGATGG - Intronic
1183726765 22:39594290-39594312 ACTTTGAGCCTGAAACTGGCAGG + Intronic
1184193354 22:42909826-42909848 ACTTGGTGGCAGAAACTGCTGGG - Intronic
1184904685 22:47473010-47473032 CCTTGGGGGAAGAAACTGGGAGG - Intronic
949659493 3:6261597-6261619 AGTTTTGAGCAAAAACTGGAAGG - Intergenic
952809714 3:37390979-37391001 GCTTTGGGGCTGAGACTGTAGGG + Intronic
956006807 3:64788499-64788521 ACTTTGGGGGTGAGATTGGAGGG - Intergenic
956260029 3:67329358-67329380 GATTTGGGGCAGCAAATGGAAGG - Intergenic
956378565 3:68641890-68641912 GCTTTGGGGCAGAAACTATGGGG + Intergenic
957446392 3:80317103-80317125 CCTTTGGGGCAGAGACTATAGGG - Intergenic
959090325 3:101895784-101895806 ACTTGGGGGCTGAGACAGGAGGG - Intergenic
961570296 3:127792954-127792976 ACATCTGGGCAGAAACTGAAGGG + Intronic
964755669 3:160089032-160089054 ACTAGGGGGTAGACACTGGATGG - Intergenic
966007403 3:175032834-175032856 ACATTTGGGCATAAAGTGGATGG + Intronic
968470219 4:777562-777584 ACTTTGGGGCCGAAGGTGGAAGG + Intergenic
968729714 4:2263939-2263961 ACTGTGGGGCGGGAACAGGAAGG - Intergenic
970083199 4:12314079-12314101 ACTTCAGGGTAGAAAGTGGAAGG + Intergenic
972090882 4:35281925-35281947 TCTTTTTGGCAGAAACTGAAAGG + Intergenic
972314538 4:37913717-37913739 AAATTGGGCCAGTAACTGGAGGG - Intronic
972638698 4:40906746-40906768 ACTTTGGGTCAGAAGATTGAGGG - Intronic
973081256 4:45996829-45996851 AATTTGTGCAAGAAACTGGAAGG - Intergenic
973091880 4:46147386-46147408 ACTTGGGAGCAGAATCAGGAGGG + Intergenic
973219567 4:47710475-47710497 ACCTTGGGACAGAAACTGCTTGG - Intronic
974118007 4:57604379-57604401 AGTTTAGGCCAGAAACTGGAAGG + Intergenic
977134395 4:93284337-93284359 ACATTGGGGCACACATTGGAGGG + Intronic
977551402 4:98447645-98447667 AATTAGGGGCAGAAAATAGAGGG - Intergenic
977914550 4:102577124-102577146 AGTGTGGGGTAGAGACTGGAAGG - Intronic
980395017 4:132200929-132200951 AGTATGGGGGAGAAAGTGGAGGG + Intergenic
980939076 4:139255518-139255540 TCTTTGAGGCACAAACAGGATGG + Intergenic
982538570 4:156638877-156638899 ACTTTGTGGTGGAAAGTGGAAGG - Intronic
983854786 4:172630496-172630518 ACATTGCCACAGAAACTGGAGGG + Intronic
984200517 4:176714682-176714704 AGGCTGGGGCAGAATCTGGAAGG - Intronic
984465713 4:180098553-180098575 ACTTTGGGGCAGACACTGTGGGG + Intergenic
984466639 4:180108285-180108307 GATATGGGGCAGTAACTGGAGGG - Intergenic
984793833 4:183639185-183639207 ACTTGGGGGCACAAACTGTCAGG + Intergenic
989204224 5:38795695-38795717 ACTTTGGGGCAGGAAAAGAAAGG + Intergenic
989631270 5:43484617-43484639 ACTCTGAGGCAGAGACGGGATGG - Intergenic
990433920 5:55768277-55768299 ACTTTAGGGTAGAAAGTGGGAGG - Intronic
990434030 5:55769476-55769498 ACTTTGGGGCAGAGATTATAGGG - Intronic
990686787 5:58312388-58312410 AATTTTGGGCAGACACGGGAAGG - Intergenic
993297037 5:86153644-86153666 ACTTTGGAGAAGAATCTGGCTGG - Intergenic
996469708 5:123845379-123845401 AGTTTGGGGCAAAAACTGAAAGG + Intergenic
999664231 5:153895961-153895983 AGTTTGGGGCAGAGATTAGAGGG + Intergenic
1000281567 5:159786912-159786934 AATTTGGGGCAGAGCCTGAATGG - Intergenic
1000537247 5:162493956-162493978 ACTTTGGAGAAGAATCTGGCTGG - Intergenic
1000698315 5:164417328-164417350 GCTTTGGGGCAGAGACTGCGGGG + Intergenic
1001756775 5:174176404-174176426 CCTTTCAGCCAGAAACTGGAAGG - Intronic
1001966228 5:175911593-175911615 GGTATGGGGCAGAAACTAGAGGG + Intergenic
1002250718 5:177927610-177927632 GGTATGGGGCAGAAACTAGAGGG - Intergenic
1003159152 6:3620440-3620462 GAGTTGGGGCAGGAACTGGATGG - Intergenic
1003688741 6:8330796-8330818 ACTGTGGAGCAGAACCAGGAGGG - Intergenic
1004773357 6:18812280-18812302 ACTTTGGATCAGAACCTGTAAGG + Intergenic
1005394759 6:25369784-25369806 ACTTTTGTGAAGAAACTGAAAGG + Intronic
1005806243 6:29476610-29476632 ACCCTGAGGCAGAGACTGGAAGG - Intergenic
1006454553 6:34124310-34124332 ACTTTTGTGCAGAACCTGAACGG - Intronic
1006981092 6:38148945-38148967 ACTTTGGGGGAAACTCTGGAGGG - Intronic
1007472794 6:42101822-42101844 ACTTTAGGGAAGAAAGTGCAGGG - Exonic
1007567375 6:42862692-42862714 ACTTTGGGTAAGAAACTTGAAGG + Intronic
1008215498 6:48782976-48782998 ACTTTGGAGGAGAATCTGGCTGG - Intergenic
1009846918 6:69146063-69146085 GCTTTTGGGCAGAAAAGGGAGGG - Intronic
1011126928 6:84017885-84017907 AGTTTGCCTCAGAAACTGGAAGG + Intergenic
1011248504 6:85345097-85345119 AATTTGGGGAAGAAACAGTATGG + Intergenic
1012181750 6:96163189-96163211 TCTTTGAGCCAGAAACTGGTAGG - Intronic
1012972047 6:105741793-105741815 ATTTTGGGGTAGAAGCTGAATGG - Intergenic
1014167438 6:118241334-118241356 AGTGTGGTGCAGAAACTGAAAGG - Intronic
1014646372 6:123978414-123978436 ACTTTGGGGCAGAATATAAATGG + Intronic
1015402278 6:132799916-132799938 ACTTGAGGGCAGAGTCTGGATGG - Intergenic
1017140112 6:151182567-151182589 ACTTTGCTGCCGAAGCTGGAGGG - Intergenic
1017555835 6:155567205-155567227 ATTTTGGGAAAGAAAATGGATGG - Intergenic
1018253291 6:161893736-161893758 ACTTTGTGGCTGGGACTGGATGG - Intronic
1018407800 6:163505791-163505813 ACTTTGGGGAAGTAACTAGTGGG + Intronic
1020395950 7:7717655-7717677 ACTTTGGGGCATCAACAGCATGG + Intronic
1022663096 7:32384949-32384971 AGTTTGGGGAATAAATTGGAAGG + Intergenic
1023888172 7:44375395-44375417 GCATCGGGGCAGAAAGTGGACGG - Intergenic
1024454196 7:49584377-49584399 ACATGGAGGCAGAGACTGGAGGG + Intergenic
1026430798 7:70345261-70345283 ACTTTGCGGGAAAAACTGTATGG - Intronic
1026849101 7:73713889-73713911 ACTGTGGGGCACAAACTCAAAGG + Intronic
1027364962 7:77447780-77447802 TCTTAGGGACAGAAACAGGATGG + Intergenic
1028386068 7:90254513-90254535 ACTTTGGGGCAGGGAGTGGTGGG + Intronic
1029807857 7:103015438-103015460 ACTTTTGGGCAGAGACTGTGGGG - Intronic
1031982656 7:128137565-128137587 TCATTTGAGCAGAAACTGGAAGG - Intergenic
1032596560 7:133246655-133246677 AATTTGGGAGAGAAACTGGGGGG + Intergenic
1032880151 7:136080920-136080942 ACTTTGTGGCAAATAATGGAAGG - Intergenic
1032917598 7:136509918-136509940 ACTTTGGAGAAGAATCTGGCTGG - Intergenic
1033431347 7:141292567-141292589 AATATGGGGAAGAAGCTGGAAGG - Intronic
1034408993 7:150927883-150927905 ACTCTGAGACAGAGACTGGAAGG - Intergenic
1034431176 7:151041895-151041917 TCTTTGCCCCAGAAACTGGAGGG - Intronic
1035459625 7:159030935-159030957 CCTTGGGGGCAGAGGCTGGAGGG + Intronic
1035495057 7:159317451-159317473 ATTTATGGGCAGAAAATGGAAGG - Intergenic
1036116651 8:5966930-5966952 AGTGTGGGGCAGAGACTGGGTGG - Intergenic
1037283924 8:17275447-17275469 ACATTGAGGTAGAAACTGGATGG + Intronic
1040452323 8:47560486-47560508 ACTTATAAGCAGAAACTGGAAGG - Intronic
1041327271 8:56681740-56681762 ACTTTGGGGTAAGGACTGGAGGG - Intergenic
1041334398 8:56763858-56763880 ATTTGGGGGCAGAAAATGTATGG - Intergenic
1041560808 8:59215730-59215752 TGTCTGGGGCAGACACTGGAGGG - Intergenic
1041930673 8:63283146-63283168 AGGCTGGGGCAGAACCTGGAAGG + Intergenic
1042165397 8:65940797-65940819 GCTTTAGGGAATAAACTGGATGG + Intergenic
1042883541 8:73522201-73522223 ACTTTGGGGCTGTAATTAGAAGG + Intronic
1043388637 8:79770161-79770183 ACTTTGGGGAAAGAAATGGAAGG - Intergenic
1045834359 8:106503020-106503042 CCTTTGGGGCATAAAAAGGATGG - Intronic
1046297028 8:112232868-112232890 ATTTTGGGGCAGAGTCTGAAAGG - Intronic
1046775027 8:118154911-118154933 AGTTTGGGGCAGCAAATGGATGG + Intergenic
1047259600 8:123243679-123243701 ACTTTCAGGGAGAAACTGAAAGG - Intronic
1049370134 8:142260451-142260473 CCCTTGGGGCATAAACTGGCCGG + Intronic
1049968415 9:799915-799937 TATTTGGGGCAAAAAATGGATGG + Intergenic
1050168043 9:2787071-2787093 ACTTTGGGGCACACACTGATGGG + Intronic
1050928194 9:11292619-11292641 GCTTTGGGGCAGAGACTATAGGG + Intergenic
1051184038 9:14439956-14439978 ACTTTGGGGTGGGAATTGGAAGG + Intergenic
1051347794 9:16168259-16168281 ATCTTGGGGAAGAAACTGGAAGG - Intergenic
1051369384 9:16345354-16345376 TCATTGGGGCAGAAAATAGAAGG - Intergenic
1053287324 9:36858499-36858521 TCATTTGGGCAGAAACTGGGGGG - Intronic
1054089990 9:60836097-60836119 ACTTTGGGGTACAATTTGGAGGG + Intergenic
1054111401 9:61111655-61111677 ACTTTGGGGTACAATTTGGAGGG + Intergenic
1054609456 9:67219470-67219492 ACTTTGGGGTACAATTTGGAGGG - Intergenic
1056476074 9:86952325-86952347 AGTTTGTGGCAGATACTGCATGG + Intergenic
1056604605 9:88076478-88076500 ATGCTGCGGCAGAAACTGGAAGG - Intergenic
1057006846 9:91568310-91568332 ACTTTAGGGAAGAATCTGGCCGG - Intronic
1058594277 9:106598763-106598785 AATTTGGGGCAGCAGTTGGATGG - Intergenic
1059458933 9:114417473-114417495 AGTGTGGAACAGAAACTGGAAGG - Intronic
1059622714 9:116025762-116025784 GCTTTTGGGCAGACACTGCAGGG + Intergenic
1060039143 9:120284657-120284679 AGTTTGGAGGAGAAATTGGAAGG + Intergenic
1060239877 9:121893805-121893827 ACATTCTGTCAGAAACTGGAGGG + Intronic
1061767560 9:132891118-132891140 AATTTGAGGCAGATACAGGAAGG + Intergenic
1061864398 9:133484998-133485020 GCTTGGGGGCAGGATCTGGAGGG + Intergenic
1188642164 X:32519977-32519999 ACCATGGGTCAGAAACTTGACGG + Intronic
1189536101 X:41936895-41936917 AGTTTGGAGCACATACTGGAGGG + Intergenic
1189678704 X:43491265-43491287 GCTTTTGGGCAGAGACTGTAGGG - Intergenic
1189821358 X:44872879-44872901 ACACTGGGGCAGAGAATGGAGGG - Intergenic
1193899041 X:87152664-87152686 GCTTTGGGGCAGAGACTGTGTGG + Intergenic
1194078944 X:89433438-89433460 ACTTTGGGGCAGAGACTATGAGG + Intergenic
1194474733 X:94344754-94344776 ACCTTGGGGAAGAAACTGGTTGG + Intergenic
1195409493 X:104554553-104554575 ACTTTGTCGCAGATACAGGATGG + Intergenic
1196237655 X:113300849-113300871 ACATTGGAGCAGAATCTTGAAGG - Intergenic
1196487898 X:116235046-116235068 ACTTTGGGGCCAAAACTGTGGGG + Intergenic
1196644356 X:118100688-118100710 AAATTGGGCCAGAAAATGGAGGG - Intronic
1197446120 X:126553308-126553330 ACTGAGGGGCTGAAACTTGAGGG - Intergenic
1197970804 X:132112928-132112950 TCTTTGGTGAAGTAACTGGATGG + Intronic
1199765979 X:150941955-150941977 AGTGTGGGGCAGAAAAAGGAGGG + Intergenic
1200431567 Y:3088760-3088782 ACTTTGGGGCAGAGACTATGAGG + Intergenic
1201949135 Y:19544013-19544035 ACTTTAGGGCAGATATTGGAGGG - Intergenic