ID: 1085053571

View in Genome Browser
Species Human (GRCh38)
Location 11:73391902-73391924
Sequence ATGTCTGGGCACAGGGACGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 135}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085053571_1085053586 26 Left 1085053571 11:73391902-73391924 CCCACGTCCCTGTGCCCAGACAT 0: 1
1: 0
2: 1
3: 10
4: 135
Right 1085053586 11:73391951-73391973 CCTGACCCCAGCGTGAGGGGAGG 0: 1
1: 0
2: 1
3: 21
4: 213
1085053571_1085053588 30 Left 1085053571 11:73391902-73391924 CCCACGTCCCTGTGCCCAGACAT 0: 1
1: 0
2: 1
3: 10
4: 135
Right 1085053588 11:73391955-73391977 ACCCCAGCGTGAGGGGAGGGTGG 0: 1
1: 0
2: 1
3: 30
4: 340
1085053571_1085053579 21 Left 1085053571 11:73391902-73391924 CCCACGTCCCTGTGCCCAGACAT 0: 1
1: 0
2: 1
3: 10
4: 135
Right 1085053579 11:73391946-73391968 CACCCCCTGACCCCAGCGTGAGG 0: 1
1: 0
2: 1
3: 30
4: 235
1085053571_1085053587 27 Left 1085053571 11:73391902-73391924 CCCACGTCCCTGTGCCCAGACAT 0: 1
1: 0
2: 1
3: 10
4: 135
Right 1085053587 11:73391952-73391974 CTGACCCCAGCGTGAGGGGAGGG 0: 1
1: 0
2: 2
3: 21
4: 237
1085053571_1085053580 22 Left 1085053571 11:73391902-73391924 CCCACGTCCCTGTGCCCAGACAT 0: 1
1: 0
2: 1
3: 10
4: 135
Right 1085053580 11:73391947-73391969 ACCCCCTGACCCCAGCGTGAGGG 0: 1
1: 0
2: 0
3: 12
4: 166
1085053571_1085053582 23 Left 1085053571 11:73391902-73391924 CCCACGTCCCTGTGCCCAGACAT 0: 1
1: 0
2: 1
3: 10
4: 135
Right 1085053582 11:73391948-73391970 CCCCCTGACCCCAGCGTGAGGGG 0: 1
1: 0
2: 1
3: 13
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085053571 Original CRISPR ATGTCTGGGCACAGGGACGT GGG (reversed) Intronic
901042537 1:6374200-6374222 CTGTTTGGGCTGAGGGACGTGGG - Intronic
901049054 1:6417141-6417163 CCCTCTGGGCACAGGGAGGTGGG + Exonic
903682782 1:25108276-25108298 AAGTCTGGGGACAGGGACAGTGG + Intergenic
905340982 1:37277367-37277389 ATGCCTGGGCACAAGGTCCTTGG + Intergenic
906692557 1:47802185-47802207 CTGGCTGGGCACAGGCACGGTGG - Intronic
907044774 1:51294117-51294139 CTGCCTGGGCACATGGACATGGG + Intronic
907329492 1:53661807-53661829 AGGACTGGGGACAGGGAGGTTGG + Intronic
912587044 1:110776564-110776586 ACGTGTGTGCACAGGGAGGTGGG + Intergenic
913301372 1:117373389-117373411 ATGTCTGAGTAAAGGGAAGTGGG - Intronic
914370430 1:147019885-147019907 ATCTCAGGACACAGGGAGGTGGG - Intergenic
914484264 1:148093525-148093547 ATCTCAGGACACAGGGAGGTGGG + Intergenic
915091376 1:153428659-153428681 ATGTGTGGGCAGAGGGAGGAGGG + Intergenic
923375290 1:233355986-233356008 ATGGCTGGGGACAGGGGCGGTGG - Intronic
1063116152 10:3073401-3073423 ATCTCTGGGCACACGGAGGCTGG - Intronic
1071330475 10:84553905-84553927 ATGTCTGTGCCCAGGGAGGATGG + Intergenic
1071446032 10:85748145-85748167 ATGTCTGAGCCCAGGGTCTTTGG - Intronic
1075016017 10:118910487-118910509 ATTTCTGGACCCAGGGACTTGGG - Intergenic
1075477256 10:122746630-122746652 AGGGCTGGGCCCAGGCACGTTGG - Intergenic
1075636978 10:124035975-124035997 CTGTCTGGGCACAGAGAGGTGGG - Intronic
1076220779 10:128731616-128731638 AGGTCTGGGCACACGGCAGTGGG + Intergenic
1077300070 11:1842695-1842717 AGATCTGAGCACAGGGACCTTGG - Intergenic
1077326410 11:1965882-1965904 ATGGCTGGCCACTGGGACCTGGG + Intronic
1078521982 11:12070828-12070850 CTGTCTGAGCACATGGGCGTTGG + Intergenic
1080043360 11:27783038-27783060 ATGTTTGGGCCCAGTGAAGTGGG + Intergenic
1084410558 11:69003935-69003957 ATGTCTGGGCACTGGGAGGCTGG + Intergenic
1084692448 11:70735033-70735055 GTGTCTGGGCTCAGGGGCGAAGG + Intronic
1085053571 11:73391902-73391924 ATGTCTGGGCACAGGGACGTGGG - Intronic
1085530969 11:77191832-77191854 AGTTCTGGGCACGGTGACGTGGG - Intronic
1088476337 11:110243434-110243456 ATGTCTGGGCACAGTGGCTCAGG + Intronic
1202809391 11_KI270721v1_random:21061-21083 ATGGCTGGCCACTGGGACCTGGG + Intergenic
1092043042 12:5402518-5402540 ATGTATGTGCACAGGGAAGGAGG + Intergenic
1092245517 12:6861892-6861914 ATGGCTGAGCACAGGCACTTAGG + Intronic
1093000016 12:13985940-13985962 ATGCCTGTGCCCAGGGACCTAGG - Intergenic
1093935312 12:24994396-24994418 AAGGCTGGGCACAGGCACTTTGG + Intronic
1095043913 12:37477554-37477576 ATGTTTGGGTACAGGGCCTTTGG + Intergenic
1099537019 12:83857620-83857642 TTTTCTGGGAACAGGGAAGTTGG + Intergenic
1100305037 12:93342558-93342580 ATGTCAGGACACAGGGAAGGAGG + Intergenic
1102724072 12:115043260-115043282 TTGTCTGGCCACAGTGAGGTCGG + Intergenic
1102870034 12:116406837-116406859 ATGACTGGGAACAGTGACTTTGG + Intergenic
1103676774 12:122662141-122662163 ATGGCTGGGCACAGAGGCTTTGG - Intergenic
1103954603 12:124569034-124569056 ATGTCTGGCAAAAGGGAAGTGGG + Intergenic
1108364608 13:49697273-49697295 ATGTGTGGGAAAAGGGATGTGGG - Intergenic
1108587986 13:51887890-51887912 ATGACTGGGCATTGGGAGGTAGG - Intergenic
1111996456 13:95170137-95170159 ATGGCTGGGCACAGTGACTCAGG - Intronic
1112289995 13:98137748-98137770 ATGGCTGGGAACAGGGACAGTGG + Intergenic
1113634739 13:111911947-111911969 ATTTCTTGGCAACGGGACGTTGG - Intergenic
1113697178 13:112354774-112354796 ATCTGAGGGCACAGGGACGCCGG + Intergenic
1120282218 14:82454066-82454088 TTGTCTGGCCACAGGGAGGGAGG + Intergenic
1120749370 14:88183708-88183730 AGGTCTGGGGACAGGGAGATGGG + Intronic
1123110458 14:105864733-105864755 GTGGCTGGGGACAGGGACGCCGG - Intergenic
1124477242 15:30045463-30045485 CCCTCTGGGCACAGGCACGTGGG - Intergenic
1126290963 15:47078309-47078331 ATGTTTGGGTACAGGGCCTTTGG - Intergenic
1127845495 15:62866811-62866833 TTGGCTGGGCCCAGGGACGCAGG - Intergenic
1129462157 15:75704898-75704920 AGGCCAGGGCCCAGGGACGTGGG - Intronic
1129843695 15:78758635-78758657 ATCTCTGGGCACAGAGATGAAGG + Intergenic
1130258108 15:82335165-82335187 ATCTCTGGGCACAGAGATGAAGG - Intergenic
1130596823 15:85254797-85254819 ATCTCTGGGCACAGAGATGAAGG + Intergenic
1131445843 15:92497370-92497392 CTGTATGGGGACAGGGACCTCGG + Intronic
1132650295 16:1018510-1018532 ATGGCTGAGCCCAGGGAGGTTGG - Intergenic
1135967658 16:27049282-27049304 ATGGGTGAGCACAGGGATGTGGG - Intergenic
1139185669 16:64803731-64803753 ATGCCTGGGCACAGTTACGGAGG + Intergenic
1141440954 16:84029286-84029308 GTGTCTGGGCTCAGGGAAGTGGG - Intronic
1147975801 17:44247558-44247580 ACTTCTGGGTACATGGACGTGGG + Intergenic
1148103846 17:45108854-45108876 ATGTCTGGGAACAGGGACGGGGG + Exonic
1148844207 17:50519153-50519175 GTGTCTGGACACAGGGATGCTGG + Intronic
1150591143 17:66563801-66563823 CTGTCTGTGCAGAGGTACGTTGG + Intronic
1151581561 17:74982161-74982183 ATGTCCGGGGACAGGGAGGGAGG + Intergenic
1151951431 17:77356367-77356389 GTGGCTGAGAACAGGGACGTGGG + Intronic
1152595623 17:81236341-81236363 ATGTGTGGGCACTGGGATGGAGG + Intronic
1152740185 17:82015324-82015346 AAGGCTGGGCACAAGCACGTGGG + Exonic
1152918479 17:83053377-83053399 TTGACTGGGGACAGGGCCGTGGG + Intergenic
1157567419 18:48689018-48689040 ATGCCGGGGCACAGAGAGGTGGG + Intronic
1157589618 18:48828689-48828711 AGGGCTGGGGACAGGGATGTAGG - Intronic
1158672417 18:59488610-59488632 AAGTCTGGGCACTGGGCCTTGGG + Intronic
1158986511 18:62823282-62823304 AAGTCTGGGCACAGCGACTCAGG + Intronic
1160468070 18:79099506-79099528 ATATTTGGGCCCAGGGACGGTGG - Intronic
1160778884 19:869074-869096 ATGTCTGTGAACAGTGAGGTGGG + Intronic
1161801256 19:6417824-6417846 ATGCCTGGGCACTGGCACCTGGG + Exonic
1163324920 19:16597212-16597234 AGTGCTGGGCACAGGGACGTGGG - Intronic
1163727509 19:18931300-18931322 GTGTGTGGGCACAAGGAGGTGGG - Intronic
1164260224 19:23562878-23562900 ATATCTGGGCATAGGGCCATAGG - Intronic
1165062917 19:33213646-33213668 AGGTCTGGGGACAGGGACCCTGG - Intronic
1166258008 19:41619732-41619754 ATGTCAGGGGACAGGGAGGGAGG + Intronic
927878133 2:26672519-26672541 ATCCTTGGGCACAGGGAGGTGGG - Intergenic
928768707 2:34679108-34679130 ATGTCTGAGAACAGGTAGGTAGG + Intergenic
930118920 2:47743950-47743972 ATGTCTAGGCAGATGGAGGTGGG + Intronic
930500878 2:52215843-52215865 CTGTTTGGGCACATGGACTTTGG - Intergenic
932421205 2:71602528-71602550 ATGTCAGTGCAGAGGGACGCTGG - Intronic
936087750 2:109480768-109480790 TTGCCTGGGCACAGGGACCTGGG + Intronic
941183204 2:162286495-162286517 TTATCTGGTCACAGGGACATAGG - Intronic
948663577 2:239521169-239521191 ATGTCTGTCCACAGGGACCCTGG + Intergenic
949006320 2:241650769-241650791 AGGTATGGGGACAGGGAGGTGGG - Intronic
1170432672 20:16290811-16290833 ATGTCAGGGAAGAGGGAGGTAGG + Intronic
1172126296 20:32627099-32627121 TTGTCTGGGCATAGGGAGGTTGG - Intergenic
1174076969 20:47944284-47944306 ATGACTGGGCCCAGGCACGGGGG - Intergenic
1174668448 20:52282905-52282927 ATCTATGGGCACAGAGAGGTAGG - Intergenic
1176412907 21:6458402-6458424 ATGGCTGGGCATAGGGGCGTAGG - Intergenic
1178747448 21:35266638-35266660 ATGTCTTGGCAGATGGATGTAGG - Intronic
1179688400 21:43066724-43066746 ATGGCTGGGCATAGGGGCGTAGG - Intronic
1181277217 22:21694664-21694686 AGGTCTGTGCCCAGGGAGGTGGG + Exonic
1181762048 22:25065354-25065376 ATGTCTGGGCTGTGGGATGTGGG + Intronic
1183064862 22:35355868-35355890 ATGTTTGTGCACAGGGACTTTGG + Intergenic
954618945 3:51984981-51985003 ATGTCTGGACACAGGGTTGGAGG - Intronic
959771616 3:110105746-110105768 ATGACTGAGCACAGGGAAGATGG - Intergenic
962725120 3:138217850-138217872 ATGTCTGGGCACATGGGTGCAGG - Intronic
963045196 3:141097167-141097189 ATGTAAGGGCAGAGGGACATTGG - Intronic
964551575 3:157890739-157890761 ATGTGGGGGCACAGAGAAGTGGG + Intergenic
967184328 3:186931732-186931754 GTGTCTGGGCACACGGACACGGG - Intronic
969083408 4:4637714-4637736 AGGTTTGGGCACAGGGACACAGG - Intergenic
969090722 4:4692091-4692113 ATGTCTGGGCTCAGGGTCTGAGG + Intergenic
969209811 4:5678105-5678127 ATGTCTGGGAACATGGATTTTGG + Intronic
969219654 4:5751609-5751631 ATGGCTGGTCAAGGGGACGTGGG + Intronic
969299312 4:6288279-6288301 ATGCCTGGGCAAAAGGATGTGGG - Intronic
969428300 4:7138575-7138597 ATGTGTGGGCAGAGGGACACAGG - Intergenic
973548398 4:52005736-52005758 AGGGCTGTGCACAGGGACTTGGG - Intronic
976557853 4:86469385-86469407 ATGTCTGGGCACTGGTACTGGGG - Intronic
980987170 4:139706864-139706886 ATTTCTGGCCACAGAGATGTGGG + Intronic
990302237 5:54460392-54460414 ATGTCTGTGGGCAGGGATGTTGG + Intergenic
994281682 5:97911407-97911429 ATGTGCGGGCCAAGGGACGTGGG + Intergenic
998444483 5:142188054-142188076 ATGACTGCACACAGGGACCTGGG - Intergenic
998482345 5:142473441-142473463 ATGTCAGGGAACAGGGAGGAAGG - Intergenic
999961712 5:156763038-156763060 ATGCCTGGGAACAGGGAGGATGG + Intronic
1007358164 6:41335692-41335714 TTCTGTGGGCACAGGGAAGTGGG - Intronic
1007906940 6:45471413-45471435 ATGTCTGGGGCGAGGGATGTAGG - Intronic
1023340427 7:39213787-39213809 ATGTCTGCCCACTGGGATGTTGG - Intronic
1032076812 7:128839944-128839966 AGGACTGTGCACAGGGAGGTGGG + Intronic
1034551544 7:151823722-151823744 AGGGCTGGGCCCAGGGATGTGGG + Intronic
1041131546 8:54707402-54707424 CTGTCTGGGCACAGTGTCTTAGG - Intergenic
1041274652 8:56144298-56144320 TTAGCTGGGCACAGGGATGTGGG - Intergenic
1042549376 8:69980715-69980737 ATCTCTGCACACAGGGACATTGG - Intergenic
1045287716 8:100806344-100806366 AAGGCTGGGCACAGGGACTATGG - Intergenic
1048554682 8:135463208-135463230 ACGTCTGAGCACAGGGCCCTTGG + Intronic
1049542811 8:143216051-143216073 ATGAGAGGGCACAGGGAGGTGGG + Intergenic
1051683409 9:19631813-19631835 GTGTCTGGGCACAGGGTCCCAGG - Intronic
1051806292 9:20996453-20996475 ATGCCTAGGCCCAGGGAGGTCGG + Intergenic
1051806302 9:20996498-20996520 GTATCTGGGCCCAGGGAGGTGGG + Intergenic
1051818754 9:21140032-21140054 ATGTCTGGTAACAAGGACATAGG - Intergenic
1057150306 9:92790817-92790839 CTGTCTGGGCTCAGGCCCGTGGG - Intergenic
1057475685 9:95399313-95399335 ATGCCTGTGCACAGGGGAGTGGG + Intergenic
1061191687 9:129086035-129086057 ATGTGTGGGCACAGGTCCCTGGG + Intronic
1062556766 9:137116295-137116317 TTCTGTGGGCACAGGGATGTGGG - Intergenic
1186060117 X:5695797-5695819 ATGTCTGGGTAGGGGGAGGTGGG + Intergenic
1187447542 X:19372587-19372609 CTGTCTGGGGACTGGGACCTGGG + Intronic
1187806477 X:23126820-23126842 ATGTGTGGGCACTGGAACATGGG + Intergenic
1190217778 X:48491579-48491601 ATGTCTGTGCACATGTACGTGGG + Intergenic
1196642412 X:118077448-118077470 AGGCCTGGGACCAGGGACGTAGG + Intronic
1197256663 X:124270621-124270643 AGGTCTGGGCAAAGGGAGGGTGG + Intronic