ID: 1085053876

View in Genome Browser
Species Human (GRCh38)
Location 11:73393062-73393084
Sequence AGGTAGCCACAGGCTCCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 121}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085053876_1085053881 15 Left 1085053876 11:73393062-73393084 CCCATGGGAGCCTGTGGCTACCT 0: 1
1: 0
2: 0
3: 11
4: 121
Right 1085053881 11:73393100-73393122 ATCTCCCATGCTAGCACCCTCGG 0: 1
1: 0
2: 0
3: 8
4: 105
1085053876_1085053879 -9 Left 1085053876 11:73393062-73393084 CCCATGGGAGCCTGTGGCTACCT 0: 1
1: 0
2: 0
3: 11
4: 121
Right 1085053879 11:73393076-73393098 TGGCTACCTCAAGAGTGAAATGG 0: 1
1: 0
2: 0
3: 27
4: 144
1085053876_1085053886 25 Left 1085053876 11:73393062-73393084 CCCATGGGAGCCTGTGGCTACCT 0: 1
1: 0
2: 0
3: 11
4: 121
Right 1085053886 11:73393110-73393132 CTAGCACCCTCGGCTGTCTGGGG 0: 1
1: 0
2: 0
3: 4
4: 117
1085053876_1085053885 24 Left 1085053876 11:73393062-73393084 CCCATGGGAGCCTGTGGCTACCT 0: 1
1: 0
2: 0
3: 11
4: 121
Right 1085053885 11:73393109-73393131 GCTAGCACCCTCGGCTGTCTGGG 0: 1
1: 0
2: 0
3: 5
4: 59
1085053876_1085053884 23 Left 1085053876 11:73393062-73393084 CCCATGGGAGCCTGTGGCTACCT 0: 1
1: 0
2: 0
3: 11
4: 121
Right 1085053884 11:73393108-73393130 TGCTAGCACCCTCGGCTGTCTGG 0: 1
1: 0
2: 0
3: 2
4: 63
1085053876_1085053887 29 Left 1085053876 11:73393062-73393084 CCCATGGGAGCCTGTGGCTACCT 0: 1
1: 0
2: 0
3: 11
4: 121
Right 1085053887 11:73393114-73393136 CACCCTCGGCTGTCTGGGGCTGG 0: 1
1: 0
2: 1
3: 19
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085053876 Original CRISPR AGGTAGCCACAGGCTCCCAT GGG (reversed) Intronic
900541341 1:3204534-3204556 ACGGAGCCACGGGCTCCCCTGGG - Intronic
900642298 1:3693604-3693626 AAGTAACCAGTGGCTCCCATTGG - Intronic
1064198462 10:13264643-13264665 AGGAAGACACAGGAGCCCATCGG + Intergenic
1067395041 10:45907421-45907443 AGGTACACACAGGCTAGCATAGG + Intergenic
1067863361 10:49876552-49876574 AGGTACACACAGGCTAGCATAGG + Intronic
1069448503 10:68496304-68496326 ATGAAGCTACAGTCTCCCATTGG + Intronic
1069564017 10:69451390-69451412 AGGCAGCCGCGGCCTCCCATTGG + Intergenic
1070395554 10:76008780-76008802 AGGAAAACACAGGCTCACATGGG - Intronic
1073126966 10:101157112-101157134 GGGTAGCCACAGACTTCGATGGG + Intergenic
1073328252 10:102654957-102654979 AGGCTGCCCCAGGCTCCCAAGGG - Intronic
1075746035 10:124728327-124728349 TGGGTGCCACAGCCTCCCATGGG - Intronic
1077309210 11:1881022-1881044 AGGGAGCCACAGGCTGACAGGGG + Intronic
1077442178 11:2573998-2574020 AGGCAGCCACCAGCTCCCAGAGG - Intronic
1078363322 11:10687130-10687152 GGGTTGCCACATGGTCCCATGGG - Intronic
1078420630 11:11209197-11209219 TGGTAGCCACAGGCTATCTTGGG - Intergenic
1085053876 11:73393062-73393084 AGGTAGCCACAGGCTCCCATGGG - Intronic
1094043441 12:26141920-26141942 GGGGAGTCACAGGCACCCATAGG + Intronic
1094587365 12:31789788-31789810 AAATGGCCATAGGCTCCCATAGG - Intergenic
1101965364 12:109278843-109278865 AAGTAGCCCCAGGCTGCCAAGGG + Exonic
1101985320 12:109441563-109441585 TGGTAGCCACAGGCTTCTTTGGG - Intronic
1102001873 12:109562489-109562511 AGGGAGGAAAAGGCTCCCATGGG + Intronic
1102606796 12:114073950-114073972 AGGTAGCCACAACTTCCCAGGGG + Intergenic
1103466901 12:121149215-121149237 AAGCAGCCTCAGGGTCCCATGGG + Intronic
1112333180 13:98492619-98492641 GGGTGGCCACAGGCTTCCTTAGG + Intronic
1113509479 13:110841543-110841565 TGGTAGCCCCAGGCACCCCTTGG + Intergenic
1114417425 14:22554126-22554148 AGGCCTCCACAGGCTCCCACGGG - Intergenic
1129229197 15:74187309-74187331 AGGCAGGCACAGGATCCCAGAGG - Intronic
1132747482 16:1443045-1443067 AGGTGGCCACAGGGGCCCCTTGG - Intronic
1133171794 16:3986333-3986355 AGGTGGCCACAGGGTCCCGGTGG - Intronic
1133863435 16:9618790-9618812 AGATTGCTACAGGCTACCATCGG + Intergenic
1136185967 16:28589239-28589261 TGGTGGCCACAGGCCCCCACAGG - Intronic
1137636677 16:49992952-49992974 AGGCAGCCACATTCTCCCAAGGG + Intergenic
1140378577 16:74465525-74465547 AGGAACCCGCAGGCTCCCAGGGG + Intronic
1140653279 16:77112338-77112360 AGGTAGACACATGCTCCATTAGG - Intergenic
1141002279 16:80319189-80319211 AGCAAGCAACAGGCTCCCATTGG + Intergenic
1142471365 17:164999-165021 AGGGAGCCCCAGCCTCCCCTTGG - Intronic
1144688390 17:17242297-17242319 AGGTCGACACAGGATGCCATGGG - Intergenic
1145798576 17:27669622-27669644 TGGGAGCCACAGGGTCCCAGTGG - Intergenic
1146160495 17:30556992-30557014 TGGGAGCCACAGGGTCCCAGCGG + Intergenic
1150433907 17:65139497-65139519 AAGCAGCCACAGGCACCCCTGGG + Intronic
1151464392 17:74275220-74275242 AGGTAGTCACTGACCCCCATCGG + Intronic
1152120136 17:78413429-78413451 AGGTGGCCACGGGCTCCTCTGGG - Intronic
1152760784 17:82106039-82106061 GAGTAGCCACAGGCGCCCAGAGG - Intronic
1157483889 18:48073534-48073556 AGGTACGGACAGGCTCCCAGTGG + Intronic
1157528124 18:48400573-48400595 CTGTAGCCACAGCCTCCCCTAGG + Intronic
1158485610 18:57863301-57863323 AGGTAAGCACAGGCTTCCATGGG + Intergenic
1160070939 18:75627116-75627138 AGGCAGCCCCAAGCGCCCATGGG - Intergenic
1160272517 18:77400515-77400537 AGGTATCCACAGGCACACATGGG + Intergenic
1161505820 19:4642876-4642898 AGGTACTCACAGGCACCCATTGG + Intronic
1161588365 19:5117618-5117640 AGGCAGCCTCAGGCTCCACTAGG - Intronic
1162964720 19:14150462-14150484 AGGTTGCCAAAGGCCCCCACTGG - Exonic
1163641940 19:18466957-18466979 AGGCAGGCAAAGCCTCCCATGGG - Intronic
1163674048 19:18646527-18646549 AGGGAGCCACAGTCACCCATGGG - Intronic
1164907542 19:31979580-31979602 ATGCAGCCACAGGCTCTCCTGGG - Intergenic
1165130565 19:33629406-33629428 AGGTAGAGACTGGCTCCCTTGGG - Intronic
1165324929 19:35109009-35109031 AGGTGGTCCCAGGCTCCCTTTGG + Intergenic
1165429773 19:35766043-35766065 AGGTATTCACAGGCTCCCTCTGG + Intronic
1168667867 19:58218083-58218105 AGGTGGTCACAGGCTCCTAGGGG + Intergenic
925315375 2:2918977-2918999 ATGTAGCCTCAGGTTTCCATGGG + Intergenic
925362444 2:3288928-3288950 GGGCAGCCACAGGCCCCCAGCGG + Intronic
933975173 2:87503754-87503776 AGGAAGACACAGCCTCCCTTTGG - Intergenic
934899834 2:98150678-98150700 AGGCAGGCACAGGATCCCAGAGG - Intronic
936318652 2:111447060-111447082 AGGAAGACACAGCCTCCCTTTGG + Intergenic
937311317 2:120905141-120905163 TGGCAGCCTCAGGCTCCCTTGGG + Intronic
937926395 2:127170897-127170919 AGATGGCCACAGGCCGCCATGGG - Intergenic
945305417 2:208254918-208254940 AGGTAACCTCAGGCTCCAAGGGG - Intronic
945561737 2:211348068-211348090 TGGTACCCAAAGCCTCCCATAGG - Intergenic
1169067911 20:2704952-2704974 AGACAACCACAGGCTCCCTTGGG - Intronic
1170189391 20:13629425-13629447 AGATACCCACAGTCTCACATGGG + Intronic
1172670843 20:36633542-36633564 ACGTGGCCAAAGTCTCCCATGGG - Exonic
1172774303 20:37398179-37398201 GGGTCTCCACAGTCTCCCATAGG - Intronic
1173828402 20:46062322-46062344 GGGCAGCCACAGGCCCCCATGGG - Exonic
1174617037 20:51843584-51843606 AGGAAGCCAGAGGCTCACTTGGG + Intergenic
1175421771 20:58839470-58839492 AGGTGGGCGCAGGCTCCCGTGGG - Intergenic
1175905006 20:62375346-62375368 AGGTAACCCCAGGATCCCACTGG + Intergenic
1177527029 21:22306709-22306731 AGGTTGCCACAACCTCCAATTGG + Intergenic
1183828145 22:40404459-40404481 AGGTGGCCACAGGGACCCACAGG + Intronic
1184349754 22:43935926-43935948 AGGCAGCCACAGGCTCCACCAGG + Intronic
951979074 3:28545737-28545759 AGGTAACCACAAGTTCCCATAGG - Intergenic
957221570 3:77389401-77389423 AAGTAGCCACAAGCCCGCATGGG - Intronic
959511574 3:107218945-107218967 AGGAGGGCACAGGCTCCCAAAGG - Intergenic
961195436 3:124997668-124997690 AGGTAGCCACAGCTTCGCCTGGG - Exonic
961658383 3:128455659-128455681 TGGGACCCACAGGCTCGCATGGG - Intergenic
969320298 4:6408411-6408433 AGGTAGCCACACCCTCCTAGAGG + Intronic
970253414 4:14141321-14141343 AGGTAGCCACAGGCTCCTCCTGG + Intergenic
971241299 4:24891369-24891391 TGCTAGCAAAAGGCTCCCATGGG + Intronic
972831343 4:42817324-42817346 AGGTAGCCATAGTCTTCCAGAGG + Intergenic
972974270 4:44614213-44614235 GGGTAGACACAGGATGCCATAGG + Intergenic
973746849 4:53971810-53971832 AGGAAGACTCAGGCTTCCATAGG - Intronic
983427984 4:167610905-167610927 ATTTCTCCACAGGCTCCCATGGG + Intergenic
984933246 4:184867000-184867022 AGGAAGCCACAACCTCCCCTAGG - Intergenic
987073493 5:14359561-14359583 AGGAAGCCAAGGGCTCCCACAGG - Intronic
987402275 5:17490707-17490729 AGGGAGTCAGAGGCACCCATTGG - Intergenic
989458726 5:41671283-41671305 AGGTACCAACAGGCTACAATTGG - Intergenic
991131796 5:63131256-63131278 AGGGAGACACAGAGTCCCATTGG - Intergenic
997600254 5:135134112-135134134 AGGGAGCCACCGACTCCCAGGGG - Intronic
997668156 5:135648899-135648921 GGGCAGCCACAGGCCCCCAGGGG - Intergenic
998390545 5:141784441-141784463 AGGCAGGCCCAGGCTCCTATGGG - Intergenic
1001481744 5:172093547-172093569 AGGTGGCTCCAGGCTGCCATTGG + Exonic
1003204917 6:3999728-3999750 AGGAAGCCATAGGCTCTCATGGG - Intergenic
1006367798 6:33625750-33625772 AGGTAGACAGAGAATCCCATGGG - Intronic
1010637993 6:78283779-78283801 AGGTAGAAAGAGGCTCCCAAAGG - Intergenic
1011282342 6:85689534-85689556 AGATAGCCACAGTGTCCCATTGG - Intergenic
1011670658 6:89680055-89680077 AGGTAGTCAGAGGCTGCCAGGGG + Intronic
1013583603 6:111559536-111559558 AGGTGGGCACATGCTCCTATGGG + Exonic
1017531037 6:155292342-155292364 AGGTAGCAAAAGGGTCCCAAGGG + Intronic
1020274735 7:6617112-6617134 AGGTGCCCACAGGCCCCCAAAGG - Intronic
1022324590 7:29319724-29319746 AGACAGCCTCAGGCACCCATGGG - Intronic
1022438107 7:30409305-30409327 AAATAGCCACAGGGACCCATAGG - Intronic
1024156942 7:46635916-46635938 AGGAAGACACAGGCTCTCACAGG - Intergenic
1027714451 7:81652743-81652765 AGGTAGCCACCATCTCCAATGGG + Intergenic
1028823864 7:95246096-95246118 AGTTAGCCACAGGCATCCAAGGG + Intronic
1032559993 7:132879550-132879572 CAGAAGCCACAGTCTCCCATGGG - Intronic
1034895185 7:154872000-154872022 TGGTAGCCACGGGATCCAATGGG + Intronic
1035317625 7:158006718-158006740 AGGTAGGCCCAGGGTCCCTTAGG + Intronic
1035934182 8:3818603-3818625 AGGGAGAAACAGGGTCCCATGGG + Intronic
1038002231 8:23402376-23402398 TGGTAGCCACTGGGGCCCATGGG + Intronic
1038583592 8:28770671-28770693 AGGTAGCCACAGCCTCACGCAGG + Intronic
1039038600 8:33385507-33385529 AGGCAACCACAGGCTCCTAAGGG + Intronic
1039096094 8:33887759-33887781 AGCTGACCACAGGCTTCCATCGG - Intergenic
1046160067 8:110350478-110350500 AGCAAGGCACAGGCTCACATTGG + Intergenic
1047198694 8:122745229-122745251 AGGGAGCATGAGGCTCCCATTGG + Intergenic
1048885646 8:138907195-138907217 ACAAAGCCACAGGCTCCCCTAGG - Intronic
1050694263 9:8261509-8261531 AGGCAGCCTCAGGCACTCATTGG + Intergenic
1052214635 9:25951208-25951230 AGGTACCAACATGGTCCCATTGG - Intergenic
1052861412 9:33440033-33440055 AGGGATCCTCTGGCTCCCATGGG + Intergenic
1060221475 9:121766263-121766285 AGGGAGACCCAGGCTCCCATCGG - Intronic
1060223229 9:121775231-121775253 AGGTTGCCACAGGCTTTCCTGGG - Intronic
1060727756 9:126017149-126017171 AGGAAGCCCCAGGCTGCCAGGGG + Intergenic
1061410553 9:130418928-130418950 CTCCAGCCACAGGCTCCCATCGG - Exonic
1061467354 9:130792142-130792164 AAGTAGACACAGGGTCCCTTGGG + Intronic
1187972617 X:24674026-24674048 AGGTAGGAACAGCTTCCCATAGG + Intergenic
1191249679 X:58254412-58254434 AGGAAGTCACAGTCTTCCATGGG + Intergenic