ID: 1085054141

View in Genome Browser
Species Human (GRCh38)
Location 11:73394323-73394345
Sequence TGGGCTGGTGGGAGATAACG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 188}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085054134_1085054141 -7 Left 1085054134 11:73394307-73394329 CCTGTGTCCAAGTGAGTGGGCTG 0: 1
1: 0
2: 0
3: 10
4: 199
Right 1085054141 11:73394323-73394345 TGGGCTGGTGGGAGATAACGGGG 0: 1
1: 0
2: 0
3: 9
4: 188
1085054131_1085054141 0 Left 1085054131 11:73394300-73394322 CCACAGGCCTGTGTCCAAGTGAG 0: 1
1: 0
2: 1
3: 26
4: 234
Right 1085054141 11:73394323-73394345 TGGGCTGGTGGGAGATAACGGGG 0: 1
1: 0
2: 0
3: 9
4: 188
1085054129_1085054141 27 Left 1085054129 11:73394273-73394295 CCACAGCAAACAGCTGGTGCAGA 0: 1
1: 0
2: 2
3: 17
4: 245
Right 1085054141 11:73394323-73394345 TGGGCTGGTGGGAGATAACGGGG 0: 1
1: 0
2: 0
3: 9
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085054141 Original CRISPR TGGGCTGGTGGGAGATAACG GGG Intronic
900996011 1:6124109-6124131 TGGGGTGGTGGGAGGGAAGGTGG + Intronic
901795003 1:11674981-11675003 AGGGCTTGCGGGAGAGAACGGGG - Intronic
902418988 1:16262660-16262682 TGGGGTGGTCAGAGATTACGCGG + Intronic
904770951 1:32881168-32881190 TGGGCTGGTGGGACATTATTAGG + Intergenic
905251666 1:36652874-36652896 CTGGCTGGTGGGAGATTGCGAGG + Intergenic
906503862 1:46362630-46362652 TGGGATTGTGGGAGATTACTGGG + Intronic
906638268 1:47424888-47424910 TGGGCTGGAGGCAGAAAACCTGG + Intergenic
911735395 1:101331343-101331365 GGGCCTGGTGGGAGATGACTGGG - Intergenic
913017340 1:114752459-114752481 GGGGTTGGGGGGAGATAACAAGG - Intronic
918077751 1:181183307-181183329 TGGGCTGATGGGGGAAAATGAGG + Intergenic
918299381 1:183188754-183188776 TTGCCTGGTGTGAGATAAAGTGG + Intronic
920577213 1:207070345-207070367 CAGCCTGGTGGGAGATGACGAGG - Exonic
920654612 1:207866535-207866557 TGGGCTGGTAGGAGCTGAGGTGG - Intergenic
922375225 1:224957179-224957201 TGGGTTGGTGAGAGAGAAGGAGG + Intronic
922818830 1:228470449-228470471 TGGGCAAGTGGGGGATACCGGGG + Intergenic
923053257 1:230403720-230403742 TGCCCTGGTGGGAGAGAAGGCGG - Intronic
1062838078 10:649326-649348 TTGGATGGTGGGAGAGAACAGGG + Intronic
1066055285 10:31674908-31674930 TGGGCTTTTGGGAGTTAATGGGG - Intergenic
1067147869 10:43706582-43706604 TTGGCGAGTGGGAGATAAAGAGG + Intergenic
1076674376 10:132140605-132140627 TGGGCTTGGAGGAGGTAACGAGG + Intronic
1076674388 10:132140644-132140666 TGGGCTTGGAGGAGGTAACGAGG + Intronic
1077375998 11:2205378-2205400 TGGGCTGCTGGGAGGTAGGGAGG - Intergenic
1077376071 11:2205592-2205614 TGGGCTGTTGGGAGGTAGGGAGG - Intergenic
1078882989 11:15471532-15471554 TAAGCTGGTGGGAGATAAGAAGG + Intergenic
1079293420 11:19209687-19209709 TGGGATGGTGGGAGAAGAAGTGG - Intronic
1082796480 11:57381508-57381530 GGAGCTGGTGGGAGACAATGGGG + Intergenic
1083245179 11:61421336-61421358 TGGGCTGGAGGGAGAGCACTGGG - Intronic
1083822067 11:65178190-65178212 TCTTCTGGTGGGAGATAAGGAGG - Intronic
1085054141 11:73394323-73394345 TGGGCTGGTGGGAGATAACGGGG + Intronic
1085153135 11:74268145-74268167 TGTCCTGGTGGGAGATAAGTGGG - Exonic
1085626556 11:78078397-78078419 GGGGCTAGTGGGAGCTAATGGGG - Intronic
1086606692 11:88704178-88704200 TGGGCTTTTGGAAGATAAAGAGG - Intronic
1088971962 11:114781525-114781547 TGAGTTGGTGGGAGATAAAAGGG + Intergenic
1089306469 11:117529566-117529588 GGGGGTGGGGAGAGATAACGAGG - Intronic
1089699618 11:120236631-120236653 TGGGCTGGAGTGAGATAGAGAGG - Exonic
1089708621 11:120299072-120299094 TGGGCTGGTAGGAGAAATCCTGG + Intronic
1090195631 11:124814275-124814297 TGGGGTGGTGGGAGGAAATGGGG - Intergenic
1090363305 11:126187734-126187756 TGGGCAGGTGGGGGAGACCGTGG + Intergenic
1090378266 11:126306785-126306807 TGGGATGGTGGGAAATTAGGTGG + Intronic
1091701530 12:2666624-2666646 TGGGCTGCTGGCAGAGACCGTGG + Intronic
1095724398 12:45435977-45435999 TGGGCTGATTGTAGATAAAGGGG - Intronic
1096520483 12:52182017-52182039 TGGGCTGGTGGGAAAGAAGAAGG - Intronic
1096550106 12:52366521-52366543 TGGAAGAGTGGGAGATAACGGGG - Intronic
1096652247 12:53067599-53067621 TGGGATGGTGGGAGATGTGGAGG - Intronic
1097801228 12:63916635-63916657 GGGGCTGGAGGGAAATGACGGGG + Intronic
1098865025 12:75752451-75752473 TGGGCTGTTGAGAAATAAGGAGG - Intergenic
1102201279 12:111059599-111059621 TGGGGAGGTGGGAGATGAAGTGG + Intronic
1102426137 12:112845782-112845804 TGTTCTGGTGGGAGATAAAGGGG + Intronic
1102695730 12:114797890-114797912 TGGGCAGGAGGGAGAGAAGGTGG - Intergenic
1103755835 12:123206104-123206126 TGGGCTAGAGGAAGATAACGTGG + Intronic
1107334495 13:39339666-39339688 TGGGCAGGTGGAAGATGAGGTGG - Intergenic
1107468084 13:40666789-40666811 TGGGCTGGTGGGGGGTAGTGGGG + Intergenic
1107542480 13:41403970-41403992 TGGGCCTGTGGGAGATAATCAGG - Intergenic
1108684156 13:52804445-52804467 TTGTCTGGAGGGAGATAATGAGG - Intergenic
1109219697 13:59628816-59628838 TGGGATGGTGGGAGAAAAATAGG + Intergenic
1110301016 13:73927436-73927458 TGGGCTGGATGGAGATAGTGTGG - Intronic
1111509368 13:89241434-89241456 TGTGCTGGTGTGAGATCACAAGG - Intergenic
1112199224 13:97259185-97259207 TGTGGTGGTGGGAGATACTGCGG - Intronic
1112309676 13:98307402-98307424 TGGGGTGGTGGGGGAAACCGGGG - Intronic
1122012374 14:98760703-98760725 TTGGCTGGTGTGTGATAATGAGG - Intergenic
1122761848 14:104034525-104034547 TTGGCTGGTGCGAGGTTACGCGG + Intronic
1122943443 14:104993879-104993901 TGGCCTGGTAGGAGGTAACAAGG + Intronic
1123962578 15:25421093-25421115 GGGCCTGGTGGGAGGTAACTGGG + Intronic
1128065200 15:64760158-64760180 TGGGCTCGTGGGGGAGAAGGAGG + Intronic
1128288746 15:66460750-66460772 TGGGCCAGTGAGAGATAAGGGGG + Intronic
1128455353 15:67828596-67828618 TGGGGTGGTGGGAGATTCCGGGG - Intronic
1128808799 15:70555136-70555158 TGGGCTGGTGGGTGATCCCAAGG + Intergenic
1129750313 15:78058398-78058420 TGGGGTGGTTGGAGATATGGAGG - Intronic
1132244426 15:100283383-100283405 TGGTCAGGTGAGAGATAACCTGG - Intronic
1134857673 16:17534138-17534160 TGAGCTGGTGGCAGAGAAGGTGG + Intergenic
1136476681 16:30517874-30517896 GGAGCTGGTGGGAGAGATCGAGG + Exonic
1138436684 16:57004703-57004725 TGGGCTGCAGGGAGAGAACAAGG + Intronic
1143737363 17:8922154-8922176 TGGGAGGGTGGGAGAGAAGGAGG + Intronic
1144543497 17:16169501-16169523 TGGGCAGTTGGGAGAGAATGGGG + Intronic
1144703402 17:17352673-17352695 TGGGCTGCTGGGTGGTCACGGGG + Intergenic
1145300968 17:21636785-21636807 TGGGCAGTTGGGAGAGAATGGGG - Intergenic
1145349331 17:22066490-22066512 TGGGCAGTTGGGAGAGAATGGGG + Intergenic
1146171700 17:30639475-30639497 TGGGCTGGGAGGAGAGAATGGGG - Intergenic
1146267053 17:31459764-31459786 GGGACTGGTGGGGGATAAAGAGG - Intronic
1146345159 17:32055500-32055522 TGGGCTGGGAGGAGAGAATGGGG - Intergenic
1148169738 17:45508927-45508949 TGGGGGGGTGGGAGATGAAGTGG + Intergenic
1149417589 17:56476134-56476156 GGGCCTGGTGGGAGGTAACTGGG - Intronic
1150700409 17:67442395-67442417 TGAGGTGGTGGGAGATGACGAGG + Intronic
1151667931 17:75556229-75556251 TGGGCTGTTGGGATAAAATGAGG + Intronic
1151684681 17:75639645-75639667 TGGGCTGGTGGGAGAGGTTGGGG + Exonic
1153498948 18:5728907-5728929 TGGGGTAGTGGGAGAAAAAGTGG - Intergenic
1155075668 18:22351919-22351941 TTGGGTGGTGGGAGATGAAGGGG + Intergenic
1156513551 18:37661266-37661288 TTGGCTGGTGGGAGATGCCTGGG + Intergenic
1157149549 18:45202846-45202868 TGAGCTGATGGAAGATAAGGAGG - Intergenic
1157410516 18:47459200-47459222 GGGCCTGGTTGGAGATAATGGGG - Intergenic
1157872261 18:51241397-51241419 TGAGCTGGTGGAAGATGATGGGG + Intergenic
1164930607 19:32172979-32173001 GGGGCAGGTGGGAGAGAACCTGG - Intergenic
1165289978 19:34875188-34875210 TGGCCTGCTGGGAGATAAAGTGG - Intergenic
1166358997 19:42244255-42244277 TGGGGTGGTGGGGGGTAGCGGGG + Intronic
1166543911 19:43623040-43623062 TGGGTTGGGGGAAGATAACTGGG - Exonic
926667748 2:15543384-15543406 TGGACTGGTGGAAAATAATGGGG - Intronic
926885537 2:17595041-17595063 TGGGCTGGAGGGTGTTAATGAGG - Intronic
927377323 2:22433213-22433235 TGGGTTGGTGGGTGAGAAGGAGG + Intergenic
927972339 2:27313626-27313648 TGGGCTTGGGGGAGAAAACAGGG - Intronic
928280017 2:29937737-29937759 GGGGATGATGGGAGATGACGGGG + Intergenic
928280023 2:29937757-29937779 GGGGATGATGGGAGATGACGGGG + Intergenic
930204344 2:48573126-48573148 TGGGCTGGAGGGAGAAAAATAGG + Intronic
930736716 2:54787140-54787162 TGCGTTGGTGGGAGAGAAAGCGG + Intronic
932719870 2:74131024-74131046 GGGGCTGGTAGGGGATAAAGAGG + Intronic
934733476 2:96674168-96674190 TGGGGAGGTGGGAGATAAATGGG - Intergenic
935050926 2:99524422-99524444 TTGGCTGGTGGCAGATGAGGAGG + Intergenic
937320289 2:120956792-120956814 TGGGCTGGTGGGAAATCATGTGG + Intronic
937901683 2:127024852-127024874 TGGGATGGTGGGGGATAACTAGG - Intergenic
938120855 2:128632129-128632151 AGCGCTGGTGGGAGATGATGGGG - Intergenic
946785570 2:223239972-223239994 TAGCCTGGTGGAAGATAACCTGG + Intergenic
946918948 2:224558193-224558215 TGGGCTGTTGGGATTTAACTTGG - Intronic
947292323 2:228589893-228589915 TGGGGTGGTGGGAGCTAAGATGG - Intergenic
947551970 2:231052890-231052912 TGGGCTGCACGGAGATAAGGTGG - Intergenic
948246925 2:236494678-236494700 TGGGCTGGAGGGAGGTTATGGGG - Intronic
948867238 2:240782337-240782359 GGGGCTGCTGGGAGACACCGAGG - Intronic
1170516162 20:17132652-17132674 TGGGGTGGTAGGAGATCAAGAGG - Intergenic
1171559232 20:26107497-26107519 TGGGCAGTTGGGAGAGAATGGGG + Intergenic
1172282045 20:33714810-33714832 TGGGATGGGGGGAGAGAACAAGG - Intronic
1176520223 21:7818708-7818730 TGGCCTGGTGGGTGGTAAGGAGG + Exonic
1176651720 21:9554581-9554603 TGGGCAGTTGGGAGAGAATGGGG - Intergenic
1177245450 21:18517148-18517170 AGGGTGGGTGGGAGATAACGTGG - Intergenic
1178654249 21:34448720-34448742 TGGCCTGGTGGGTGGTAAGGAGG + Intergenic
1178681114 21:34672493-34672515 TGGACTTGTGGCAGATAACTAGG - Intronic
1179792105 21:43761701-43761723 AGGGCTGGTGGGACAAAAAGAGG + Exonic
1179819708 21:43929704-43929726 TGGGATGGAGGGAGAAGACGCGG + Intronic
1181682155 22:24502856-24502878 TGGGCTGGGGGGATAGAACAAGG - Intronic
1183238785 22:36640336-36640358 AGGGCTGGAGGGAGATTACAAGG + Intronic
1183309966 22:37104095-37104117 TGGGCTGGAGGAAGAAAACATGG - Intronic
1185382945 22:50518504-50518526 TGGGCTGGGGGGAGACAGCAGGG - Intronic
1203308279 22_KI270736v1_random:124695-124717 TGGGCTGGAGGGGAATAAAGTGG + Intergenic
949567550 3:5258919-5258941 TGGGCTTATAGGAGATAACCTGG + Intergenic
949850844 3:8418792-8418814 GGGCCTGGTGGGAGGTAACTGGG + Intergenic
953041818 3:39262245-39262267 TTGGGTGGTTGGAGATAACTGGG - Intergenic
953606197 3:44414901-44414923 TTGGCTGGTGAGAGACAAGGGGG - Intergenic
954303057 3:49711348-49711370 TGTGCTGGAGGGAGATGAAGGGG - Intronic
955574986 3:60351338-60351360 TGGGCTGCTGTGAGATGAGGTGG - Intronic
960634083 3:119766558-119766580 TGGGCTGATGGGATAGAAGGTGG + Exonic
961050250 3:123739510-123739532 TGGGCTCCTGGAAGATAATGTGG + Intronic
961462223 3:127058266-127058288 TGGGCTGGTGGGTGACCCCGTGG + Intergenic
963931627 3:151009728-151009750 TGGGGTGGTGGGGGAAAACCAGG - Intergenic
965465079 3:169019249-169019271 TGGGCTGGTGTGAGAAAAATTGG + Intergenic
968276900 3:197446982-197447004 TGGGCTGGTGACAGAGAACATGG + Intergenic
968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG + Exonic
969391440 4:6893880-6893902 TGGGCTAGCGGGAGATACTGAGG + Intergenic
971013887 4:22467757-22467779 TGGGTTGGTGGGGGAAAAAGGGG - Intronic
976236258 4:82900596-82900618 TTGGCTGCTGGGACACAACGTGG + Intronic
982810858 4:159824406-159824428 TGGGCTAGTAGGAGACAAGGAGG - Intergenic
984709286 4:182871755-182871777 TGGGGAGGTGGGAGATGTCGGGG - Intergenic
992135188 5:73737376-73737398 TGGGCTGGGGAGTGATGACGGGG - Intronic
992777800 5:80103591-80103613 TGGGCTGGTGGAAGCTTCCGTGG + Intergenic
997110102 5:131065489-131065511 GGGCCTGGTGGGAGATCACAGGG + Intergenic
997722857 5:136094325-136094347 TGGGCTGCAGGGAGAAAATGGGG - Intergenic
998398707 5:141836281-141836303 TGAGATGGTGGGAAAAAACGAGG + Intergenic
999940875 5:156541435-156541457 TGGGATGGTGGCAGAAAAGGTGG + Intronic
1001179241 5:169503246-169503268 GGGGCTGGGGGGAGAGAAAGGGG - Intergenic
1001776093 5:174330143-174330165 TTTGCTGGTGGGAGATTAGGAGG + Intergenic
1001944877 5:175770630-175770652 CACGCTGGTGGGAGATAACGAGG - Intergenic
1002674771 5:180902210-180902232 TGGGCAGATGGGAGAGAATGTGG + Intronic
1002784942 6:393266-393288 CGGGCTGGTGTGGGAGAACGAGG + Exonic
1005582902 6:27250826-27250848 TGGGCTGGGGGGAGGGAACTCGG + Intronic
1006185022 6:32176615-32176637 TGGACTGCTGGGAGATAGTGAGG - Exonic
1011712782 6:90071526-90071548 TGAGCTGGTGTGAGAGAACATGG + Intronic
1020185338 7:5954659-5954681 TGACATGGTGGGAGATATCGTGG + Intronic
1020297575 7:6770086-6770108 TGACATGGTGGGAGATATCGTGG - Intronic
1022976655 7:35564747-35564769 TGAGATGGTGGGAGAGAACAGGG + Intergenic
1024037899 7:45524116-45524138 TTGGCAGGGGGGAGATAACCTGG - Intergenic
1024260934 7:47573363-47573385 CGGGCTGGTGGGAGGCAGCGTGG - Intronic
1025278392 7:57605575-57605597 TGGGCAGTTGGGAGAGAATGGGG - Intergenic
1026103791 7:67404621-67404643 TGGGTGGGTGGGTGATAATGGGG + Intergenic
1028900900 7:96099714-96099736 TGGGCCTTTGGGAGATAACTGGG - Intronic
1030512433 7:110500165-110500187 AGGGCTGGTAGGAGATACAGAGG - Intergenic
1033245719 7:139714902-139714924 TGGGCAGCTGGGAGGTAACATGG - Intronic
1033308152 7:140239759-140239781 TAGGCTGGAGGGAGAGAAGGAGG + Intergenic
1034345648 7:150383861-150383883 TGGGCTGGTGGGAGGTTCCAGGG + Intronic
1036707641 8:11056966-11056988 TGGGCTGGTGGGCACCAACGTGG - Intronic
1037033909 8:14142707-14142729 GGGCCTGGTGGGAGGTGACGAGG + Intronic
1037334608 8:17780029-17780051 GGGCCTGGTGGGAGATGACTGGG + Intronic
1037674790 8:21043469-21043491 TGGGGTGGTGGGAGGTCAGGGGG - Intergenic
1037674891 8:21043682-21043704 TGGGGTGGTGGGAGGTCAGGGGG - Intergenic
1037674910 8:21043725-21043747 TGGGGTGGTGGGAGGTCAGGGGG - Intergenic
1038000696 8:23388892-23388914 TGGGTTGGAGGGAGAGAAAGAGG + Intronic
1040468243 8:47715071-47715093 TGGGAGGGTGGGTGGTAACGGGG - Intronic
1043334336 8:79155537-79155559 GAGCCTGGTGGGAGATATCGGGG + Intergenic
1047609013 8:126502527-126502549 TGGGATGGTGGGAGATGAAAGGG - Intergenic
1050626618 9:7510990-7511012 GGTTCTGGTGGGAGATAAGGTGG + Intergenic
1051576577 9:18622702-18622724 ATGCCTGGTGGAAGATAACGAGG + Intronic
1052454480 9:28677903-28677925 TGGGCAGGTGAGAGAGAAGGAGG - Intergenic
1053289890 9:36872936-36872958 GGGGCTGGTGGGAGATGAGCTGG - Intronic
1058416172 9:104791001-104791023 TGGGCTCCTGGGAGTTAATGGGG - Exonic
1060164532 9:121399168-121399190 TGGAGTGGTGGGAGATAAAACGG + Intergenic
1061703023 9:132430286-132430308 TGGGATGGGGGGAGAAAAAGTGG + Intronic
1061997195 9:134192566-134192588 TGGGCTGGTGGGGGACACAGCGG + Intergenic
1203629451 Un_KI270750v1:58136-58158 TGGGCAGTTGGGAGAGAATGGGG - Intergenic
1185766242 X:2727987-2728009 TGGAATGATGGGAGATTACGGGG - Intronic
1188924880 X:36027326-36027348 TGGGATGGTGTGAGATGGCGAGG - Intergenic
1197191964 X:123657121-123657143 TGGCTTATTGGGAGATAACGCGG + Intronic
1199899026 X:152154872-152154894 TGGGCTGGAGGGAAAAAACAGGG - Intergenic
1201960657 Y:19677697-19677719 TGGGCTGTTAGAAGCTAACGAGG - Intergenic