ID: 1085058028

View in Genome Browser
Species Human (GRCh38)
Location 11:73419281-73419303
Sequence CAAGCTGCACTGTGGGACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 169}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085058028_1085058033 5 Left 1085058028 11:73419281-73419303 CCTTGGTCCCACAGTGCAGCTTG 0: 1
1: 0
2: 0
3: 17
4: 169
Right 1085058033 11:73419309-73419331 GGGCAGTGTTTCTCATACAGAGG 0: 1
1: 1
2: 5
3: 37
4: 310
1085058028_1085058035 24 Left 1085058028 11:73419281-73419303 CCTTGGTCCCACAGTGCAGCTTG 0: 1
1: 0
2: 0
3: 17
4: 169
Right 1085058035 11:73419328-73419350 GAGGGCAATTTTGCCCCATAAGG 0: 1
1: 1
2: 7
3: 44
4: 258
1085058028_1085058036 25 Left 1085058028 11:73419281-73419303 CCTTGGTCCCACAGTGCAGCTTG 0: 1
1: 0
2: 0
3: 17
4: 169
Right 1085058036 11:73419329-73419351 AGGGCAATTTTGCCCCATAAGGG 0: 1
1: 2
2: 4
3: 34
4: 216
1085058028_1085058034 6 Left 1085058028 11:73419281-73419303 CCTTGGTCCCACAGTGCAGCTTG 0: 1
1: 0
2: 0
3: 17
4: 169
Right 1085058034 11:73419310-73419332 GGCAGTGTTTCTCATACAGAGGG 0: 1
1: 0
2: 4
3: 15
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085058028 Original CRISPR CAAGCTGCACTGTGGGACCA AGG (reversed) Intronic
900294624 1:1942745-1942767 GAGGCTTCACTGTGGGAACAGGG - Intronic
900856562 1:5189965-5189987 CCATCTCCACTGTGGGACCAAGG + Intergenic
901405086 1:9039995-9040017 GAAGCGGCACCGTCGGACCAGGG + Intronic
901786736 1:11629773-11629795 CAAGCTGCCCCCTGGGACCCTGG + Intergenic
902666639 1:17943931-17943953 CAGCCTGCACTTTGGGACAATGG - Intergenic
903235601 1:21948792-21948814 CATGCTCCACTGTGGGCCCAGGG + Intergenic
903802901 1:25982991-25983013 CAAACTGCAGTTTGGCACCAGGG + Intronic
903981528 1:27192196-27192218 GAAGCTGGACTGTGTGACCTTGG - Intergenic
904610872 1:31725610-31725632 CAAGCTGAGCTGTGGGAGCTTGG + Intergenic
905863014 1:41362849-41362871 CAAGAAGAACTGTGGGCCCATGG - Intronic
906607762 1:47183488-47183510 CCAGCTGCCCTGTGGGCACAGGG + Intergenic
907341122 1:53737180-53737202 CCAGCTTCACTGGGGGACGAAGG + Intergenic
907829803 1:58053934-58053956 CAGGCAACAATGTGGGACCATGG - Intronic
911091317 1:94019527-94019549 CAAGCTCCACCTTGGGCCCACGG + Intronic
912762742 1:112383460-112383482 GAAGCTGCAAGGTGGGAACAGGG + Intergenic
913485058 1:119326603-119326625 CAAGCTGCACTATTGGCTCAGGG + Intergenic
916470756 1:165119947-165119969 CAAAGTGCACAGTGGGAGCAGGG + Intergenic
918046453 1:180944491-180944513 CCAGCTGCACTGTGGTCCCCTGG - Exonic
920383349 1:205548749-205548771 CAAGCTGCACAGTGGAAGCTGGG + Intergenic
922738188 1:228000972-228000994 TGAGCTGCCCTGTGGGACGAGGG - Intergenic
922864683 1:228849463-228849485 CAAGCTCCAGTGTGAGAGCAGGG - Intergenic
923524371 1:234760663-234760685 CAACCTGCACTGTGGTGCCCTGG - Intergenic
924078540 1:240367348-240367370 CAAGCTCCAAAGTGGGAGCAGGG - Intronic
1064953367 10:20879589-20879611 CACTCTGCACAGTGGGACTATGG + Intronic
1065189113 10:23194615-23194637 CGCGGTGCACTGTGGGAGCAGGG + Intergenic
1066477891 10:35765315-35765337 CAGGCTGCACGGTGGGAAGACGG - Intergenic
1066501974 10:36003405-36003427 CCACCTGCACAATGGGACCATGG + Intergenic
1068502511 10:57858036-57858058 CAAGATCCACAATGGGACCAAGG - Intergenic
1073928963 10:108551906-108551928 CAATCTTCCCTGTGGGAACATGG - Intergenic
1074561416 10:114538773-114538795 CACTCTGCAGTGTGGGACGAGGG + Intronic
1074726180 10:116312184-116312206 AAGGCAGCAGTGTGGGACCATGG + Intergenic
1075667607 10:124242407-124242429 CCAGCTGCACTGGGGCAACATGG - Intergenic
1076450003 10:130550928-130550950 CACACTGCACTGTGGGAGCAGGG - Intergenic
1079574663 11:21988714-21988736 CCAGCTGCACTTTAAGACCAGGG - Intergenic
1081616901 11:44596538-44596560 CAAGTTGCCCTGTGGAACCAGGG + Intronic
1085058028 11:73419281-73419303 CAAGCTGCACTGTGGGACCAAGG - Intronic
1085386853 11:76162552-76162574 CATGCTGCACTGTGGGGGCAGGG + Intergenic
1085508039 11:77071256-77071278 CAGGCTGCACACTGGGGCCAGGG - Intronic
1088711836 11:112515694-112515716 CACGCTGCACTTTGGGGCTATGG - Intergenic
1090320346 11:125837819-125837841 CAGGCTGGATTGTGGGACAATGG - Intronic
1090394022 11:126407321-126407343 CGAGCTGCCCTATGGGACCAAGG + Exonic
1090624668 11:128595964-128595986 CAAGCTGCTCCTTGGGAACAAGG - Intergenic
1090705572 11:129333289-129333311 CAAACAGTAATGTGGGACCATGG + Intergenic
1092306368 12:7305047-7305069 CAAAATGCACTGCAGGACCATGG + Intronic
1096102518 12:48978381-48978403 CGGGCCGCACTGTGGCACCAGGG - Intergenic
1096999816 12:55867187-55867209 CAAGGTGCACTGTGGAAACATGG - Intergenic
1099216652 12:79861721-79861743 CAACCTGCAATGTGGGAGCTTGG + Intronic
1101660896 12:106764795-106764817 CAGTCTGCACTGATGGACCAGGG + Intronic
1102442933 12:112977567-112977589 CAAGATGTAGTGGGGGACCAGGG - Intergenic
1104279937 12:127367332-127367354 CAAGGAGCTCTGTGTGACCAGGG - Intergenic
1105968180 13:25403759-25403781 ATAGCTGCAATGAGGGACCAAGG - Intronic
1106203519 13:27566279-27566301 CAGGCTGCAATGTGGGAATAAGG + Intronic
1106252366 13:27992200-27992222 CGGGCTGGCCTGTGGGACCAGGG + Intergenic
1109102047 13:58198007-58198029 AATTCTTCACTGTGGGACCAAGG + Intergenic
1109528416 13:63606474-63606496 CAAGATCCACAGTGGAACCAAGG - Intergenic
1109763341 13:66860369-66860391 CAAGCTGAACCTTGGGACAAGGG - Intronic
1110461422 13:75749688-75749710 CAAGAGACACTGTGGGCCCAAGG - Intronic
1113399704 13:109979555-109979577 CAGGATGCACTGTGGGTCCTGGG + Intergenic
1114736679 14:25049866-25049888 CAGGCTGCACGGTAGGACCGGGG - Exonic
1115444970 14:33479567-33479589 CAAGCTGCACTTTGAAAACATGG - Intronic
1117402525 14:55371068-55371090 CCAGCTACAGGGTGGGACCAAGG + Intronic
1118323207 14:64765271-64765293 CAGGCTGCACTGGGGGCCAAGGG - Intronic
1120782052 14:88494184-88494206 CAGGCTGCAATGAGGGAGCAAGG + Intronic
1122240941 14:100366755-100366777 CAAGCTTCATTGTGGCCCCACGG - Intronic
1122852877 14:104546376-104546398 CCAGGTGCTCGGTGGGACCACGG + Intronic
1122864363 14:104596856-104596878 CACAGTGCACAGTGGGACCAGGG + Intronic
1122961837 14:105097477-105097499 CAAGCTGCCCTCTGGGCTCAGGG + Intergenic
1123152557 14:106196981-106197003 CCAGCTGCACTGTTGTACCCAGG + Intergenic
1125336397 15:38630691-38630713 AAAGCTGCACTGTTGGCCCTTGG - Intergenic
1126663694 15:51056360-51056382 GAAGCTGCACTGTGAAAGCAAGG + Intergenic
1128091472 15:64921998-64922020 CAAGATCCACTGTGAGAGCAAGG + Exonic
1129854952 15:78816970-78816992 GAAGGAGCACTGAGGGACCAGGG - Intronic
1129907321 15:79197602-79197624 AAAGCTGGACTGTGTGACCATGG - Intergenic
1130158063 15:81370418-81370440 CCAGCTGCACTCTGAGACCCTGG + Intronic
1130322138 15:82850315-82850337 CACGCCTCTCTGTGGGACCAGGG - Intronic
1130560340 15:84953201-84953223 GATGCTGCAGTCTGGGACCAGGG + Intergenic
1136080480 16:27849293-27849315 CAAACTGCACTGTGGGCTCCAGG - Intronic
1136122717 16:28150018-28150040 CAAGGTGCACTCTAGGACCAAGG - Intronic
1137083751 16:36097628-36097650 CAAGCTGCAAGGTGGCAGCAAGG - Intergenic
1142032450 16:87845334-87845356 CTAGCTGCCCTGTGGGCTCAGGG + Intronic
1143572758 17:7770684-7770706 CAGGCTGCAGAGTGGGACCAAGG + Intronic
1144837143 17:18162533-18162555 CAAGGTGGACTGTGGGAGAAAGG - Intronic
1145810235 17:27759969-27759991 CAAGCTCCACTGTGAGCCCTGGG - Intronic
1147995832 17:44359893-44359915 CAAGCTGCCCTGTGAGTGCAGGG - Exonic
1152164673 17:78694857-78694879 AAAGCATCACTGTGGGCCCACGG + Intronic
1153067517 18:1062996-1063018 CAGGATCTACTGTGGGACCAAGG + Intergenic
1155996783 18:32338991-32339013 AGAGCTGCAGTTTGGGACCAAGG - Intronic
1157675349 18:49564416-49564438 TGAGCTGCACTTTGGGAGCAGGG + Intronic
1158047181 18:53170241-53170263 CAAGCTGTACTGTGGAACTCAGG + Intronic
1158223862 18:55180285-55180307 CAAGCTCCACTGTGGGGTCTTGG + Intergenic
1159883340 18:73880830-73880852 TAAGCAGGACTGTGGGACCTTGG + Intergenic
1159926217 18:74271447-74271469 CAAACTGCACTGTGGGATGAGGG - Intronic
1160146590 18:76370587-76370609 CAAACACCACTGTGGGAACAAGG + Exonic
1160441902 18:78899478-78899500 CACGATGCACTGTGGGGACAAGG + Intergenic
1162017762 19:7854769-7854791 CCAGCTGAACTGAGGGACTAGGG + Intronic
1162419860 19:10559911-10559933 CCAGCTGGACTGGGGGACCGTGG + Exonic
1162643955 19:12035370-12035392 CCAGCCCCACTGTGGGGCCAAGG + Intronic
1163713293 19:18859821-18859843 CAAGCTGCAGTGTTGGGCCCCGG + Intronic
1164004409 19:21135537-21135559 CAAGCTGCAGTGAGAGACAAAGG + Intergenic
1164824575 19:31275208-31275230 AAAGCTGCAGTGTGGGATCTTGG + Exonic
1165049444 19:33132262-33132284 CAAGCTGTCCTGGGGGACCATGG + Exonic
1167284747 19:48592708-48592730 CAAACTGCACTGTGGGCAGAGGG - Exonic
927229220 2:20803414-20803436 CAAGCTGCTGTGTGGAACAAAGG - Intronic
928327956 2:30334999-30335021 CAGGTGGCACTGTGGGACCCAGG - Intergenic
928369398 2:30730306-30730328 AAAGCTGCACAGTGAGACAATGG + Intronic
928443726 2:31314833-31314855 CACACTTCACTGTGGGACCATGG - Intergenic
929955914 2:46458593-46458615 CCAGCTCCAGTCTGGGACCATGG + Intronic
930458892 2:51644100-51644122 CAAGCTGCACTGTGATTCAAGGG - Intergenic
936822163 2:116535418-116535440 CCAGCTGCTGTGTGTGACCACGG - Intergenic
937940296 2:127280117-127280139 CAGGCAGCACTGTGGTATCAGGG + Intronic
941652932 2:168112863-168112885 CCAGCTGCCCTGAGGGATCAGGG + Intronic
947306031 2:228748691-228748713 CAAGAAGCACTGTGGGATCCTGG + Intergenic
948122993 2:235544614-235544636 CAAGCTGCACTGTCCCACCTTGG - Intronic
948226870 2:236318137-236318159 CCAGCTGCACCTTGGGCCCAAGG - Intergenic
1172477754 20:35251774-35251796 CAAGCTACACTCTGGGACCCTGG - Intronic
1174929060 20:54793775-54793797 GTGGCTGCACTGTGGGCCCAGGG + Intergenic
1175561543 20:59934107-59934129 CGAGCTGGACCGGGGGACCAGGG + Intronic
1175987748 20:62772330-62772352 CACGCTGCACTGTGGTGCCCAGG + Intergenic
1176163881 20:63662893-63662915 CAAGCAGCTGGGTGGGACCAGGG + Intronic
1181674303 22:24441793-24441815 CAAGCTGCTCTGTGGAGACAAGG - Exonic
1182508154 22:30800288-30800310 GAGGCTGCCATGTGGGACCAAGG + Intronic
1183279149 22:36922904-36922926 CAGGCTGCACAGTCGGTCCAGGG + Intronic
1183395735 22:37569662-37569684 CATGCTGCCCTGTGGGATTATGG - Intergenic
1184089587 22:42285164-42285186 CCAGCTGCCCCGTGGCACCAGGG - Intronic
1184108254 22:42381149-42381171 CTGGCTGTCCTGTGGGACCAGGG - Exonic
951577051 3:24124681-24124703 CTCTTTGCACTGTGGGACCAAGG + Intronic
954171372 3:48805396-48805418 AAAGCTGCACTGAGAGAACAGGG + Intronic
960864640 3:122186698-122186720 CAGACTGAACTGTGAGACCAGGG + Intronic
962391772 3:134978274-134978296 GAAGATGCACTGAGGGGCCAGGG - Intronic
964200096 3:154109238-154109260 CAAGGTGGACTGTGGGGCCAGGG - Intergenic
969298708 4:6284861-6284883 CACGCTGCTCTGTGGGCCCATGG + Intronic
969316438 4:6384041-6384063 AAAGCAGCTCTGTGGGAACACGG + Intronic
969491871 4:7504074-7504096 CAGGCTGCAGTGAGTGACCAGGG - Intronic
969717669 4:8875984-8876006 TAAGCTGCCCTGTGGCACCTGGG - Intergenic
970219883 4:13799385-13799407 CAAGCTGCAAGGTGGCAGCAAGG + Intergenic
972697423 4:41461500-41461522 CAAACAGCCCAGTGGGACCACGG - Intronic
974408105 4:61502195-61502217 CAAGGTCCAATGTGGGACCTTGG + Intronic
980060999 4:128129302-128129324 CAGGCTGCAGTGTGTGACCTCGG - Intronic
980107183 4:128599310-128599332 TAAGCTGTTCTGTGGGACCGAGG + Intergenic
983649240 4:170022295-170022317 CAAGCTGCCCTGTGAAACCTGGG + Intronic
985794611 5:1952883-1952905 CCAGCTGCACTGAGACACCAGGG - Intergenic
986103180 5:4632508-4632530 CAAGCTGGACTGTTGTCCCATGG + Intergenic
987424425 5:17756521-17756543 CAAGCTGCACTTTGACCCCAGGG - Intergenic
990302314 5:54461156-54461178 CAAACTGCACTGAGGTATCAGGG + Intergenic
992758381 5:79930482-79930504 CAAGCTGCCATGTGGGAGCTGGG + Intergenic
1001401776 5:171450515-171450537 CGAGCTGTAGTGTGGGACCTGGG - Intronic
1004183473 6:13400824-13400846 CAAACTGTTCTGTGGGACAAGGG + Intronic
1006387434 6:33739166-33739188 CAGGCTGCACTGAAGGCCCAGGG - Exonic
1008070399 6:47093579-47093601 CAAGTTGCAAAGTGGGAACATGG - Intergenic
1008682909 6:53893139-53893161 CTAGCTGCACTTAGGGACAAAGG + Intronic
1009790950 6:68400441-68400463 CATCCTGCACTGTGCTACCATGG - Intergenic
1011124708 6:83994827-83994849 GAAGCTGCAGTGTGGTATCAAGG - Intergenic
1014005354 6:116411430-116411452 CAGGCTGCACTCTGGGAGGAGGG + Intronic
1015259926 6:131225326-131225348 CAATGTACCCTGTGGGACCAGGG - Intronic
1017765876 6:157606672-157606694 CAAGCTGCACTTCTGCACCAGGG - Intronic
1017923420 6:158890486-158890508 GAGGATGCACTGTGGGACCGTGG + Intronic
1018850132 6:167581707-167581729 CAACCTGGACTCTGGGGCCATGG - Intergenic
1018918417 6:168153083-168153105 CACGCTGTTCTGTGGGGCCAGGG - Intergenic
1020657113 7:10940834-10940856 AAAGATGCAATTTGGGACCAGGG - Intergenic
1023479393 7:40616640-40616662 CATGGTGGATTGTGGGACCATGG + Intronic
1030616321 7:111741887-111741909 CAAACTGCACTGTTTTACCAGGG - Intronic
1033079756 7:138284307-138284329 CAAGCTGGAGTGTGTGATCATGG - Intergenic
1034962547 7:155371930-155371952 CCAGAAGCTCTGTGGGACCACGG - Intergenic
1035382080 7:158446602-158446624 CAAGCTGCTCCGTGTGTCCATGG - Intronic
1036001147 8:4606415-4606437 CTAGCAGCACTGTGAGCCCAGGG - Intronic
1037414456 8:18634548-18634570 CAGAATGCACTGTGGGATCATGG - Intronic
1042089521 8:65143700-65143722 CGAGCCGCACTGAGGGACGAGGG + Intergenic
1045949726 8:107838114-107838136 CCAGAGGCACTGGGGGACCATGG + Intergenic
1051829862 9:21263985-21264007 GAATGTGCACTCTGGGACCAGGG - Intergenic
1056679486 9:88704722-88704744 AAAGCTGCACGTTGGGATCATGG - Intergenic
1058271735 9:102981234-102981256 CTAGCAGAACTGTGGGACCAAGG + Intergenic
1060473233 9:123965911-123965933 AAAGATTAACTGTGGGACCAAGG - Intergenic
1062625105 9:137438942-137438964 CAGCCTGCACTGGGGGCCCAGGG + Intronic
1185467566 X:363687-363709 GAAGATGCACTGTGGGATCGCGG - Intronic
1188340723 X:28998000-28998022 CCAGCTGCACTGAGGGAAAAGGG - Intronic
1188380536 X:29486240-29486262 CAATCTGCAGGATGGGACCATGG + Intronic
1189043188 X:37564437-37564459 CAAGCCTCACTGTGTGACCTAGG - Intronic
1191062211 X:56310645-56310667 GAAGCTGCACTGCTGGCCCAAGG + Intergenic
1193620829 X:83750905-83750927 CAAGCTGCAAGGTGGCAGCAAGG + Intergenic
1193912989 X:87328043-87328065 CTGGCTGCATTGTGGGCCCAAGG - Intergenic
1194950792 X:100123240-100123262 CAAGCTGAACTGGGATACCAAGG + Intergenic
1195542226 X:106075747-106075769 CAAGCTTCCCAGTGAGACCAAGG - Intergenic
1201510059 Y:14749294-14749316 CAGGCTGCACAGTGTGTCCAGGG - Intronic
1202162692 Y:21952075-21952097 CCAGCTTCAGTGTGGGGCCAAGG + Intergenic
1202228664 Y:22634293-22634315 CCAGCTTCAGTGTGGGGCCAAGG - Intergenic
1202314493 Y:23561874-23561896 CCAGCTTCAGTGTGGGGCCAAGG + Intergenic
1202556309 Y:26108721-26108743 CCAGCTTCAGTGTGGGGCCAAGG - Intergenic