ID: 1085058249

View in Genome Browser
Species Human (GRCh38)
Location 11:73420886-73420908
Sequence TTACCTTCATGGTGTCCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 160}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085058249 Original CRISPR TTACCTTCATGGTGTCCTGA GGG Intronic
900520927 1:3105188-3105210 CTGCCTGCCTGGTGTCCTGAGGG + Intronic
902698850 1:18158029-18158051 TGACCTTCATAGTGTCCCCAGGG - Intronic
904955162 1:34277137-34277159 CTACTTTCTTGGTGTTCTGAAGG + Intergenic
904968464 1:34399749-34399771 GGACCTTCAGGGTGGCCTGAGGG + Intergenic
906700789 1:47856599-47856621 TTCCAGTCATGATGTCCTGATGG + Intronic
909274911 1:73671052-73671074 TTTCCTTCATGTTGTTCTCACGG + Intergenic
914947999 1:152083068-152083090 TTACCTATATGGTTTGCTGACGG - Intergenic
918113671 1:181479736-181479758 TTACCCTATTGCTGTCCTGAAGG + Intronic
919169281 1:193933589-193933611 TAATCTTCATGGTATCCTAAAGG - Intergenic
919835631 1:201571184-201571206 TTGCCATCATGGTGTGATGAAGG + Intergenic
920268595 1:204745605-204745627 AGACCTTCCTGGTGTCCTGCTGG - Intergenic
921858561 1:220015769-220015791 TTACCTTCTTGCTTTCCTGAAGG - Intronic
922095900 1:222442584-222442606 TGACCTTCCTGGTGTTATGAAGG - Intergenic
922158100 1:223055648-223055670 TTTCCTTCAGGGTGTCTTCAGGG - Intergenic
923831242 1:237559911-237559933 TTAGCTTCATGGTCAGCTGATGG + Intronic
923986851 1:239391373-239391395 TGTCCATCATGGTGTACTGAGGG - Intronic
1064190023 10:13197706-13197728 TCACCTCCAGGATGTCCTGAGGG - Exonic
1068266399 10:54655789-54655811 TTGTCTTCATGTTTTCCTGAAGG - Intronic
1072007797 10:91271727-91271749 TCACCGCCATGGTGTCATGATGG - Intronic
1073549921 10:104389252-104389274 TTATCTTCTTGGTGTCCTGACGG + Intronic
1077472093 11:2768856-2768878 TGACCTTAATGGTGGCCCGATGG - Exonic
1078792963 11:14563040-14563062 TTACCTTTATTGTGTCATTATGG + Intronic
1080136653 11:28862949-28862971 TTACCTCCATGCTGTCCTTCAGG + Intergenic
1081460955 11:43272585-43272607 TTACCTCCATGCTGTTCTCATGG + Intergenic
1081816859 11:45950231-45950253 TTGCCTTCATGGTGTCTCTAGGG - Exonic
1083198900 11:61107750-61107772 TGACTTTCATGGTGTCCAGAGGG + Intronic
1083348555 11:62011329-62011351 TTCCCCTCATGGTTTCATGATGG - Intergenic
1085058249 11:73420886-73420908 TTACCTTCATGGTGTCCTGAGGG + Intronic
1085715013 11:78864739-78864761 TTACATCCAGGGTGTCATGAGGG - Intronic
1085872904 11:80371414-80371436 TTCCATTCATGGTTGCCTGAGGG - Intergenic
1087253080 11:95924688-95924710 ATCCCTTTATGGTGTCCTTATGG - Intronic
1087304861 11:96476828-96476850 TTATCTTCATGGTGTGCTGTTGG - Intronic
1089721067 11:120422214-120422236 TTCCATTCATGGTGTCATGTTGG - Intronic
1095341266 12:41091833-41091855 ATAACTTCATAGTGGCCTGAAGG - Intergenic
1095952513 12:47789535-47789557 TGATCTGCATGGTGTCCTGGGGG + Exonic
1097599102 12:61670076-61670098 TTACCCTCATGCTGTTCTCATGG - Intergenic
1102353343 12:112211506-112211528 TTACCTTAGAGATGTCCTGAAGG + Intronic
1104208174 12:126660869-126660891 TTGCCTTCCTGGTCCCCTGATGG - Intergenic
1104411133 12:128558743-128558765 TTACCTACAGGTTGCCCTGAGGG - Intronic
1106973720 13:35179309-35179331 TTACCTTGATGTTGTTCGGAAGG + Intronic
1107100306 13:36583151-36583173 TCACCTTCATGGTCTCCAGAGGG - Intergenic
1107450160 13:40500988-40501010 TTACCTCCATGCTGTTCTCATGG + Intergenic
1107627213 13:42301261-42301283 TTACCTGGATTGTGTTCTGAAGG - Exonic
1110262827 13:73504873-73504895 TTACCTCCATGCTGTTCTCATGG - Intergenic
1112432205 13:99359858-99359880 TTCCCTGCATGGTGGCCTGCAGG + Intronic
1112948801 13:104963840-104963862 CAACCTTCATGTTGTGCTGAGGG + Intergenic
1114889652 14:26902128-26902150 TTACATTCATGCTGTCTTCAGGG + Intergenic
1122345354 14:101055240-101055262 TTACCTTAAGGGAGTGCTGAGGG - Intergenic
1126386427 15:48098317-48098339 TTAGCTTCTTGGTGTTCTGGTGG - Intergenic
1126936926 15:53720910-53720932 TTGCCTTTATGGTGACCAGAGGG - Intronic
1128432103 15:67606431-67606453 CTGCCTTCATGGTGTTTTGAAGG + Intronic
1130610525 15:85356851-85356873 TTACATTTAGGGTGTCATGATGG - Intergenic
1131939883 15:97550125-97550147 TTTCCTTAGTGGTTTCCTGAAGG + Intergenic
1133074051 16:3265790-3265812 TCACCTTCATGGTGTTCTCAGGG + Intronic
1133239957 16:4408377-4408399 TTGCCCCCATGGTGTCCAGAGGG - Intronic
1137497834 16:48984406-48984428 TTCACCTCTTGGTGTCCTGAAGG - Intergenic
1139493698 16:67301182-67301204 TTCCCCTCATGGTTTCCTCAGGG - Intronic
1140681869 16:77393128-77393150 TCACCTCCATGGTGACCAGATGG - Intronic
1141402958 16:83766818-83766840 TTTCCTTCATGCTGTTCTCATGG + Intronic
1142756254 17:2018183-2018205 TTCCCTCCAGGGTGACCTGATGG - Intronic
1149177075 17:53885698-53885720 TTACTTTCATGTTATCATGATGG + Intergenic
1149214938 17:54343596-54343618 ATACCTTAATGGTGAGCTGAAGG + Intergenic
1150191147 17:63240689-63240711 TTAGTTTCATGTGGTCCTGATGG - Intronic
1150942492 17:69707730-69707752 TGACCTTCAGGGTGGGCTGAAGG + Intergenic
1157884820 18:51356872-51356894 TCACCCTCATGATGTCCTAAAGG - Intergenic
1163229962 19:15994783-15994805 TTACCTTCATGGTGTTCTCATGG + Intergenic
1163738101 19:18994166-18994188 TTACCTTCCAGGTTTGCTGAAGG - Exonic
1166969733 19:46558193-46558215 TTCCTTTCATGCTTTCCTGAAGG + Intronic
1168710746 19:58498676-58498698 TGACCTCCATGGCGTCCTGCAGG + Exonic
925251629 2:2443936-2443958 TGACCTTTATGATGTCCAGATGG - Intergenic
927038600 2:19205671-19205693 TTACTTTCAGGGCTTCCTGAGGG + Intergenic
927057393 2:19378405-19378427 TTGCCTTGATGGTGTTCTTAAGG - Intergenic
927188044 2:20496648-20496670 TGAGCTTCATGGTGTCCTGAGGG - Intergenic
930295915 2:49553458-49553480 TTACCCTCATGCTGTTCTCATGG - Intergenic
933897444 2:86824571-86824593 TTCCCTTCCTGGGGTCCTGTGGG + Intronic
937923707 2:127151430-127151452 TTAACTTCATGGATGCCTGAGGG - Intergenic
938234410 2:129692245-129692267 TTTTCTTCATGGCTTCCTGATGG - Intergenic
940104509 2:150083262-150083284 TTACCTTCATGGTCACGTGTAGG - Intergenic
940728811 2:157366090-157366112 CTACTTTCATGATGTCCTTATGG - Intergenic
941512880 2:166436272-166436294 TTACCTTCATGCTGTTCTCATGG + Intronic
944465567 2:199996572-199996594 ATACCTTCACAGTGTCCTGGAGG - Intronic
946616483 2:221516053-221516075 TCACCTTCATGTTTTCCTCAAGG + Intronic
948081514 2:235208924-235208946 TTACATTCATTGTCTCTTGATGG + Intergenic
1168761753 20:354350-354372 TCACCTTCCTGGTTCCCTGAGGG + Exonic
1172667124 20:36608011-36608033 TTACCTTCCTGCCTTCCTGAAGG + Intronic
1173259836 20:41424151-41424173 TTATCTTACTGGTGTCCCGAAGG + Intronic
1173938474 20:46889586-46889608 TTTCCTGCATGGTGTTTTGATGG + Intergenic
1176893252 21:14344813-14344835 TTACCTTTATGATGTTCTGTGGG - Intergenic
1181532882 22:23527051-23527073 TTATCTCCATGGTGCCCAGATGG - Intergenic
949522562 3:4870015-4870037 TTACTTTGAAGCTGTCCTGATGG + Intronic
951167170 3:19496561-19496583 TTACCTTTATGATGTGCTGCTGG + Intronic
951448789 3:22813128-22813150 TAATCATCAGGGTGTCCTGATGG + Intergenic
952667240 3:35922007-35922029 TTGCCTACAAGGTCTCCTGATGG + Intergenic
952722611 3:36548835-36548857 TTTCCTGCATGGTGGCCTCAGGG - Intergenic
953207709 3:40846541-40846563 TTTCCTTCATGGTTCCCTAAAGG + Intergenic
955828471 3:62975135-62975157 TTACCTTCATAGGGCCCTCAAGG - Intergenic
956071227 3:65454162-65454184 TTAGCTGCATGGTGCCCTGGGGG - Intronic
957120627 3:76086299-76086321 TTACCTCCATGCTGTTCTCATGG - Intronic
957287413 3:78234677-78234699 TGACCTTCAAGGTGTCCACATGG - Intergenic
959759564 3:109944048-109944070 TTCCCTTCCTGGTTTCCTGTTGG + Intergenic
961819723 3:129569807-129569829 TGCCCTCCAAGGTGTCCTGAGGG + Intronic
969030745 4:4211063-4211085 TTAGCTCCATGGTGGCTTGATGG - Intronic
969509844 4:7611553-7611575 TCACCTTCAGGGGGCCCTGAAGG - Intronic
970880951 4:20930240-20930262 TTTACTTCAGGGTGTCCTGTTGG - Intronic
970997302 4:22282168-22282190 TTACCCTCATGCTGTTCTCATGG + Intergenic
971213152 4:24639412-24639434 TTTCCATCATGGTGGCCTCAGGG + Intergenic
971856991 4:32057299-32057321 TTACCTCCATGCTGTTCTCATGG - Intergenic
974589899 4:63932746-63932768 TTACCTTTATGATGTGCTGTTGG - Intergenic
976193126 4:82508094-82508116 TTATTTTCATGGTGTCTGGAAGG - Intronic
981471616 4:145141776-145141798 TTTCCTTCTTGGTGTCCAGGAGG - Intronic
983259216 4:165437328-165437350 TTACTTAAATGGTGTCCAGAGGG - Intronic
983731917 4:171005532-171005554 TTATCTTCTTGGTGTCCTGTTGG + Intergenic
984012396 4:174385925-174385947 TTACCCCCATGCTGTCCTCATGG - Intergenic
984552889 4:181181864-181181886 CTACCTTGATGGTGGCCTGATGG + Intergenic
986668243 5:10121404-10121426 TTTCCTTCATACTGTCCTCATGG + Intergenic
986701446 5:10413163-10413185 TGACCTTCATGCTTTCCTCAAGG - Intronic
991538348 5:67698187-67698209 TGAGCTTCTTGGTGTCCTCAGGG - Intergenic
992614005 5:78532505-78532527 TTAGCTTCATGATGTCATCAGGG - Intronic
993045859 5:82865989-82866011 TCACCTTCATGAGGTGCTGATGG - Intergenic
998789832 5:145754084-145754106 TTACCTTCAAGCTGTTCTGATGG - Intronic
999114129 5:149147430-149147452 TTAACTTCTTGGTGTTCTGCTGG + Intronic
999873314 5:155774532-155774554 TTCCCTTCAGAGTGTCCAGAAGG - Intergenic
1001432501 5:171674030-171674052 TTACCCTCATGGTGACAAGATGG - Intergenic
1003991117 6:11487634-11487656 GGAGCTTCATGGTGTCTTGAAGG - Intergenic
1005222584 6:23604400-23604422 TTATTTTCATTGTGTTCTGAGGG - Intergenic
1005380287 6:25226917-25226939 TTACTTTCATGCTATTCTGATGG - Intergenic
1005388015 6:25305093-25305115 TTATCTTCCTGCTGTCCTGGTGG + Intronic
1005475874 6:26207305-26207327 TTACCTCCATGCTTTCCTGCTGG - Intergenic
1007507774 6:42349540-42349562 TTTCCTACCTGGTGTCCTGAAGG + Intronic
1008966220 6:57315670-57315692 TTAACTTCTTTGTATCCTGATGG + Intronic
1009400959 6:63255128-63255150 TTACTTTCAAAGAGTCCTGAGGG - Intergenic
1009614936 6:65991625-65991647 TTATCTGCATGCTGTTCTGATGG - Intergenic
1011862588 6:91778634-91778656 TTACCTTCCTGGTCTCCTATAGG - Intergenic
1014305660 6:119738331-119738353 TTAGCTTCTTGGTTTTCTGATGG + Intergenic
1016946135 6:149535687-149535709 TTATCTTGATGGTGTCCATACGG - Exonic
1017398370 6:154029753-154029775 TTACCTCCATGCTGTTCTCATGG + Intronic
1017494839 6:154974532-154974554 TTTCCTTCCTGGCTTCCTGAGGG - Intronic
1020807895 7:12813311-12813333 TTATCTGCATGGAGTCCAGATGG + Intergenic
1021059537 7:16093505-16093527 TTTCCTTGATTGTGTTCTGAGGG + Intronic
1021921869 7:25493928-25493950 TCACCTTCATGCTGACCTGCTGG + Intergenic
1022276559 7:28861031-28861053 TAAGCCTCATCGTGTCCTGATGG + Intergenic
1023267136 7:38418525-38418547 CTAGCTTCATGGTGACCTGTTGG - Intronic
1026276331 7:68880471-68880493 ATATCTTCATGGTATTCTGAGGG - Intergenic
1029507547 7:100971444-100971466 TTACCTCGAAGGTGTCCTGCAGG - Intronic
1031680609 7:124669104-124669126 TTACCTTCCTGGTGTCAGGCAGG - Intergenic
1031802320 7:126263567-126263589 TTATCTTCTTGATGTACTGATGG + Intergenic
1031959627 7:127976913-127976935 TCCCCTACATGGTGTCTTGAGGG + Intronic
1034160884 7:148993551-148993573 TTACCTCCATTGTCTACTGAAGG - Intergenic
1034302021 7:150024508-150024530 TTTCCTTCATGTTGCTCTGATGG + Intergenic
1034804031 7:154072807-154072829 TTTCCTTCATGTTGCTCTGATGG - Intronic
1036092182 8:5678842-5678864 GCACCTTTATGGTGTCCTCACGG + Intergenic
1037466955 8:19170342-19170364 TTTCCTTCATGGTTTCCTTCTGG + Intergenic
1038469150 8:27797327-27797349 TTACCTTCTTTGTCTCTTGATGG + Intronic
1039195952 8:35031808-35031830 TTACTTGCATGGTGTCTAGAAGG + Intergenic
1039432101 8:37532938-37532960 TTCTGTTCCTGGTGTCCTGAGGG + Intergenic
1040014273 8:42688648-42688670 TTTGCTTCCTGGTGTCCTGATGG + Intergenic
1041835859 8:62214415-62214437 TTACCTACCTGGTGTACTCATGG + Intergenic
1041928127 8:63258532-63258554 TTGACTTCATGGTGTCCTGCAGG + Intergenic
1042067406 8:64893347-64893369 TTAGATTCATGGGGTCATGAGGG - Intergenic
1051801811 9:20943385-20943407 TGCCCTTCATGGTGCCATGATGG - Intronic
1056245120 9:84687491-84687513 TTAAATTCCTGGTGTCTTGAGGG + Intronic
1056949263 9:91029027-91029049 TTTCCTTCCTGTGGTCCTGAGGG + Intergenic
1057536630 9:95915788-95915810 GTTCCTTCATGTTGTTCTGAAGG - Exonic
1058173996 9:101717037-101717059 TTACCTTCATGGCCTCTAGAAGG + Intronic
1059141572 9:111857871-111857893 TTACCTTGAAGGTCTACTGACGG - Intergenic
1059799479 9:117735840-117735862 TTCCCTTCATGGGTTCCTTATGG + Intergenic
1062575694 9:137206291-137206313 TTACCTTCATGTTGTCAGGGGGG - Exonic
1188391589 X:29627579-29627601 GTATATTCATGGTTTCCTGATGG + Intronic
1189195540 X:39149121-39149143 TCACCTCCATGGTGATCTGAAGG - Intergenic
1192721939 X:73708292-73708314 TAACTTTCATGGTTTACTGATGG - Intergenic
1195172938 X:102286498-102286520 TTGCCTGCATGGAGTCCAGAGGG - Intergenic
1195185928 X:102400597-102400619 TTGCCTGCATGGAGTCCAGAGGG + Intronic
1198623976 X:138547993-138548015 TTAAATTCATGAAGTCCTGATGG + Intergenic
1198921775 X:141737049-141737071 TCAACTTCATGGGCTCCTGAAGG + Intergenic
1198953243 X:142097274-142097296 TTTGCTAAATGGTGTCCTGAGGG + Intergenic
1200122849 X:153799329-153799351 ATGCCTGCCTGGTGTCCTGAGGG - Intergenic