ID: 1085058309

View in Genome Browser
Species Human (GRCh38)
Location 11:73421336-73421358
Sequence GTGCTGTTTTTGTTGAACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 185}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085058308_1085058309 -4 Left 1085058308 11:73421317-73421339 CCAGAGAAGGTCAGGGACTGTGC 0: 1
1: 0
2: 1
3: 27
4: 222
Right 1085058309 11:73421336-73421358 GTGCTGTTTTTGTTGAACCAAGG 0: 1
1: 0
2: 0
3: 20
4: 185
1085058298_1085058309 29 Left 1085058298 11:73421284-73421306 CCTCTGGTTCCTTCGATCCCAGA 0: 1
1: 0
2: 0
3: 8
4: 94
Right 1085058309 11:73421336-73421358 GTGCTGTTTTTGTTGAACCAAGG 0: 1
1: 0
2: 0
3: 20
4: 185
1085058300_1085058309 20 Left 1085058300 11:73421293-73421315 CCTTCGATCCCAGAAGTACTGGG 0: 1
1: 0
2: 0
3: 4
4: 125
Right 1085058309 11:73421336-73421358 GTGCTGTTTTTGTTGAACCAAGG 0: 1
1: 0
2: 0
3: 20
4: 185
1085058304_1085058309 11 Left 1085058304 11:73421302-73421324 CCAGAAGTACTGGGGCCAGAGAA 0: 1
1: 0
2: 3
3: 14
4: 197
Right 1085058309 11:73421336-73421358 GTGCTGTTTTTGTTGAACCAAGG 0: 1
1: 0
2: 0
3: 20
4: 185
1085058303_1085058309 12 Left 1085058303 11:73421301-73421323 CCCAGAAGTACTGGGGCCAGAGA 0: 1
1: 0
2: 1
3: 20
4: 248
Right 1085058309 11:73421336-73421358 GTGCTGTTTTTGTTGAACCAAGG 0: 1
1: 0
2: 0
3: 20
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085058309 Original CRISPR GTGCTGTTTTTGTTGAACCA AGG Intronic
901037674 1:6346105-6346127 GTTTTGTTTTTGTAGAAACAGGG + Intronic
903915965 1:26764575-26764597 GAGTTGTTGTTGATGAACCAAGG + Intronic
904111941 1:28133099-28133121 TTGTTGTTGTTGTTGAAACAGGG + Intergenic
904398372 1:30239056-30239078 GTGATGTTTTTGTTGAAAGCTGG + Intergenic
904927079 1:34057698-34057720 AGGCTGTGTTTGTTAAACCATGG + Intronic
906199158 1:43948063-43948085 GACCTGGTTTTGTTGAGCCAAGG + Intronic
906428568 1:45735395-45735417 ATGTTGTTTTTGTAGAAACAAGG + Intronic
907723253 1:56993831-56993853 GTTTTGTTTTGGTTGAAACAGGG - Intergenic
907743134 1:57186232-57186254 GGGCTGTTTTTGGAGAAACACGG - Intronic
911404039 1:97413646-97413668 GTGTTGTTTTTGTAGAGACAGGG + Intronic
917525138 1:175781710-175781732 GTGCTGGTGCTGTTGATCCATGG - Intergenic
917770710 1:178274760-178274782 GTACTCTTTTTGTAGAGCCAGGG + Intronic
918176298 1:182048636-182048658 GTGCTGGCTTTGGTGTACCATGG - Intergenic
920410374 1:205754971-205754993 GTGCTCTTTTTGTTCTACCTTGG - Intergenic
924840377 1:247704328-247704350 GTGCTGTATTTGTTGTACAAAGG + Intergenic
1064842222 10:19606405-19606427 AAGCTGTTCTTGTTGAACCTGGG + Intronic
1065095042 10:22272083-22272105 ATGCTCTTTTTATTGAAACAGGG + Intergenic
1067149954 10:43723419-43723441 GAGCTTTTTTGCTTGAACCAGGG + Intergenic
1068614029 10:59091884-59091906 GTGCTGTTATTGTTGGAGCAAGG + Intergenic
1069115733 10:64503952-64503974 TTGCTGTTTATGTGGAACCATGG + Intergenic
1072059274 10:91793542-91793564 GTTTTGTTTTTTTTGAAACAGGG - Intergenic
1075234689 10:120716325-120716347 CTCCTGTTTTTGTTAAAACAAGG + Intergenic
1079642326 11:22821693-22821715 GTGCTGTTTTTGTTCATAAAGGG - Exonic
1081479600 11:43473241-43473263 GTGCTTTTTTCATTGACCCATGG - Intronic
1084322152 11:68379314-68379336 TTGCTGTTCTTGTGGAGCCATGG + Intronic
1085058309 11:73421336-73421358 GTGCTGTTTTTGTTGAACCAAGG + Intronic
1086148215 11:83579053-83579075 GAGCTGTTATTGTTGAGGCAAGG - Intronic
1086506970 11:87515315-87515337 ATTTTGTTTTTGTTGGACCATGG + Intergenic
1092137765 12:6161487-6161509 GTGCTGCTTTTGTTCAAGGATGG - Intergenic
1093393841 12:18656121-18656143 TTGCTGTTTTTGTGGAAGAATGG - Intergenic
1095258450 12:40069631-40069653 GTCCTTTTTTTTTTCAACCATGG - Intronic
1098617032 12:72539108-72539130 GTGTTATTTGTGTTGAACCTTGG - Intronic
1102886035 12:116522685-116522707 GTTTTGTTTTTGTTGAGACAGGG + Intergenic
1103644263 12:122378407-122378429 GTGCTGTTTTGTTTTAAACAAGG + Intronic
1103796315 12:123505631-123505653 TTTCTGTTTTTTTTGACCCAGGG + Intronic
1106694491 13:32157911-32157933 TTGCTGTTTTTGTTTAACTATGG + Intronic
1109623468 13:64941802-64941824 TTGCTGTTGTTGTTGAGACAGGG - Intergenic
1110384436 13:74892360-74892382 GTGCTGTTTTGTTTTGACCAGGG + Intergenic
1111918673 13:94388003-94388025 ATGCAGTTATTGTTGATCCAGGG + Intronic
1113172689 13:107523216-107523238 TTGCTGTCTTTGATGACCCAGGG - Intronic
1113334444 13:109364618-109364640 TTTCTGTTCTTGTTAAACCATGG + Intergenic
1113509816 13:110844361-110844383 GTCCTGTTTTTGTTGATTTACGG - Intergenic
1113646800 13:112003529-112003551 GCGCTGTTTTTGGTGAACGCAGG + Intergenic
1114463801 14:22905920-22905942 TTGCATTTTTTGTAGAACCAGGG + Intronic
1114671020 14:24411122-24411144 GTGCAGTTTTTCTGGAACCGGGG + Exonic
1117579708 14:57139843-57139865 GTGTTGTTTTTTTTGAGACAGGG + Intergenic
1119053939 14:71399409-71399431 CTGCTGTTGTTTTTGAAACAGGG + Intronic
1120867177 14:89305294-89305316 CTGAGGTTTTTGTTGAACGATGG - Intronic
1122484652 14:102070697-102070719 GTGCGGTTTTTTTTGAGACAGGG - Intergenic
1124969316 15:34469452-34469474 GTTTTGTTTTTGTAGAAACAGGG - Intergenic
1126499632 15:49330952-49330974 TTGTTGTTGTTGTTGAAACAGGG - Intronic
1127933312 15:63612179-63612201 TTGTTGTTTTTGTTGAGACAGGG - Intronic
1130192595 15:81750751-81750773 CTGCTGTTTTTGCAGAACAAGGG - Intergenic
1130983313 15:88827928-88827950 ATGCTCTTTCTGTTGCACCAGGG + Intronic
1131734126 15:95314017-95314039 GTGTTGTTTGTGTAGAAACAAGG + Intergenic
1132509868 16:334165-334187 GTGCTGTTATTGGTGTGCCATGG - Intronic
1133424435 16:5675572-5675594 GAGCTGTTTATGTTTAAACATGG + Intergenic
1133539461 16:6735140-6735162 TTGTTGTTTTTGTTGAGACAGGG - Intronic
1133600657 16:7337195-7337217 GGACTGGATTTGTTGAACCAGGG + Intronic
1134372887 16:13641971-13641993 ATGCTTCTTTGGTTGAACCAAGG + Intergenic
1137667198 16:50258347-50258369 GTGGTGTTTTTGTTGAAGCTGGG + Intronic
1137887907 16:52126413-52126435 GGTTTGTTTTGGTTGAACCATGG - Intergenic
1138150577 16:54652970-54652992 GTGCTGTATTTATTTAGCCAAGG - Intergenic
1138646554 16:58429891-58429913 TTGTTGTTGTTGTTGAAACAGGG + Intergenic
1138663191 16:58538775-58538797 GTGATCTGTTTGTTGCACCATGG + Exonic
1138982604 16:62288213-62288235 ATGCTGTTTTAGTTTAAGCACGG + Intergenic
1140100900 16:71915835-71915857 TTGTTGTTTTTGTTGAGACAGGG + Intronic
1142783138 17:2197553-2197575 GTGTTGTTTTTTTTGAGACAGGG - Intronic
1146776624 17:35624353-35624375 GTGCTGTTCTTGGTGAATCAAGG + Intronic
1149195249 17:54111669-54111691 GTGCTGTTTTTCTAGAATGAAGG - Intergenic
1150436240 17:65156493-65156515 GTGCTGTTGTTGCAGGACCAGGG - Intronic
1150513845 17:65786591-65786613 TTGCTGTTGTTGTTGAGGCAGGG + Intronic
1152481465 17:80556505-80556527 TTGCTGTTTTTATTGAAGCAGGG - Intronic
1153710919 18:7797962-7797984 GTGCTATTTTCATTGAAGCAGGG + Intronic
1157114372 18:44849303-44849325 GTGCCATTTTTATTGAATCATGG - Intronic
1159403876 18:67974954-67974976 TTTCTGTTTTTATTGAACCAAGG + Intergenic
1159849402 18:73509250-73509272 GTTCTGTTGTTGTGGAACCAGGG - Intergenic
1160495049 18:79368383-79368405 GTCCTGTTTTTGTAGAGACAGGG - Intronic
1164295752 19:23908147-23908169 GTGGTGTTTTTCTTGTACCCAGG + Intergenic
1164328073 19:24219780-24219802 ATGCTGTTTTTGTAGAATCTAGG - Intergenic
1164333784 19:24287148-24287170 ATACTGTTTTTGTAGAATCAGGG + Intergenic
1164775475 19:30850256-30850278 GTGTTTTTTTCATTGAACCAAGG + Intergenic
1166031189 19:40130737-40130759 GTGCTGTCTTTTTTGACCCTTGG - Intergenic
925406502 2:3608848-3608870 GTGCTGTTGGTCCTGAACCAGGG + Intronic
927770200 2:25854212-25854234 GAGCTTTTTTTCTTGAACTAGGG - Intronic
927823364 2:26288700-26288722 TTTCTGTTTTTTTTGAAACAGGG - Intronic
929516557 2:42608091-42608113 GTCCTTTTTATGGTGAACCAAGG + Intronic
931452443 2:62379497-62379519 GTGCTGATTGCTTTGAACCAAGG - Intergenic
931698010 2:64886451-64886473 TTGCTGTTTGTGATAAACCATGG + Intergenic
931903440 2:66817591-66817613 ATTCTGTTTTTGTGGATCCAAGG + Intergenic
931919348 2:66996224-66996246 ATGCACTATTTGTTGAACCATGG - Intergenic
935516478 2:104046828-104046850 CTGCTGTTTTTATTGATTCATGG - Intergenic
936005318 2:108881969-108881991 TTGCTCTTTTTGTAGAAACAGGG - Intronic
937391599 2:121493255-121493277 TTGCTGTTTTTGTGGCAGCATGG + Intronic
937601697 2:123744281-123744303 TTGCTGTTGTTGTTGAGACAGGG - Intergenic
939235628 2:139488599-139488621 ATGCTGTTTTGGTTGAACATTGG + Intergenic
939441254 2:142253138-142253160 TTGTTGTTGTTGTTGAAACAGGG - Intergenic
939548106 2:143578664-143578686 TTACTGTTTTTGTTGTATCAGGG + Intronic
942094595 2:172525123-172525145 GTGCTGTTTTCTTTGACCCATGG - Intergenic
942309596 2:174643009-174643031 GTACTGGTTTTCTTGACCCAAGG + Intronic
943867164 2:192940570-192940592 GTCCGGTTCTTGTTGAACCCGGG + Intergenic
943999792 2:194819124-194819146 ATGATGTTTCTGTTGAACAAAGG - Intergenic
945237915 2:207649741-207649763 GTACTGTATTTGTTACACCATGG + Intergenic
945705482 2:213226129-213226151 GTTCTGTTTCTTTTGAACCCAGG - Intergenic
945804790 2:214477380-214477402 GTCCTATTTGAGTTGAACCAAGG - Intronic
946115696 2:217460128-217460150 GTGGAGTTTTTGTTGGCCCAAGG - Intronic
946390547 2:219413574-219413596 TTGTTGTTGTTGTTGAAACAGGG - Intergenic
946954998 2:224920077-224920099 TTGCTGTTGTTGTTGAGACAGGG + Intronic
948117262 2:235502506-235502528 TTGGTGTTTTTGTTTAACCAGGG + Intronic
948989307 2:241544156-241544178 GTACTGATATTTTTGAACCATGG - Intergenic
1169167552 20:3437268-3437290 GTTCTGCTTTTATTGAAACAGGG - Intergenic
1170475379 20:16709114-16709136 TTGCTGTTTTTTTTGAATAAAGG - Intergenic
1170870219 20:20199254-20199276 TTGTTGTTGTTGTTGAACAAAGG + Intronic
1172852835 20:37978924-37978946 TTGCTGTTGTTGTTGAAACAGGG - Intergenic
1177413169 21:20757933-20757955 GTGCTCTTTCTTTTTAACCAGGG + Intergenic
1177816008 21:25977637-25977659 TTGTTGTTTTTGTAAAACCATGG + Intronic
1178451555 21:32705978-32706000 TTGCTGTTGTTGTTGAGACAGGG - Intronic
1178898215 21:36577935-36577957 TTGCTGTTTTTATTGAGCCAGGG + Intergenic
1179238806 21:39570454-39570476 TTGTTGTTTTTGTTGAGACAGGG + Intronic
1181291654 22:21798871-21798893 GTGCTGTCTTTTTTGAGACAGGG - Intronic
1182821891 22:33223633-33223655 GGGCTGCTTCTGTTGAACGAGGG - Intronic
949824047 3:8145977-8145999 GTGCTATTTTTGTTCTGCCATGG - Intergenic
955019628 3:55106803-55106825 AGGCTGTTTTTGGTGAGCCAAGG - Intergenic
955036710 3:55274945-55274967 ATGCTGTTTTATTTGACCCAAGG - Intergenic
959310952 3:104736162-104736184 GTGCTGATTTAGTTGTACCCTGG - Intergenic
959586420 3:108029277-108029299 ATGCTGTTTTTGTTAAAGTAAGG + Intergenic
961025259 3:123550134-123550156 TTGTTGTTGTTGTTGAAACAGGG - Intronic
961597908 3:128033827-128033849 AAGCTGTTTTTGATGAACCGTGG - Intergenic
962382207 3:134907278-134907300 GTGCTCTCTTAGTTGCACCATGG + Intronic
965318830 3:167226025-167226047 GTGCAGTTTGTGCTGGACCAAGG - Intergenic
966284109 3:178272942-178272964 GTGCTGTTTTGAGTGAAACAGGG + Intergenic
967389748 3:188944132-188944154 GTGCTATGTTTTTTGAACAAGGG - Intergenic
968314755 3:197714337-197714359 TTGCTTTTTTTGTTGAGACAGGG + Intronic
969906297 4:10399322-10399344 GTGCTTTTTTTTTTGAGACAGGG - Intergenic
970474708 4:16410539-16410561 GTGCTGCTTCTGCTGAAACAGGG - Intergenic
971092205 4:23359101-23359123 GTGTTGTTATTGCTGAACCAGGG + Intergenic
973125767 4:46582588-46582610 GTCCTGTTTTAGTAGAACCTGGG + Intergenic
976657338 4:87503127-87503149 TTCCTGTTTGTGTTGAAACATGG + Intronic
976945384 4:90759554-90759576 ATGTTGTTATTGTTGCACCATGG + Intronic
977563486 4:98557783-98557805 GTGCCATTTTTGTTGTATCAGGG - Intronic
980067896 4:128210351-128210373 ATGCTGTTTTTGTAAAACCATGG - Exonic
982388637 4:154839470-154839492 GTGCTTTCTTTGGGGAACCACGG + Intergenic
984667737 4:182447486-182447508 TTACTGTTGTTGTTGAATCATGG + Intronic
985033522 4:185816206-185816228 GTGATGATTTTGTTGAATTAAGG - Intronic
986168658 5:5297482-5297504 GAGGGGTTTTTGTTGAACGAGGG + Intronic
987820280 5:22956619-22956641 GTTCTCTTATTGTTGACCCAAGG - Intergenic
990384538 5:55246817-55246839 GTGCCGTTGTTCTTGAACCATGG + Intergenic
991027136 5:62042013-62042035 GTGCTTTTTTTTTTTAACAAAGG - Intergenic
991334987 5:65537057-65537079 GTGCTGTTTTTGGTGAGGGAAGG - Intronic
993842290 5:92894405-92894427 CGGCTGATTTTGTTGAGCCAGGG - Intergenic
994351762 5:98753830-98753852 ATGCTGTTGCTGTTGGACCAGGG + Intergenic
995053361 5:107731561-107731583 ATGATGTTTCTGTTGAAACAGGG + Intergenic
997221415 5:132169259-132169281 GTACTCTTTTTGGTGTACCATGG - Intergenic
999302046 5:150497333-150497355 GTGCTGTTTTTATAGATTCAGGG + Intronic
1000627300 5:163553806-163553828 TTGCTGTTTTTTTTGAGACAGGG - Intergenic
1000744476 5:165016087-165016109 GTTCTGTTCTTATTGAAACAAGG + Intergenic
1001949976 5:175809569-175809591 GTGCTTTTTCTGCTGAGCCACGG + Intronic
1003255663 6:4472720-4472742 GTGCTGGGTTTGGTGCACCATGG - Intergenic
1003263568 6:4546867-4546889 GAGGTGCTTTTGTTGAAGCAAGG - Intergenic
1003665800 6:8110145-8110167 TTGCTGTTGTTGTTGAGACAGGG - Intergenic
1006240083 6:32670071-32670093 TTGCTGTTTTGCATGAACCATGG - Intergenic
1006894426 6:37458059-37458081 TTGTTGTTTTTGTTGAGACAGGG + Intronic
1009411416 6:63369534-63369556 CTGCTTTGATTGTTGAACCATGG + Intergenic
1012376745 6:98570906-98570928 GTACTGTTTTTGATACACCAGGG - Intergenic
1013434303 6:110086740-110086762 GTTTTGTTTTTGTAGAAACAAGG + Intergenic
1014308512 6:119770601-119770623 CTGCTGTTTTTGTTGATACCTGG + Intergenic
1014962333 6:127702903-127702925 GTGTTGTGTGTGTTGAATCATGG - Intergenic
1022654586 7:32307065-32307087 GTGCTGTTTTTCTTGATCCTGGG - Intergenic
1027476821 7:78642324-78642346 GTGCTCGTTTTACTGAACCATGG - Intronic
1028255367 7:88589465-88589487 ATGCTGATGTTGTTGATCCAGGG - Intergenic
1029511226 7:100996551-100996573 GTGCTGTGTCAGTTGAACCTGGG - Exonic
1029511452 7:100997973-100997995 GTGCTGTGTCAGTTGAACCTGGG - Exonic
1030973979 7:116097731-116097753 GTGCTGTTTTCGGTTATCCATGG - Intronic
1032073895 7:128827209-128827231 ATCCTGTTTTTCTGGAACCAGGG - Intergenic
1033204314 7:139404335-139404357 TTGCAGTTTTTGTAGAAACAGGG - Intronic
1034228853 7:149503417-149503439 GGGCAGTTTTTGTTGAACAAAGG - Intergenic
1038004258 8:23416578-23416600 GGGCTCTTTTTCCTGAACCATGG - Intronic
1039080580 8:33730190-33730212 TTGTTGTTTTTGTTGAGACAAGG - Intergenic
1039866337 8:41506776-41506798 ATGCTTTATTTGTTGAACTAGGG - Intronic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1044063291 8:87666087-87666109 TTGCTGTTATAGTTGAACCTAGG - Intergenic
1044756176 8:95463792-95463814 GTGCTTTTTGTGTTCAACTAAGG + Intergenic
1045162407 8:99562980-99563002 GTGTTGTTGTTGTTGAGACAAGG - Intronic
1045697557 8:104827211-104827233 GTGCTATTTTTATTGAAACGTGG + Intronic
1046353447 8:113046697-113046719 CTGCTGTTTTTATTGATACAAGG + Intronic
1047195829 8:122720695-122720717 TTGCTGTTGTTGTTGAGACAGGG - Intergenic
1047202215 8:122776741-122776763 GTGCTGTTTTTTTTTTCCCATGG + Intergenic
1048220427 8:132536176-132536198 CTGCTGGTTCTGTGGAACCAAGG - Intergenic
1048726403 8:137390319-137390341 TTGCTGTTGTTGTTGAGACAGGG + Intergenic
1049799124 8:144509643-144509665 TTGCTGCTGTTGTTGAACCTGGG + Exonic
1052365502 9:27607872-27607894 GTGTTGTTATTTTTGAATCATGG - Intergenic
1055172112 9:73271398-73271420 ATGCTTTTGTTGTTGAAACAAGG + Intergenic
1055301676 9:74889128-74889150 TTGCTGTTGTTGTTGAGCCAGGG + Intergenic
1060288084 9:122272713-122272735 ATGATGTTTTTGTTGAACATGGG + Intronic
1185575115 X:1165857-1165879 GTGCTGTTTTTCTTTAACAATGG + Intergenic
1187566501 X:20454718-20454740 ATGCTGTTGTTGCTGGACCATGG + Intergenic
1190042364 X:47081552-47081574 GTTTTGTTTTTGTTGAGACAGGG + Intronic
1192120022 X:68446779-68446801 TTGCTGTTGTTGTTGAGACAGGG + Intergenic
1193966261 X:87990269-87990291 GTGCTATTTTTGATGATCTATGG - Intergenic
1195367735 X:104142233-104142255 GTTCAGTTTTTTTTGAAACAGGG - Intronic
1196201041 X:112886275-112886297 ATGCTGTTTTTGCTGACTCAAGG - Intergenic
1196652963 X:118187565-118187587 TTGTTGTTGTTGTTGAAACAGGG - Intergenic
1197186898 X:123597650-123597672 TTTCTGTTTTTTTTGAAACAGGG - Intergenic
1197225512 X:123952424-123952446 GTTTTGTTTTTGTAGAAACAGGG - Intergenic
1198930309 X:141850551-141850573 GTGGGGGTATTGTTGAACCATGG - Intronic
1202067650 Y:20957786-20957808 GTGATGATTTTTTTAAACCATGG - Intergenic