ID: 1085064757

View in Genome Browser
Species Human (GRCh38)
Location 11:73484077-73484099
Sequence CTGAAGATAAGGAGGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1322
Summary {0: 1, 1: 0, 2: 7, 3: 104, 4: 1210}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085064757_1085064762 -5 Left 1085064757 11:73484077-73484099 CCTTCCTCCCTCCTTATCTTCAG 0: 1
1: 0
2: 7
3: 104
4: 1210
Right 1085064762 11:73484095-73484117 TTCAGTCAATAAACCTTTACTGG 0: 1
1: 1
2: 5
3: 59
4: 386
1085064757_1085064763 -4 Left 1085064757 11:73484077-73484099 CCTTCCTCCCTCCTTATCTTCAG 0: 1
1: 0
2: 7
3: 104
4: 1210
Right 1085064763 11:73484096-73484118 TCAGTCAATAAACCTTTACTGGG 0: 1
1: 1
2: 5
3: 54
4: 324

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085064757 Original CRISPR CTGAAGATAAGGAGGGAGGA AGG (reversed) Intronic
900215047 1:1477112-1477134 CTGAGGCTCAGGTGGGAGGATGG - Intronic
900222213 1:1515180-1515202 CTGAGGCTGAGGTGGGAGGATGG - Intronic
900602174 1:3507629-3507651 CTGGAGACAGGGAGGCAGGAAGG + Intronic
900993567 1:6108715-6108737 ATGAAGGGAAGGAGGGATGATGG + Intronic
901059422 1:6465294-6465316 CTGGAGAGAAAGAGGGAGGGAGG - Intronic
901508386 1:9701005-9701027 CTGCGGAGAAGCAGGGAGGAAGG - Intronic
901612448 1:10509560-10509582 CAGAAGACAAGCAGAGAGGAAGG - Intronic
901855038 1:12039139-12039161 CTGAGGACAGGGAGGGAGGAGGG + Intergenic
901860866 1:12073496-12073518 AAGAAGAGAAGGAGGGAGGGAGG - Intronic
902275024 1:15333315-15333337 AGGAAGATGAGGAGGAAGGATGG + Intronic
902688912 1:18097376-18097398 AGGGAGAGAAGGAGGGAGGAAGG - Intergenic
902833101 1:19030173-19030195 CAGAAGGGAAGGAGGGAGGGAGG + Intergenic
903010765 1:20328526-20328548 AGGAAGAGAGGGAGGGAGGAAGG + Intronic
903010771 1:20328546-20328568 AGGAAGGAAAGGAGGGAGGAAGG + Intronic
903130899 1:21279068-21279090 CTGAGGCTAAGGAGGGAGCCAGG - Intronic
903130968 1:21279333-21279355 CTGCAGGGAAGGAGGCAGGAGGG + Intronic
903294591 1:22335705-22335727 CTGAGCAGGAGGAGGGAGGAGGG - Intergenic
903333574 1:22610050-22610072 AAGAAGAGAGGGAGGGAGGAAGG - Intergenic
903342250 1:22661800-22661822 CTGAGGATCAGAAGGGATGAAGG + Intergenic
903345679 1:22682650-22682672 CTTAAGAGTGGGAGGGAGGATGG - Intergenic
903819961 1:26094528-26094550 CTGAAGAGAATGAGGGTGGCAGG + Intergenic
904727202 1:32558337-32558359 CTGTAGATAAGAAGGAGGGAGGG - Intronic
904911355 1:33936674-33936696 CTGGCAATAAGGAGGGAGGGAGG + Intronic
905165167 1:36077039-36077061 TTGAAGATAAGAAGGGCAGATGG + Intergenic
905199707 1:36307407-36307429 CGGGAGGGAAGGAGGGAGGAAGG + Intronic
905270662 1:36785483-36785505 ATGCTGATGAGGAGGGAGGAGGG + Intergenic
905596721 1:39214087-39214109 CTGAAGGCAGGGAGGGAGGAGGG - Intronic
905658993 1:39706224-39706246 CTGAAAAAAAGAAGGAAGGAAGG - Intronic
906662137 1:47590573-47590595 CTGAGGATAGAGAGGGAGGCTGG + Intergenic
906672149 1:47664209-47664231 CTGAGAAGAAGCAGGGAGGATGG + Intergenic
906700110 1:47851464-47851486 GTGAGGAAAAAGAGGGAGGAAGG + Intronic
906713293 1:47948731-47948753 CTGAGGTTAAGGAGAGAGAAAGG - Intronic
906843562 1:49165684-49165706 ATGGAGGAAAGGAGGGAGGATGG + Intronic
907076345 1:51582655-51582677 GTGTAGAGAAGGAGGGAGGCAGG - Intronic
907087734 1:51692579-51692601 AGGAAGAAAAGGAGGGAGGGAGG - Intronic
907466371 1:54640456-54640478 CTGGAGATAAAGAGTGAGGGAGG + Intergenic
907619403 1:55961186-55961208 CAGAATATGAGGTGGGAGGATGG - Intergenic
907630760 1:56079646-56079668 CTTAAAATAAGGAGTGAGGAGGG - Intergenic
907802480 1:57783894-57783916 CTGAAGAGAAGGAGAGAGATTGG - Intronic
907858487 1:58327282-58327304 AAGAAGAAAGGGAGGGAGGAAGG + Intronic
908331478 1:63074970-63074992 TTGAGGATGGGGAGGGAGGAGGG - Intergenic
908372644 1:63498825-63498847 AGGAAGAAAAGGAGGGAGGGAGG + Intronic
909824156 1:80105051-80105073 CTGAAGAGAGGGAGAGAGGTGGG + Intergenic
909988282 1:82189571-82189593 CTGGTGATGAGGAGGGAAGAGGG - Intergenic
910105453 1:83626997-83627019 CTGAAGACAAGGAGGGCACAGGG + Intergenic
910118060 1:83754579-83754601 ATGAAGGAAGGGAGGGAGGAAGG - Intergenic
910160283 1:84265024-84265046 GTGGAGATGAGGAGGAAGGATGG + Intergenic
910410385 1:86937251-86937273 CTGGAAGGAAGGAGGGAGGAAGG - Intronic
910491900 1:87781910-87781932 CAAATGCTAAGGAGGGAGGAAGG - Intergenic
910535693 1:88295114-88295136 CTGAAGGAAAGAAGGAAGGAAGG - Intergenic
910734907 1:90442955-90442977 CAGAAGGAAAGGAGGGAGGGAGG + Intergenic
910838280 1:91537232-91537254 AGGAAATTAAGGAGGGAGGATGG - Intergenic
911163017 1:94700506-94700528 CTGAAGATTAGGGTAGAGGAGGG - Intergenic
911170609 1:94767413-94767435 TGGAAAAAAAGGAGGGAGGAGGG - Intergenic
911436983 1:97872981-97873003 CTGAAAATAAAGATGAAGGAGGG - Intronic
911824636 1:102466564-102466586 CTAAAGATCAGGAGGGAGGTAGG - Intergenic
912347637 1:108979419-108979441 GGGAAGCTAAGGCGGGAGGATGG + Intronic
912537967 1:110389892-110389914 TACAAGATAGGGAGGGAGGAGGG + Intronic
912952928 1:114133038-114133060 CTGAGGGTATGCAGGGAGGAAGG - Intronic
913163891 1:116168186-116168208 GAGAAGCTAAGGAGGGAGGATGG + Intergenic
913183867 1:116348904-116348926 GGGAAGGGAAGGAGGGAGGAAGG + Intergenic
913385349 1:118252974-118252996 TTGAAGGGAAAGAGGGAGGAAGG - Intergenic
914044889 1:144083105-144083127 CTTACAATAGGGAGGGAGGAAGG - Intergenic
914085987 1:144455134-144455156 AGGAAGAAAAGGAGGGAGGGAGG + Intronic
914133221 1:144877581-144877603 CTTACAATAGGGAGGGAGGAAGG + Intergenic
914143558 1:144973423-144973445 AAGAAGAGAAGGAGGGAGGGAGG + Intronic
914228087 1:145738701-145738723 CTGGAGCTTAGGAGGGAAGAAGG - Exonic
914879390 1:151535922-151535944 AGGAAGAAAAGGAGGGAGGAAGG - Intronic
915105827 1:153534677-153534699 CTGAAAATAAATAGGGAAGATGG - Exonic
915460348 1:156066833-156066855 GAGAAGCTAAGGTGGGAGGATGG + Intronic
915891216 1:159775639-159775661 CTGGAGATGGGGAGGGAGGTGGG - Intergenic
915996601 1:160570318-160570340 TGGAAGATAAGGAGAGAGAATGG + Intronic
916242756 1:162656577-162656599 AGGAAGGAAAGGAGGGAGGAAGG - Intronic
916473096 1:165142791-165142813 AGGAAGAGAGGGAGGGAGGAAGG - Intergenic
916488251 1:165278574-165278596 CTGCAGGTGAAGAGGGAGGATGG - Intronic
916674624 1:167054978-167055000 CTGAAGACAAGGAGGATGCAAGG - Exonic
916915028 1:169397189-169397211 ATGAACATGAGGAAGGAGGAGGG + Intronic
917036155 1:170749310-170749332 CTCTAGATAAGCAGGGAGAAGGG + Intergenic
917045587 1:170856330-170856352 GAGAAGAGAAGAAGGGAGGAGGG + Intergenic
917135251 1:171782884-171782906 CTGGAGGTAGGGAAGGAGGAAGG + Intronic
917447732 1:175120903-175120925 GGGAAGCTAAGGTGGGAGGATGG - Intronic
917826163 1:178823448-178823470 CTGAAGAAAAGTAGAAAGGAAGG + Intronic
917844525 1:179009396-179009418 CTGAAGCTAGAAAGGGAGGAGGG + Intergenic
918333449 1:183482887-183482909 CTTGAGATAAGGAGGTAGAATGG + Intronic
918586335 1:186193204-186193226 CTGAGGATGAGAAGGGAGGAAGG + Intergenic
919276703 1:195427563-195427585 CTAAAGAGAGGGAGGGAGAAAGG - Intergenic
919353791 1:196495492-196495514 AGGAAGGAAAGGAGGGAGGAAGG - Intronic
919599956 1:199610413-199610435 GTGAATAAAAGGAGGTAGGAGGG - Intergenic
919780850 1:201220021-201220043 AAGAAGACAGGGAGGGAGGAAGG - Intronic
919780860 1:201220107-201220129 AAGAAGAGAGGGAGGGAGGAAGG - Intronic
919780869 1:201220146-201220168 AAGAAGAGAGGGAGGGAGGAAGG - Intronic
919920946 1:202166116-202166138 CTGAGGATGAGGAGTGAGAATGG - Intergenic
919939805 1:202278436-202278458 CTGAGGACAAGGAGGGACAAGGG + Intronic
920170599 1:204070087-204070109 CTGGAGACCAGGATGGAGGAGGG + Intergenic
920396336 1:205648762-205648784 TTGAAGAGAAGGGGGCAGGAGGG - Intergenic
920481331 1:206325023-206325045 AAGAAGAGAAGGAGGGAGGGAGG - Intronic
920634450 1:207686083-207686105 AGGAAGGAAAGGAGGGAGGAAGG - Intronic
920635814 1:207702333-207702355 CTGAAGAGAGGGAGAGAGAAGGG - Intronic
921600206 1:217098628-217098650 AGGAAGAAAAGGAGGGTGGAAGG + Intronic
922063658 1:222115458-222115480 CATTAGAAAAGGAGGGAGGAAGG - Intergenic
922152845 1:223020213-223020235 CTGATGATGAGGAGTGAGGTGGG + Intergenic
922554422 1:226521972-226521994 GTGAAGACAAGTAAGGAGGATGG - Intergenic
922946790 1:229523247-229523269 CTGGAGGAAAGGAGGGAGGATGG - Intronic
923035049 1:230279809-230279831 CTGAGGACAGGGCGGGAGGAGGG + Exonic
923044474 1:230345434-230345456 CTGCAGATGAGGGGAGAGGAGGG + Intronic
923082143 1:230668239-230668261 GAAAAGATAAGGAGGGAGAAGGG + Intronic
923300475 1:232635562-232635584 AAGAAGAGAGGGAGGGAGGAAGG + Intergenic
923433944 1:233950621-233950643 CTCAACATATGGAGGGAGAAAGG - Intronic
923515488 1:234694619-234694641 CTGAACATCAGGAGTGAGGGGGG - Intergenic
924113036 1:240718577-240718599 GTGAAGGGAGGGAGGGAGGAAGG - Intergenic
924673624 1:246153398-246153420 CTGGAGATAGGGAAGGAGGGAGG + Intronic
1063255577 10:4323689-4323711 TTGAAGATACTGAGGGAGAAGGG + Intergenic
1063483589 10:6398856-6398878 GGGAAGCTAAGGTGGGAGGATGG - Intergenic
1063727465 10:8653853-8653875 CTAAAGACAAGGTGGAAGGAAGG - Intergenic
1064121567 10:12623503-12623525 AGGAAGAGAGGGAGGGAGGAAGG - Intronic
1064515878 10:16147365-16147387 CTAAAAATAGGGAGAGAGGAAGG + Intergenic
1064534958 10:16349313-16349335 TTCAAGATGAGGAGGGAAGAGGG - Intergenic
1064587652 10:16854897-16854919 AGGAAGGAAAGGAGGGAGGATGG - Intronic
1064631820 10:17322265-17322287 AAGAAAAGAAGGAGGGAGGAAGG + Intronic
1064635242 10:17358596-17358618 AGGAGGAGAAGGAGGGAGGAAGG + Intronic
1064741540 10:18439788-18439810 CAGAAGGGAGGGAGGGAGGAAGG - Intronic
1064963250 10:20989561-20989583 GAGAAGACAGGGAGGGAGGAGGG + Intronic
1065081424 10:22133489-22133511 CAGAAGAGAAGGAGGAATGATGG - Intergenic
1065784850 10:29203652-29203674 AGGAAGGAAAGGAGGGAGGAAGG + Intergenic
1066192542 10:33069226-33069248 CAGAAGAGATGGAGGAAGGAAGG - Intergenic
1066779807 10:38931856-38931878 AGGAAGAAAAGGAGGGAGGGAGG + Intergenic
1066957015 10:42182787-42182809 CTTACAATAGGGAGGGAGGAAGG - Intergenic
1067270953 10:44790895-44790917 GTTTAGATAAGGAGGGAGAAAGG - Intergenic
1067342427 10:45416719-45416741 ATGAAGGGAAGGAGGAAGGATGG + Intronic
1067921812 10:50466328-50466350 AGGAAGGAAAGGAGGGAGGAAGG + Intronic
1067942735 10:50669906-50669928 CTGGTGCTAAGGAGTGAGGAGGG - Intergenic
1068237136 10:54251967-54251989 CTGAAGATAAAAAGGCAGGGGGG - Intronic
1068381691 10:56262079-56262101 AGGAAGATGAGGTGGGAGGAAGG + Intergenic
1068550166 10:58398822-58398844 ATGAAGAGAAGGAGGGAGAATGG - Exonic
1068558240 10:58482140-58482162 GTGGAAAGAAGGAGGGAGGAAGG - Intergenic
1068752305 10:60609050-60609072 TTGAAGAAAAGGAAAGAGGAAGG + Intronic
1069378950 10:67822508-67822530 CTGAAGAGAAGAAGAGAGGCAGG + Intronic
1069726952 10:70586254-70586276 CTGAAGATGAGGAGGTGGGAGGG + Intergenic
1070056903 10:72944055-72944077 AAGAAGAAAAGGAGGAAGGAAGG - Intronic
1070469683 10:76766484-76766506 GTGAAGAAAGGAAGGGAGGAAGG + Intergenic
1070657042 10:78278774-78278796 AGGGAGGTAAGGAGGGAGGAAGG - Intergenic
1070845116 10:79515559-79515581 CAGAAGATCAGGAAGGAGCAGGG - Exonic
1070863977 10:79694869-79694891 CTGGTGCTAAGGAGTGAGGAGGG - Intergenic
1070872574 10:79769842-79769864 CAGAAGCTAAGAAGAGAGGAAGG - Intergenic
1070928684 10:80244750-80244772 CAGAAGATCAGGAAGGAGCAGGG + Intergenic
1071242022 10:83717722-83717744 CTGAAGAGAAGGAGACATGAGGG - Intergenic
1071444353 10:85731850-85731872 AGGAAGAAAGGGAGGGAGGAAGG + Intronic
1071444889 10:85736261-85736283 AAGGAGAGAAGGAGGGAGGAGGG + Intronic
1071515240 10:86292606-86292628 CTGAAGAGAGGGAGGAAGGCAGG - Intronic
1071604352 10:86974502-86974524 ATGAAGAAGAAGAGGGAGGAAGG - Intronic
1071630876 10:87217095-87217117 CTGGTGCTAAGGAGTGAGGAGGG - Intergenic
1071639496 10:87291991-87292013 CAGAAGCTAAGAAGAGAGGAAGG - Intergenic
1071655739 10:87445961-87445983 CAGAAGCTAAGAAGAGAGGAAGG + Intergenic
1071827093 10:89336139-89336161 AGGAAAATAGGGAGGGAGGAAGG + Intronic
1072754735 10:98011775-98011797 AGGAAGGAAAGGAGGGAGGAAGG + Intronic
1072923096 10:99593243-99593265 CTGAAGATAAAGAGAAAGAAAGG + Intergenic
1072976204 10:100061048-100061070 ATGAAAATAAAGAGGAAGGATGG + Intronic
1073055330 10:100696518-100696540 AGGGAGAGAAGGAGGGAGGAAGG + Intergenic
1073178801 10:101571533-101571555 CTTCAGATAAGGGGGAAGGAGGG + Intronic
1073215519 10:101834051-101834073 GAGTAGATATGGAGGGAGGAGGG - Intronic
1073318152 10:102597323-102597345 CTGGGGAAAAGGAAGGAGGAAGG - Intronic
1073583316 10:104686687-104686709 TTGATGACAAGGAGGGAAGAGGG - Intronic
1073610096 10:104934691-104934713 CTGAGCATAAGGAGGCAGGCTGG - Intronic
1074257933 10:111821920-111821942 CTGAAGATGAGGGTGGAAGATGG - Intergenic
1074372849 10:112914188-112914210 CTGAAAAGAAAGAAGGAGGAAGG - Intergenic
1074607289 10:114985848-114985870 CTGAAGAGAGGGAGAGAGGTGGG + Intergenic
1074827932 10:117228274-117228296 AGGAAGGGAAGGAGGGAGGAAGG - Intergenic
1075077468 10:119360746-119360768 TGGAAGAGGAGGAGGGAGGAGGG - Intronic
1075313023 10:121430551-121430573 GTAAAGATAGGGAGGGAGGGAGG - Intergenic
1075416686 10:122269470-122269492 CTGGAGATCAGGAGGTAGGGAGG - Intergenic
1075474024 10:122717777-122717799 TTGAAGTGAAGGAAGGAGGAAGG + Intergenic
1075656299 10:124163346-124163368 AGGAAGGAAAGGAGGGAGGAGGG + Intergenic
1075962994 10:126585394-126585416 AGGAAGAAAAGGAGGGAAGAAGG + Intronic
1076471533 10:130722115-130722137 CTGAAGGCAAGGATGGAGGGAGG + Intergenic
1076473793 10:130738511-130738533 CATGAGACAAGGAGGGAGGAGGG - Intergenic
1076558705 10:131346999-131347021 ATGAAGGGAGGGAGGGAGGAAGG - Intergenic
1076676140 10:132148697-132148719 CTGCACAGGAGGAGGGAGGAGGG + Intronic
1076827295 10:132975454-132975476 CTGAGGATAAGGAGGGGGTAAGG - Intergenic
1076863168 10:133151860-133151882 ATGAAGATCAGCAGGGAAGAGGG - Intergenic
1077272222 11:1686735-1686757 AGGCAGAGAAGGAGGGAGGAGGG - Intergenic
1077315088 11:1916038-1916060 TGGAAGAGAAGGAGGGAGGAAGG + Intergenic
1077465153 11:2730502-2730524 CATAAGAGAAAGAGGGAGGAAGG - Intronic
1077543486 11:3158680-3158702 CAGGAGAGAGGGAGGGAGGAAGG + Intronic
1077546101 11:3170708-3170730 CTGGAGGCAAGGAGGGAGGTTGG + Intergenic
1077722819 11:4644855-4644877 GAGAAGATGAGGCGGGAGGAAGG - Intronic
1077924426 11:6666692-6666714 AGGGAGAGAAGGAGGGAGGAAGG - Intergenic
1078108204 11:8371858-8371880 ATAAAGAGAAGGAGGGAGGGAGG - Intergenic
1078314110 11:10277865-10277887 CTGAAGTTAAGGTGACAGGAGGG - Intronic
1078453044 11:11454456-11454478 AGGAAGATAAGGAGGGAGGCAGG + Intronic
1078525149 11:12095046-12095068 TTGATGAAAGGGAGGGAGGAAGG + Intronic
1078627293 11:12969031-12969053 CTGGAAATTAGAAGGGAGGATGG - Intergenic
1078911919 11:15740454-15740476 CAAAAGAAAAGGAAGGAGGAAGG + Intergenic
1078923662 11:15854516-15854538 AAGAAGAGAAGTAGGGAGGAAGG + Intergenic
1079608957 11:22406596-22406618 TAGAAGAGAAAGAGGGAGGAGGG - Intergenic
1079802118 11:24882606-24882628 CCGAAGGTTAAGAGGGAGGAAGG - Intronic
1080123471 11:28704044-28704066 CTGGAAAAAAGGAGGAAGGAAGG - Intergenic
1080237832 11:30092632-30092654 GGGAAGAGAAGGAGGGAGGGAGG - Intergenic
1080370734 11:31638541-31638563 CTGACGAAAAGGAGGGAGAAAGG + Intronic
1081042010 11:38224756-38224778 CTGAACATAGGAAGGGTGGAAGG - Intergenic
1081291459 11:41330674-41330696 CTGAGGCTGAGGTGGGAGGATGG - Intronic
1081415220 11:42806822-42806844 AGGAAGAAAGGGAGGGAGGAAGG + Intergenic
1081626441 11:44658808-44658830 CTGAGCAGAGGGAGGGAGGAGGG + Intergenic
1081716798 11:45256232-45256254 GTGGAGAAGAGGAGGGAGGAAGG - Intronic
1081773938 11:45665327-45665349 CGGAGGAAGAGGAGGGAGGAGGG - Exonic
1081824826 11:46039058-46039080 CTGAATAAAAGTAGGGAAGAAGG + Intronic
1081859643 11:46325559-46325581 AGGAAGCTAAGGTGGGAGGATGG - Intergenic
1081877532 11:46419804-46419826 ATGAAGGTGGGGAGGGAGGAAGG + Intronic
1082059851 11:47850478-47850500 CTGGAAAGAAGGAAGGAGGAAGG + Intergenic
1082207454 11:49455155-49455177 CTGTAGCTAAGGAGGGAGGCAGG + Intergenic
1082214359 11:49549766-49549788 CGGAAGAAAGGGAGGGAGGGAGG - Intergenic
1082728246 11:56763590-56763612 CAGAAGGAAAGAAGGGAGGAAGG - Intergenic
1082805432 11:57446395-57446417 CTGAAGATGAACAGGGAGGCAGG + Intergenic
1083243822 11:61410098-61410120 CTGAAAAAAGGTAGGGAGGAGGG - Intronic
1083338012 11:61938294-61938316 AGGAAGCTAAGGTGGGAGGATGG + Intergenic
1083590331 11:63889904-63889926 CTTACTATAAGCAGGGAGGATGG + Intronic
1084194770 11:67518219-67518241 ATGGAGTTAGGGAGGGAGGAAGG + Intergenic
1084214421 11:67639820-67639842 GGGAGGACAAGGAGGGAGGAAGG - Intergenic
1084230412 11:67748433-67748455 CTTAAGATAAGCAGAGAGGGTGG + Intergenic
1084470415 11:69356178-69356200 ATGAAGAGAAGGAAGGAGGGAGG + Intronic
1084470465 11:69356363-69356385 GGGAAGGAAAGGAGGGAGGAAGG + Intronic
1085014606 11:73165051-73165073 CTGTAGATAAGGGAGGTGGAGGG - Intergenic
1085064757 11:73484077-73484099 CTGAAGATAAGGAGGGAGGAAGG - Intronic
1085616771 11:78006274-78006296 CTGAAGAGAGGGAGGGAGACAGG - Intergenic
1086026636 11:82301253-82301275 AAGAAGAGAGGGAGGGAGGAAGG + Intergenic
1086337406 11:85812755-85812777 ATGAAGCTAAGGAGGTAGGTGGG + Intergenic
1086538873 11:87884129-87884151 CTAAAGATAAGGATAGATGATGG - Intergenic
1086576560 11:88344921-88344943 ATGAAGCTAAGCAGGAAGGAAGG + Intergenic
1086647820 11:89246602-89246624 CTGTAGCTAAGGAGGGAGGCAGG - Intronic
1086880563 11:92148612-92148634 GAGAAGATATGGAGGGAGAAAGG + Intergenic
1086986154 11:93251499-93251521 CTGAAGCCAAGCAGGCAGGAAGG - Intergenic
1087192102 11:95265817-95265839 CAGAAGCTGAGGAGGGTGGATGG + Intergenic
1087335817 11:96843004-96843026 CTGAAGTCAATGAGGGAGCATGG - Intergenic
1087969767 11:104465288-104465310 CAGAAAATTAGGAGGGAGGAGGG - Intergenic
1088031946 11:105262049-105262071 CTGGAGAGAGGGAGGGAGGGAGG + Intergenic
1088033132 11:105276645-105276667 CTGAAGAGAAGGAGGAAGAGGGG + Intergenic
1088152875 11:106768225-106768247 GAGAAGCTGAGGAGGGAGGATGG - Intronic
1088327657 11:108617283-108617305 GAGAGGATAAGGAGGGAGGATGG + Intergenic
1088741815 11:112773790-112773812 TTGGAGATAAGGAGTGATGATGG + Intergenic
1089417125 11:118301581-118301603 CTGATGATAAGGAGGAGGCAGGG + Intergenic
1089615342 11:119691869-119691891 CTGCTGAGAAAGAGGGAGGAAGG - Intronic
1089775396 11:120832072-120832094 CTCAAGGCAAGGAGGGGGGAGGG - Intronic
1089894499 11:121915845-121915867 AGGAAGAAAGGGAGGGAGGAAGG - Intergenic
1090475080 11:127013021-127013043 CGGAAGAAAGGGAGGAAGGAGGG + Intergenic
1090611813 11:128478257-128478279 AAGAAGGAAAGGAGGGAGGAAGG + Intronic
1090634643 11:128683376-128683398 AAGAAGAAAAGGAGGGAGGGAGG + Intergenic
1090678236 11:129025672-129025694 AAGAAGAGAAGGAGGGATGAGGG + Intronic
1091003412 11:131930340-131930362 TTGAAAATAAGCATGGAGGAAGG - Intronic
1091024990 11:132134160-132134182 GAGAAGCTAAGGTGGGAGGATGG - Intronic
1091196201 11:133732785-133732807 GTGAAGACAAGGAGGGACAAGGG + Intergenic
1091267996 11:134285675-134285697 GGGAAGCTAAGGTGGGAGGATGG + Intronic
1091542255 12:1472710-1472732 AGGAAGGGAAGGAGGGAGGAAGG + Intronic
1091713596 12:2760360-2760382 CTGAGGATAAAGATGGAGGGAGG + Intergenic
1091755064 12:3045982-3046004 CTGAAGATTTGGAGAGATGAAGG - Intergenic
1091755867 12:3051153-3051175 CTGAAAGGAAGGAAGGAGGAAGG - Intergenic
1092037753 12:5353751-5353773 AGGAAGAGAAGGAGGGAGGGAGG + Intergenic
1092092317 12:5812955-5812977 AGGAAGAGAGGGAGGGAGGAAGG + Intronic
1092139423 12:6172506-6172528 CTGAAGTTCCAGAGGGAGGAAGG + Intergenic
1092489135 12:8929377-8929399 CTGTGGATAAGGAGGTAGGAAGG - Intronic
1092552253 12:9515435-9515457 AAGAAGAAAAGGAGGGAGGAAGG - Intergenic
1093336160 12:17906570-17906592 AGGAAAATAAGGAGGGTGGATGG - Intergenic
1094411004 12:30169173-30169195 CTGAACAGAAGGAAGGAAGACGG + Intergenic
1094519866 12:31175176-31175198 AAGAAGAAAAGGAGGGAGGAAGG + Intergenic
1095525647 12:43122004-43122026 CTAAATATAAGGAAGGAGAAGGG + Intergenic
1095569367 12:43666030-43666052 ATGAAAATAAGGAAGGATGAAGG - Intergenic
1095650582 12:44604193-44604215 AGAAAGAGAAGGAGGGAGGAAGG + Intronic
1096007776 12:48185992-48186014 CTGGAGGCAAGGAGAGAGGAGGG - Intergenic
1096584518 12:52611121-52611143 CTCAAGAGAAGGAGGGGGCAGGG + Intronic
1096740596 12:53691206-53691228 GGGAAGATGAGGTGGGAGGATGG - Intergenic
1097207311 12:57333721-57333743 CTAGAGGGAAGGAGGGAGGAAGG + Intronic
1097865027 12:64552892-64552914 TTGAAAATAAGGACGGAGGCCGG - Intergenic
1097926472 12:65133990-65134012 AGGAAGAGAGGGAGGGAGGAAGG + Intergenic
1098237513 12:68431718-68431740 CTGCAGAGAAGGAGAGAGGGAGG - Intergenic
1098802426 12:74978421-74978443 GGGAAGGGAAGGAGGGAGGAAGG + Intergenic
1099584221 12:84495504-84495526 TTGAAGAGAAGGAGGGAGGTAGG - Intergenic
1099644232 12:85330426-85330448 GTGGAGAAAGGGAGGGAGGAAGG - Intergenic
1100346213 12:93734052-93734074 AGGAAGGGAAGGAGGGAGGAAGG - Intronic
1100448966 12:94687093-94687115 CTGGGGATAAGGAAGGATGATGG + Intergenic
1100515447 12:95323112-95323134 AGGAAGGGAAGGAGGGAGGAAGG + Intergenic
1100522045 12:95384666-95384688 AGGAAGGAAAGGAGGGAGGAAGG - Intergenic
1100985913 12:100201536-100201558 AAGAAGGAAAGGAGGGAGGAAGG - Intronic
1101432062 12:104634931-104634953 ATCAAGGGAAGGAGGGAGGAAGG + Intronic
1101708526 12:107243314-107243336 TTGAGGACAAGGAGGCAGGAAGG + Intergenic
1101788989 12:107911318-107911340 CTGATGATGAGGAGGGAGCAGGG + Intergenic
1102067963 12:109994910-109994932 TTGAAGATAGGGAGGGGGTATGG - Intronic
1102368162 12:112357478-112357500 GTGATGATAAGGAGGGTGGGAGG + Intronic
1102416033 12:112763720-112763742 CTGAATTTCAAGAGGGAGGAGGG + Intronic
1102531571 12:113550455-113550477 CTGATGGTAAGGTGGAAGGATGG - Intergenic
1102544570 12:113645482-113645504 CTGAATTCAAGAAGGGAGGAAGG + Intergenic
1102552550 12:113702233-113702255 GGGGAGAGAAGGAGGGAGGAAGG - Intergenic
1102558629 12:113746487-113746509 AGGAAGAGAAGGAGGGAGAATGG - Intergenic
1102705703 12:114878457-114878479 GGGAAGAGAAGGAGGGTGGAGGG - Intergenic
1103030204 12:117606611-117606633 GGGAAGAAAGGGAGGGAGGAAGG - Intronic
1103080426 12:118019609-118019631 CTGAGGATCAGGAAGGAAGAAGG - Intronic
1103104385 12:118210192-118210214 AAGAAGAAAAAGAGGGAGGAAGG - Intronic
1103179038 12:118891709-118891731 CTGAAGACTAGGAAGGAGGATGG + Intergenic
1103252080 12:119508655-119508677 CTGAAGCTGAGGAGGGAGGCAGG + Intronic
1103363319 12:120366789-120366811 GGGAAGAGAATGAGGGAGGAAGG - Intronic
1103444351 12:120984480-120984502 GAGAAGGGAAGGAGGGAGGAAGG + Intronic
1103620397 12:122183719-122183741 CTGGAGACAGGGAGGCAGGATGG - Intronic
1103688538 12:122752152-122752174 ATGAAGGAAGGGAGGGAGGAAGG + Intergenic
1104202800 12:126608265-126608287 ATGAAAAGAAGGAGGGAGCATGG + Intergenic
1104505665 12:129329855-129329877 CTGAAGATGAGGGGAGAGTATGG + Intronic
1104540117 12:129656203-129656225 AGGAAGATAGGAAGGGAGGAAGG + Intronic
1104559203 12:129828773-129828795 AGGAAGAAAAGGAGGGAGGGAGG + Intronic
1104803285 12:131569347-131569369 CTGAGGAGAGGGAGGGAGGAGGG - Intergenic
1105323617 13:19350440-19350462 GGGAGGCTAAGGAGGGAGGATGG - Intergenic
1105870329 13:24499057-24499079 GGGAGGCTAAGGAGGGAGGATGG + Intronic
1106082925 13:26515464-26515486 CTGAAGTTAAAGAGGCACGAGGG + Intergenic
1106544519 13:30718487-30718509 ATGGAGAAAAGGATGGAGGAAGG - Intronic
1106594329 13:31123732-31123754 AGGAAGAAAAGAAGGGAGGAGGG - Intergenic
1107798813 13:44083839-44083861 GGGAAGATTAGGAGGGAGGAGGG + Intergenic
1107988863 13:45799584-45799606 CTGGAGCTCAGGATGGAGGATGG + Intronic
1108698943 13:52927303-52927325 AGGAAGAAAAGGAGGAAGGAAGG - Intergenic
1108822365 13:54368751-54368773 AGGAAGAGAAGGAGGGAGGGAGG + Intergenic
1109496618 13:63180269-63180291 AGGAAGAAAGGGAGGGAGGAAGG - Intergenic
1110451558 13:75642363-75642385 GGGAGGCTAAGGAGGGAGGATGG + Intronic
1110466287 13:75806024-75806046 ATGAAGAAAAGAAGGGAAGAGGG - Intronic
1110533590 13:76625810-76625832 AAGAAGAGAAGGAGGGAGAAAGG - Intergenic
1110708241 13:78620372-78620394 CTCAAGAAAAGGAGGAAGTATGG - Intronic
1111048366 13:82846592-82846614 AGGAAGAAAGGGAGGGAGGAAGG + Intergenic
1111057207 13:82967123-82967145 AGGAAGAAAAGGAGGAAGGAAGG + Intergenic
1111086340 13:83380449-83380471 AGGAAGAGAGGGAGGGAGGAAGG - Intergenic
1111166583 13:84465118-84465140 CTTAAGGTAAGCATGGAGGATGG + Intergenic
1111363627 13:87210819-87210841 AGGAAGATAGGGAGGGAAGAAGG - Intergenic
1111537420 13:89621211-89621233 GGGAATAAAAGGAGGGAGGAAGG - Intergenic
1111612690 13:90623953-90623975 CAGAAAATAAGGTGGGAGGGAGG + Intergenic
1111792020 13:92869538-92869560 AGGAAGGAAAGGAGGGAGGAGGG + Intronic
1111986659 13:95072749-95072771 GTGAAGAACAGAAGGGAGGAAGG - Intronic
1112306031 13:98274404-98274426 CAGAAGAGACTGAGGGAGGAAGG + Intronic
1112620528 13:101049809-101049831 TTGAAGCCAAGGAGGAAGGAGGG + Intergenic
1113303874 13:109054961-109054983 AGGAGGAAAAGGAGGGAGGAAGG - Intronic
1113405142 13:110031931-110031953 CTGGAAATTAAGAGGGAGGAAGG + Intergenic
1113673205 13:112189010-112189032 CTGTAGACTAGGAGAGAGGAAGG + Intergenic
1113695030 13:112339234-112339256 CTGAAGAGAAGGAGGGAGGTGGG - Intergenic
1113814054 13:113159418-113159440 CGAGAGAAAAGGAGGGAGGATGG + Intronic
1113849275 13:113408854-113408876 CTGCAGAGAGGAAGGGAGGAGGG + Intergenic
1113974473 13:114216249-114216271 CTGAAAACAAGCCGGGAGGAGGG - Intergenic
1114492189 14:23109999-23110021 ATGAAGATGAGGAAGGAGGAAGG + Intergenic
1114492273 14:23110661-23110683 ATGGGGATAAGGAGAGAGGATGG + Intergenic
1115598201 14:34929431-34929453 CTGGACATAAGGAGCCAGGAAGG - Intergenic
1115833344 14:37367521-37367543 CTGAAGAAAAAGAGGAAGCATGG - Intronic
1115968479 14:38918325-38918347 CAGAGGAAAAGGAGGAAGGAAGG + Intergenic
1116109421 14:40558249-40558271 GTGAAGAAAAGGAGGGTGGAAGG - Intergenic
1116416874 14:44688627-44688649 CTGAAAAAATGGAGGGAGTATGG + Intergenic
1116987209 14:51233361-51233383 CAGAAGGAAAGGAGGGAGAAAGG + Intergenic
1117061107 14:51964769-51964791 CGGAAGGTGAGGCGGGAGGATGG + Intronic
1117162398 14:53002227-53002249 GAGATGAGAAGGAGGGAGGAGGG - Intergenic
1117796449 14:59399032-59399054 CTGAAGAAAAGGGAGGAAGAGGG - Intergenic
1118227122 14:63912249-63912271 AAGAAGGAAAGGAGGGAGGAAGG + Intronic
1118348074 14:64954234-64954256 GTGAAGAGAAGGAGGGAGGAAGG + Intronic
1118421881 14:65615208-65615230 AGGAAGCTAAGGAAGGAGGATGG - Intronic
1118443334 14:65831069-65831091 CTGAAGAGATGATGGGAGGAAGG + Intergenic
1118795480 14:69139859-69139881 AGGAAGGGAAGGAGGGAGGAAGG + Intronic
1118837238 14:69485606-69485628 CTCAGGCTAAGGAGGGAGGAAGG + Intronic
1118895519 14:69942561-69942583 CTGGAGATAAGGAGAGAAGCAGG - Intronic
1119076394 14:71644343-71644365 TGGAAGCTAAGGTGGGAGGATGG - Intronic
1119344439 14:73910886-73910908 GTGAAGATAAGGAGGGAAAGGGG + Intronic
1120039873 14:79740147-79740169 CTGAATATAAAGGGGGAGGGAGG - Intronic
1120205320 14:81581327-81581349 GAGAAGACAAGGAGAGAGGATGG + Intergenic
1120681840 14:87489410-87489432 CTGTAGAAAAGGAGGAAGAAAGG + Intergenic
1120746907 14:88160366-88160388 CAGAAGAAAGGAAGGGAGGATGG - Intergenic
1121092800 14:91194498-91194520 CTGAGGTTAGGGAGGGGGGATGG + Intronic
1121092952 14:91195509-91195531 CTGAAGGTATGCAGGGAGGTAGG + Intronic
1121608037 14:95255576-95255598 CTGCAGAGAAGGAGGCAGTAGGG + Intronic
1121710795 14:96038191-96038213 AGGAAGAAAAGGAGGGAGAAAGG + Intergenic
1121797225 14:96745206-96745228 CTGTAGGGAAGGAGGGAGGCAGG - Intergenic
1121947550 14:98137345-98137367 AGGAAGATAAGGAGGGAGATGGG + Intergenic
1122020240 14:98831912-98831934 GTGAAGACAGGGAGTGAGGATGG + Intergenic
1122068592 14:99190619-99190641 AGGAAGGAAAGGAGGGAGGAAGG + Intronic
1122096472 14:99376528-99376550 AGGCAGATAAGGAGGGAGGGAGG + Intergenic
1122099249 14:99394252-99394274 TTGAGGGTAAGGAGGGAGGCAGG - Intergenic
1122972431 14:105157896-105157918 CTGAGGATGAGGAGGGTGGTGGG - Intronic
1202936096 14_KI270725v1_random:88989-89011 CTTACAATAGGGAGGGAGGAAGG + Intergenic
1202937453 14_KI270725v1_random:104384-104406 AGGAAGAAAAGGAGGGAGGGAGG - Intergenic
1123677822 15:22729222-22729244 CTGAGGAAGAGGAGGAAGGAGGG + Intergenic
1123983757 15:25625912-25625934 CTGAAGACAAGGAGGGTGGCTGG + Intergenic
1124330023 15:28803486-28803508 CTGAAGAAGAGGAGGAAGGAGGG + Intergenic
1124486623 15:30123064-30123086 CTGAAGATCAGTAGGCAGGCTGG + Intergenic
1124541699 15:30592043-30592065 CTGAAGATCAGTAGGCAGGCTGG + Intergenic
1124548359 15:30653838-30653860 CTGAAGATCAGTAGGCAGGCTGG + Intronic
1124756907 15:32415254-32415276 CTGAAGATCAGTAGGCAGGCTGG - Intergenic
1125121234 15:36161151-36161173 CTGAAGGGAAGAAGGAAGGAAGG + Intergenic
1125124992 15:36209776-36209798 GTGAAGATAGAGAGGGAAGAAGG + Intergenic
1125411614 15:39411925-39411947 CTGATGGTAAGGTAGGAGGAAGG + Intergenic
1126778508 15:52119304-52119326 GTGATGAGAGGGAGGGAGGAGGG + Exonic
1126919953 15:53510162-53510184 CTGAAAAAAAGAAGGAAGGAAGG - Intergenic
1127711994 15:61608162-61608184 TTTAAGTAAAGGAGGGAGGAAGG + Intergenic
1127788613 15:62378615-62378637 AGGAAGAGAGGGAGGGAGGAAGG + Intergenic
1127873584 15:63093253-63093275 CTTAAAATATGGTGGGAGGATGG + Intergenic
1128064498 15:64755900-64755922 CTTTAGTTAAGGAGTGAGGAAGG - Intronic
1128109222 15:65066161-65066183 ATGAAGGGAAGGAGGGAGGGAGG + Intronic
1128365027 15:66993404-66993426 GGGAAGAAAGGGAGGGAGGAAGG + Intergenic
1128440303 15:67701133-67701155 ATGAAGAAATGGAGAGAGGAAGG + Intronic
1128458003 15:67843724-67843746 CCGGAGGGAAGGAGGGAGGAAGG + Intergenic
1128589325 15:68880740-68880762 CTGATGAGAAGGAGGGGGGCAGG + Intronic
1128713276 15:69887897-69887919 CAGGAGAAAAGGAAGGAGGAAGG + Intergenic
1128809844 15:70562850-70562872 ATAAAGATAAGGTTGGAGGAAGG - Intergenic
1128919058 15:71593980-71594002 CTGATGAGAAAGAGGGAAGAGGG + Intronic
1129142359 15:73611581-73611603 CAGGAGATAAGAAGGAAGGAGGG + Intronic
1129165244 15:73773574-73773596 AGGCAGAAAAGGAGGGAGGAGGG - Intergenic
1129980554 15:79865643-79865665 CTGAGGGTAAGCAGGGATGAGGG - Intronic
1130378407 15:83351028-83351050 TGGAAGGAAAGGAGGGAGGAAGG - Intergenic
1130552280 15:84897779-84897801 CTGAAGGGGAGGAGGGAGGCGGG - Intronic
1130754912 15:86752971-86752993 CTGAAGAAAGGGCGGGAGCAAGG - Intronic
1130847135 15:87758090-87758112 ATGAAGGAAGGGAGGGAGGAAGG + Intergenic
1130891654 15:88138552-88138574 CTGAAGAGGAGGAGGGAGTGAGG - Intronic
1131009719 15:89006993-89007015 GGGAGGCTAAGGAGGGAGGATGG - Intergenic
1131508246 15:93034556-93034578 CGGAAGAGAGGGAGGGAAGAGGG + Intergenic
1131636342 15:94236833-94236855 TTGTAGATCAGGAGGGAGGTAGG + Intronic
1132934311 16:2473245-2473267 CTGCAGAGAGGGAGGGAGAATGG - Intronic
1133229663 16:4360541-4360563 CTGAAGATCTGGGGGCAGGAAGG + Exonic
1133464580 16:6018191-6018213 AGGAAGAAAGGGAGGGAGGAAGG + Intergenic
1133469244 16:6058293-6058315 AGGAAGAAGAGGAGGGAGGAAGG - Intronic
1133689547 16:8199989-8200011 GAGAAGAGAGGGAGGGAGGAAGG - Intergenic
1133953977 16:10423748-10423770 CTGATGAGGAGGAGGAAGGAGGG - Intronic
1134212441 16:12289075-12289097 GAAGAGATAAGGAGGGAGGATGG + Intronic
1134849397 16:17468680-17468702 ATGAAGAGAAGGAAGGAGGCAGG - Intronic
1134860986 16:17560605-17560627 TGGAAGGAAAGGAGGGAGGAAGG + Intergenic
1134861003 16:17560668-17560690 AGGAAGGAAAGGAGGGAGGAAGG + Intergenic
1135514241 16:23116576-23116598 GAGAAGATAAGGAGGAAGAATGG - Intronic
1135529079 16:23237231-23237253 GGGAAGGGAAGGAGGGAGGAAGG - Intergenic
1135585265 16:23665461-23665483 CTGACGAGAAGGAGGCAGCAAGG - Intronic
1135637903 16:24094794-24094816 ATGAAGGAAGGGAGGGAGGAAGG + Intronic
1135728194 16:24873232-24873254 ATGGAGAGAGGGAGGGAGGAAGG + Intronic
1135892642 16:26371450-26371472 GGGAAGGGAAGGAGGGAGGAAGG + Intergenic
1135943178 16:26840586-26840608 TGGAAGATAAGAAGGAAGGAAGG + Intergenic
1136007112 16:27338456-27338478 GGGAGGCTAAGGAGGGAGGATGG - Intronic
1136067513 16:27768828-27768850 CTGCAGAAAGGAAGGGAGGAAGG - Intronic
1136333482 16:29596371-29596393 AGGAAGGAAAGGAGGGAGGAAGG + Intergenic
1136498516 16:30658452-30658474 CTGAGGAGGAAGAGGGAGGAGGG + Exonic
1136564750 16:31063235-31063257 GGGAGGATAAGGTGGGAGGATGG - Intronic
1136575993 16:31125728-31125750 CTGTAGCTGAGAAGGGAGGAAGG - Intronic
1136901093 16:34038714-34038736 AGGAAGAAAAGGAGGGAGGGAGG + Intergenic
1137532445 16:49287949-49287971 CTGAAGATGGAGAAGGAGGAAGG - Intergenic
1137688482 16:50403164-50403186 ATGGTGAGAAGGAGGGAGGAAGG + Intergenic
1137710354 16:50562715-50562737 CTGAAGGAAAGGAGAGAGGAGGG + Intronic
1137774075 16:51041086-51041108 ATGAAGACAAGGAAGAAGGAAGG + Intergenic
1137791629 16:51179919-51179941 TAGAAGAGAAGGAGGGAGGAGGG - Intergenic
1137871542 16:51954637-51954659 CAGAAGAAAAGGAAGGAGGAAGG - Intergenic
1137931307 16:52590052-52590074 AGGAAGGTAAGAAGGGAGGAGGG + Intergenic
1138021445 16:53485749-53485771 CGGAGGATAAGGTGGAAGGATGG + Intronic
1138026025 16:53523147-53523169 CAGAAGATCAGGAGAGAGGCTGG - Intergenic
1138059504 16:53875099-53875121 AGGAAGAGAGGGAGGGAGGAAGG + Intronic
1138103970 16:54277136-54277158 CTAAAGACAGGAAGGGAGGAAGG + Intergenic
1138155269 16:54697065-54697087 CTGGAGATAAGGAGGTAAGGAGG + Intergenic
1138183965 16:54962447-54962469 TTGAAGAAAGGGAGGGAGGGAGG - Intergenic
1138522730 16:57580374-57580396 AGGAAGCTAAGGTGGGAGGATGG + Intronic
1138900693 16:61265511-61265533 ATGAAGGGAAGGAGGGAGGCGGG - Intergenic
1139139687 16:64246198-64246220 CTGAAAGTGTGGAGGGAGGAAGG + Intergenic
1139248137 16:65468340-65468362 CCCAACATAAGGAGGGAGGCAGG + Intergenic
1139249322 16:65479880-65479902 CTGAAGAAATAGAGGTAGGAGGG + Intergenic
1139273150 16:65702063-65702085 CTGAACATAAGCAGGGGCGACGG - Intergenic
1139678555 16:68541988-68542010 CTGCAGATAACCAGGGATGAAGG + Intronic
1139946283 16:70644736-70644758 AGGAAGAGGAGGAGGGAGGAGGG + Intronic
1140107379 16:71973176-71973198 CTGGGCAAAAGGAGGGAGGAGGG - Intronic
1140879027 16:79180685-79180707 ATGAAGAAATGGAGGGAGGGAGG - Intronic
1140894947 16:79316746-79316768 CTGGAGATAGGGACAGAGGAAGG + Intergenic
1141056852 16:80824815-80824837 AGGAAGAGAAGGAGGAAGGAAGG + Intergenic
1141182928 16:81766565-81766587 ATGAATATAATGGGGGAGGAAGG - Intronic
1141263675 16:82476238-82476260 AGGAGGAGAAGGAGGGAGGAGGG - Intergenic
1141348472 16:83270891-83270913 AGGAAGGAAAGGAGGGAGGAAGG - Intronic
1141557581 16:84846206-84846228 GGGAAGGGAAGGAGGGAGGAAGG - Intronic
1141651435 16:85395119-85395141 CTGAGGATGAGGAGGAAGGATGG + Intergenic
1141665211 16:85462348-85462370 CTGAGGGTAGGGAGGGTGGAGGG - Intergenic
1142614716 17:1127587-1127609 CTGGAGAGGAGGAGGGAGGAGGG - Intronic
1142652562 17:1364822-1364844 CTGTGGATAAGGGGGGATGATGG + Intronic
1142687520 17:1586213-1586235 CTGAAGTTGAGGATGGAGCACGG + Intronic
1143224522 17:5289147-5289169 AAGAAGAAAGGGAGGGAGGAAGG - Intronic
1143249427 17:5511811-5511833 ATGAAGAAAAAGAGGAAGGAAGG - Intronic
1143463364 17:7118466-7118488 ACGAAGGAAAGGAGGGAGGAAGG + Intergenic
1143894497 17:10125646-10125668 GGGGAGATGAGGAGGGAGGAGGG + Intronic
1143964087 17:10743936-10743958 AGGAAGAGAAGGAGGGAGGGAGG - Intergenic
1144100685 17:11939766-11939788 CTAAAGAGAAGGAGTGAGAAGGG + Intronic
1144560987 17:16320244-16320266 AGGAAGGAAAGGAGGGAGGAAGG + Intronic
1144955779 17:19018139-19018161 GGGAAGAAAGGGAGGGAGGAAGG + Intronic
1145051891 17:19668946-19668968 AAGAAGAAAAGGAGGGAGGGAGG - Intronic
1145709116 17:26952547-26952569 AGGAAGAAAAGGAGGGAGGGAGG + Intergenic
1145858730 17:28188096-28188118 CAGAAGCTGAGGTGGGAGGATGG + Intronic
1145961794 17:28890983-28891005 GAGAAGCTAAGGTGGGAGGATGG - Intronic
1146010570 17:29191236-29191258 CTGAAGGAGAGGAAGGAGGAAGG - Intergenic
1146027479 17:29333982-29334004 CCGAAGATAATGAGTGAGGAGGG + Intergenic
1146175476 17:30663650-30663672 CTGTGGATAAGGATGGAGGGAGG - Intergenic
1146348927 17:32079696-32079718 CTGTGGATAAGGATGGAGGGAGG - Intergenic
1146422233 17:32698337-32698359 GGGAAGAGAGGGAGGGAGGAAGG - Intronic
1146547698 17:33753300-33753322 GGGAAGAAAAGGAGGGAAGAAGG + Intronic
1146797686 17:35794681-35794703 CTGAACTTAAGGGGGCAGGAAGG - Intronic
1146944551 17:36864766-36864788 AGGAAGGAAAGGAGGGAGGAGGG - Intergenic
1147186386 17:38715589-38715611 CTGAAGGAGAGGAGAGAGGAAGG - Intronic
1147241060 17:39090817-39090839 TTGAACATGAGGAGGAAGGATGG + Intronic
1147426203 17:40346993-40347015 CTGCAGGTAAGGGGGGAGGGTGG + Intronic
1147786468 17:42981719-42981741 CTGAGGCTGAGGCGGGAGGATGG - Intronic
1147865211 17:43547274-43547296 CTGATGATCTGGAGGCAGGATGG + Intronic
1148046398 17:44747637-44747659 CTGAGGATAAGGGGAAAGGAAGG - Intronic
1148102190 17:45099047-45099069 CAGAAGGGGAGGAGGGAGGAGGG + Intronic
1148180689 17:45602452-45602474 AAGAAGAAAAGGAGGGAGGAAGG - Intergenic
1148180704 17:45602548-45602570 AAGAAGAAAAGGAGGGAGGAAGG - Intergenic
1148268199 17:46243378-46243400 AAGAAGAAAAGGAGGGAGGAAGG + Intergenic
1148268214 17:46243472-46243494 GAAAAGAAAAGGAGGGAGGAAGG + Intergenic
1148458750 17:47825518-47825540 AGGAAGTTAAGGTGGGAGGATGG + Intronic
1148478873 17:47946880-47946902 CTGAAGATAAGGGGTAGGGAGGG - Exonic
1148885525 17:50769439-50769461 CTTATGCTAAGGTGGGAGGATGG + Intergenic
1148947982 17:51282462-51282484 ATGAAGAGAAAGAGGAAGGAAGG + Intronic
1149587319 17:57800652-57800674 CAGAAGGTAAAGAGGGAGGGAGG - Intergenic
1149655455 17:58307538-58307560 GTGGAGGAAAGGAGGGAGGAGGG + Intronic
1149725863 17:58893675-58893697 CTGTCGATAGGGAGGGAGGCTGG + Intronic
1149729549 17:58931417-58931439 AGGGAGAGAAGGAGGGAGGAAGG + Intronic
1149793364 17:59498489-59498511 CTGAAGAGAAGCAGGGTGGAGGG + Intergenic
1150216734 17:63475588-63475610 CTGCAGGTCAGGAGGGAGGCTGG + Intergenic
1150386467 17:64765519-64765541 CTGAGAATGGGGAGGGAGGAGGG - Intergenic
1150502031 17:65660282-65660304 GAAAAGAGAAGGAGGGAGGAAGG - Intronic
1150633596 17:66897606-66897628 TTGCAGAGAAGGAAGGAGGAAGG - Intergenic
1150810414 17:68352016-68352038 CTGGACATAAGGAGGGAGGGAGG + Intronic
1151013556 17:70529677-70529699 TTGAAGCTGAGGTGGGAGGAGGG + Intergenic
1151021553 17:70623151-70623173 CTGAAGATAGAGAGGGTTGATGG - Intergenic
1151245919 17:72794567-72794589 GTGTAGAGAAGGAGGGAGCAGGG - Intronic
1151305660 17:73261356-73261378 CTGTAGAGAAGGAAGGGGGAGGG + Intronic
1151320730 17:73350829-73350851 CAGGAGATTTGGAGGGAGGAGGG - Intronic
1151409537 17:73912686-73912708 CTGAAGACAGGAAGGAAGGAAGG - Intergenic
1151536587 17:74742309-74742331 CTGGAGTTGGGGAGGGAGGATGG + Intronic
1151850483 17:76686925-76686947 GTGCAGATAAGGGGGGAGGCTGG + Intronic
1152050730 17:77974032-77974054 CTGGAGAGAGGGAGGGAGGGAGG + Intergenic
1152230045 17:79109846-79109868 CCGAGGATGAGGCGGGAGGAAGG + Intronic
1152405171 17:80094023-80094045 CCGAAGATAAGCAGGGTGAAGGG - Intronic
1152648159 17:81479806-81479828 CTGAAGAAAAGCAGGGGGCAAGG - Intergenic
1152913076 17:83016603-83016625 CTGAAGAGGAGGGGGGAGGAGGG + Intronic
1153025729 18:670654-670676 AGGAAGATAAGGAGGGATGGTGG - Intronic
1153090997 18:1342670-1342692 GGGAAAATAAGGAAGGAGGAAGG - Intergenic
1153831789 18:8930257-8930279 AGAAAGAGAAGGAGGGAGGAAGG + Intergenic
1154031536 18:10757505-10757527 CAGAAGATGAGGAGGAGGGATGG + Intronic
1154358587 18:13641566-13641588 CTGCAGAACAGGAGGGAGGCCGG + Intronic
1154515841 18:15164632-15164654 AGGAAGAAAAGTAGGGAGGAAGG - Intergenic
1154519134 18:15208211-15208233 AGGAAGAAAAGGAGGGAGGAAGG - Intergenic
1155140487 18:23040034-23040056 AGGAAGAAAGGGAGGGAGGAAGG + Intergenic
1155140495 18:23040062-23040084 AGGAAGAAAGGGAGGGAGGAAGG + Intergenic
1155140502 18:23040086-23040108 AGGAAGAAAGGGAGGGAGGAAGG + Intergenic
1155600953 18:27546879-27546901 AAGAAGAAAAGGAGAGAGGAAGG + Intergenic
1155658325 18:28217887-28217909 CTGAAAAAAAGGTAGGAGGAAGG - Intergenic
1156524439 18:37753418-37753440 AGGAAGGAAAGGAGGGAGGAAGG - Intergenic
1156528859 18:37795749-37795771 CTGAAGAGAAGGAGAAAGCAAGG + Intergenic
1156760726 18:40585781-40585803 CTGAAGTGAAGGAGGGAGTCTGG + Intergenic
1156761803 18:40601049-40601071 AAGAAGGGAAGGAGGGAGGAAGG - Intergenic
1157204929 18:45689684-45689706 GTGATGGTAAGGAGGGAGGGTGG - Intergenic
1157239837 18:45998636-45998658 CTGAAGGGAAAAAGGGAGGAAGG - Intronic
1157332724 18:46715178-46715200 CTGCAGAAAAGGAGGGAAAAAGG - Intronic
1157511174 18:48275987-48276009 CTCAAGATACAGAGGGAGGAGGG + Intronic
1157743081 18:50110364-50110386 CTGGAGCAAATGAGGGAGGAAGG - Intronic
1157850299 18:51042380-51042402 CTGAAGTAAGGGAGGGAGGCAGG - Intronic
1158241118 18:55379543-55379565 AGGAAGAAGAGGAGGGAGGAAGG + Intronic
1158528198 18:58234311-58234333 AGGGAGAGAAGGAGGGAGGAAGG - Intronic
1158834780 18:61319472-61319494 CTGAAGAGCAGGTGGGAGAATGG + Intergenic
1159325968 18:66918308-66918330 GTGAAGAAAGGGAGGAAGGAAGG - Intergenic
1159343594 18:67169335-67169357 AGGAAGAGAGGGAGGGAGGAAGG + Intergenic
1159512633 18:69416067-69416089 AGGAAGGAAAGGAGGGAGGAAGG + Intronic
1159946154 18:74446211-74446233 CAGAAGACCATGAGGGAGGATGG - Intronic
1160041261 18:75347750-75347772 ATGAAGAGAGGGAGGGAGGGAGG + Intergenic
1160242650 18:77133952-77133974 CTGAAGGTGAGGAGGGAAAAGGG + Intergenic
1160758624 19:771638-771660 GGGGAGATAGGGAGGGAGGAGGG - Intergenic
1161451730 19:4350124-4350146 CTGAAGGTGGGGAGGGAGGGAGG + Intronic
1161650678 19:5482582-5482604 AGGAAGAAAAGGAGGGGGGAAGG + Intergenic
1161931295 19:7342145-7342167 CAGAGGATGAGGAGGGAGGCTGG + Intergenic
1162362574 19:10228864-10228886 CTGGAGATTAGGAGAGGGGAAGG + Intronic
1162536020 19:11262960-11262982 CTGAAGCTCAGGAGGGAGGGAGG + Intergenic
1162977344 19:14214570-14214592 AGGAAGATAAGAAGGGAGGAAGG + Intergenic
1162983490 19:14254261-14254283 CTGTGGATAAGGATGGAGGGAGG + Intergenic
1163159462 19:15456307-15456329 CTGAAGACAAGGTTGGAGGATGG - Intronic
1163442691 19:17329633-17329655 CAGGAGAGAAGGATGGAGGAGGG + Intronic
1163521492 19:17794725-17794747 ATGGCGATAAGGAGGGAGGGAGG - Intergenic
1163779753 19:19240065-19240087 ATGAGGAGCAGGAGGGAGGAGGG - Intronic
1164092143 19:21966254-21966276 CTAAAAAGAAGGAGGAAGGATGG - Intronic
1164196284 19:22965573-22965595 CTAAAGAGAAGGAGGAAGGAAGG - Intergenic
1164441816 19:28284869-28284891 GTGGAGAGAAGGAGGGTGGAGGG + Intergenic
1164463515 19:28468405-28468427 ATGAAGAGAAGGAGGGGAGAAGG + Intergenic
1164667361 19:30050445-30050467 AGGAAGGAAAGGAGGGAGGAAGG - Intergenic
1165427300 19:35753240-35753262 CTGAGGATGAGGAGGTGGGATGG + Exonic
1165465889 19:35974574-35974596 GGGAAGCTGAGGAGGGAGGATGG - Intergenic
1165586783 19:36923848-36923870 CTTAAGTGAAGGTGGGAGGAGGG - Intronic
1165730463 19:38141582-38141604 CTGAAACGAAGGAGGGAGGGAGG - Intronic
1165854364 19:38870856-38870878 TTGAAGGAAAGGAGGAAGGAAGG - Exonic
1165891911 19:39117728-39117750 CTGAAGATCTGGAGGGAGGAAGG - Intergenic
1166015178 19:39974215-39974237 GTGGAGATTAGGAGGGAGGAAGG + Intronic
1166353319 19:42211454-42211476 AGGAAGAGAGGGAGGGAGGAAGG + Intronic
1166563365 19:43747953-43747975 GAGCAGAGAAGGAGGGAGGAGGG - Intronic
1166708788 19:44924133-44924155 CAGAAGTTTAGCAGGGAGGAGGG + Intergenic
1166710757 19:44935741-44935763 CAGAAGATTAGCAGGGAGGAGGG + Intergenic
1166829455 19:45630047-45630069 CTAAAGAGGAGGAGAGAGGAGGG + Intronic
1167035422 19:46992544-46992566 CTCCAGATAGGCAGGGAGGAGGG - Intronic
1167420264 19:49398606-49398628 GGGAGGATAAGGCGGGAGGATGG - Intronic
1167487772 19:49773144-49773166 CTGCAGATAAGGAGGGGGAGAGG + Intronic
1167634937 19:50648975-50648997 ATGAAGACAAGGAGGGACGGGGG + Intronic
1168143897 19:54408517-54408539 AGGAAGAAAGGGAGGGAGGAAGG + Intergenic
1168323954 19:55528708-55528730 CCGGAGAGAAGGAGAGAGGACGG + Intergenic
1168465002 19:56595047-56595069 GAGAAGAGACGGAGGGAGGAAGG - Intergenic
1202672032 1_KI270709v1_random:63987-64009 AGGAAGAAAAGGAGGGGGGAGGG + Intergenic
1202684447 1_KI270712v1_random:36509-36531 CTTACAATAGGGAGGGAGGAAGG - Intergenic
924961266 2:36602-36624 ATCAAGAAAGGGAGGGAGGAGGG - Intergenic
925018307 2:548194-548216 CTGAAGACAAGGAAGGATGTTGG - Intergenic
925082165 2:1078843-1078865 CTGAGGGTCAGGAGGGAGGAAGG + Intronic
925466473 2:4110924-4110946 AAGAAGAAAGGGAGGGAGGAAGG - Intergenic
925719550 2:6813754-6813776 AGGAAGAAAGGGAGGGAGGAAGG + Intergenic
926266787 2:11330727-11330749 GGGAAGATGAGGAGGGAGGAGGG + Intronic
926339697 2:11894846-11894868 CTGAGGGTAAGGAGGTGGGAAGG + Intergenic
926700250 2:15798680-15798702 AGGAAGGGAAGGAGGGAGGAAGG + Intergenic
927269899 2:21195429-21195451 CTGAAGAAAGGGAAGAAGGAAGG - Intergenic
927291428 2:21408540-21408562 TTGAAGATGAGGGTGGAGGAAGG + Intergenic
927715235 2:25347598-25347620 CTGGAAGTCAGGAGGGAGGATGG - Intergenic
927791773 2:26015753-26015775 CTAAAGAAAAGGAGGAAGAAGGG + Intergenic
927880999 2:26690083-26690105 CCCAAGAGAAGGAGAGAGGAGGG + Intergenic
928095652 2:28403445-28403467 CTGATGATGGGAAGGGAGGAGGG + Intronic
928269296 2:29841986-29842008 GTGAAGAGGAGGATGGAGGAAGG - Intronic
928359912 2:30654731-30654753 CTGAAGAGGAGGAGAGGGGAGGG - Intergenic
929298263 2:40272350-40272372 AGGGAGATAAGGAGGGAGAAAGG + Intronic
929334236 2:40721368-40721390 AAGAAGAGAGGGAGGGAGGAAGG + Intergenic
929342202 2:40834242-40834264 CAGATGGGAAGGAGGGAGGAAGG - Intergenic
929573129 2:43035554-43035576 CTGAAGATAAGAGGGGACTACGG + Intergenic
929600214 2:43199985-43200007 CTGGAGCCAGGGAGGGAGGACGG - Intergenic
929617763 2:43325554-43325576 AGGAAGGGAAGGAGGGAGGAAGG + Intronic
929736485 2:44555441-44555463 GTGAGGATGGGGAGGGAGGATGG + Intronic
930073759 2:47390260-47390282 AGGAAGATAGGGAGGGAGGGAGG - Intergenic
930298135 2:49580576-49580598 ATGAATATAATGAGGGAGAAAGG + Intergenic
930352647 2:50277396-50277418 AGGAAGGGAAGGAGGGAGGAAGG - Intronic
930366499 2:50446350-50446372 GTGAAAAGAGGGAGGGAGGAAGG - Intronic
930372546 2:50522048-50522070 AGGAAGAAAAGGAGGGAGGAAGG + Intronic
930614515 2:53579423-53579445 AAGAAGCTAAGGATGGAGGAGGG - Intronic
931071210 2:58652398-58652420 CTGCAGAAAAGGAGGCAGGTGGG + Intergenic
931574977 2:63709347-63709369 CTGAGGGTAAGAATGGAGGAGGG - Intronic
932073691 2:68644351-68644373 CTGAAAAGAAGGAGGGGGGCAGG - Intronic
932379048 2:71265269-71265291 AGGAAGAGAGGGAGGGAGGAAGG - Intergenic
932503817 2:72209407-72209429 CTGAGGCTGAGGTGGGAGGATGG + Intronic
932831632 2:74996076-74996098 CAGAAGTTGAGGAGAGAGGACGG + Intergenic
933448298 2:82411379-82411401 CTGAAGAGAAGGAGAGAAAAGGG - Intergenic
933805602 2:85996500-85996522 CTGAAGAAGAGGAAGGAGGTGGG + Intergenic
933935552 2:87200788-87200810 CTTAACATAAGGATGGAGGTTGG + Intergenic
934100889 2:88651970-88651992 CTCAAGACTAGGAGGCAGGAAGG + Intergenic
934247271 2:90318337-90318359 CTTACAATAGGGAGGGAGGAAGG + Intergenic
934262054 2:91484266-91484288 CTTACAATAGGGAGGGAGGAAGG - Intergenic
935096512 2:99949398-99949420 CTGGAGAGCAGGGGGGAGGATGG + Intronic
935134010 2:100283286-100283308 CAGAATATATGAAGGGAGGATGG - Exonic
935267338 2:101406276-101406298 GTGGAGAGAAGGAGGGAGGTAGG + Intronic
935788006 2:106566658-106566680 AGGAAGAGAGGGAGGGAGGAAGG - Intergenic
935831529 2:107005699-107005721 CTGAAGCTAAGGAGGGAAGGAGG - Intergenic
936259107 2:110943078-110943100 AAGAAGAGAGGGAGGGAGGAAGG + Intronic
936357597 2:111765111-111765133 CTTAACATAAGGATGGAGGTTGG - Intergenic
936457952 2:112689658-112689680 AGGAAGCTAAGGTGGGAGGATGG + Intergenic
936569060 2:113600276-113600298 CTGAGGCTGAGGAGGGAGAAGGG - Intergenic
936715362 2:115180920-115180942 CTTAAGAAAGGGAGGGAGGCAGG - Intronic
936993009 2:118386104-118386126 ATGAAGAGAGGGAGGTAGGAAGG + Intergenic
937305454 2:120867803-120867825 CTGGAGGGAAGGAGGGAGGGAGG + Intronic
937701448 2:124867109-124867131 ATGATGAAAGGGAGGGAGGAAGG - Intronic
937708706 2:124952299-124952321 TTGAAGATAATGAGGTAAGAAGG + Intergenic
937937040 2:127254452-127254474 CAGAACAAAAGGATGGAGGAAGG - Intergenic
938120347 2:128628601-128628623 CCGAAGAAAGGGAGGGAGGAAGG - Intergenic
938409684 2:131053768-131053790 AGGAAGCTAAGGTGGGAGGATGG + Intronic
938516092 2:132009335-132009357 AGGAAGAAAAGGAGGGAGGAAGG - Intergenic
938557106 2:132435292-132435314 CTGAGGAGAACGAGGAAGGAGGG - Intronic
938971473 2:136437135-136437157 AGGAAGATGGGGAGGGAGGAAGG + Intergenic
939391114 2:141570715-141570737 CTGAAGCCAAGGAGGCTGGACGG + Intronic
940010145 2:149044581-149044603 AGGAAGAGAAGGAGGGAGGGAGG - Intronic
940318241 2:152347161-152347183 CTGAAGAACAAGAGGGAGGGAGG - Intronic
940337907 2:152547690-152547712 AAGAAGAAAAGGAAGGAGGATGG - Intronic
940745210 2:157559966-157559988 AGGAAGAAAAGGAGGGAGGGAGG + Intronic
941115694 2:161469744-161469766 CTGAATAGAAGGAGGGAAAATGG + Intronic
941464971 2:165814663-165814685 AAGGAGAGAAGGAGGGAGGAAGG + Intergenic
941932651 2:170957570-170957592 ATGAAGAAAAGGAAGGAGGCTGG - Intronic
942134839 2:172914552-172914574 AGGAAGAGAGGGAGGGAGGAAGG + Intronic
942288641 2:174447792-174447814 CTAGAGGTGAGGAGGGAGGAAGG + Intronic
942855793 2:180545976-180545998 TTGAAGGTATGGAGTGAGGAAGG + Intergenic
943280641 2:185928450-185928472 AGGAAGAGAAGAAGGGAGGAAGG + Intergenic
943616561 2:190099372-190099394 CTGAAGAGAAGGAGAGAGACAGG + Intronic
943834659 2:192503626-192503648 CTGGAGATAAGGGAGGAAGAAGG + Intergenic
944094056 2:195946722-195946744 GTGAAGAGAAGGAGGAAGGGAGG - Intronic
944454924 2:199883525-199883547 CTCAAGTTAATGAGGGTGGAGGG - Intergenic
944537236 2:200723203-200723225 CTGAAGATAAGAAGAGGGGCTGG - Intergenic
944635254 2:201670119-201670141 ATGGAGAGAGGGAGGGAGGAAGG + Intronic
944640795 2:201723473-201723495 CTGAAGATAAGGATAAAGTAGGG + Intronic
944819326 2:203414003-203414025 CTGAAGAGGATGAGGCAGGAAGG - Intronic
945035055 2:205697465-205697487 CAGAAGAGAAGGAGGGAGTGTGG + Intronic
945588337 2:211695980-211696002 GGGAAGGGAAGGAGGGAGGAAGG - Intronic
946135131 2:217639694-217639716 CGGAAGGAAAGGAAGGAGGAAGG + Intronic
946437426 2:219666691-219666713 CTGAGGCTGAGGTGGGAGGATGG + Intergenic
946730772 2:222707293-222707315 AGGAAGGAAAGGAGGGAGGAAGG + Intronic
946801280 2:223418542-223418564 AGAAAGAAAAGGAGGGAGGAAGG - Intergenic
946860812 2:223998799-223998821 CTTAAGAAAAGGAGGGAGTGGGG + Intronic
946912833 2:224484064-224484086 ATGAGGCTAAGGTGGGAGGATGG + Intronic
947030031 2:225782934-225782956 ATGAAGGGAAGAAGGGAGGAAGG - Intergenic
947077051 2:226355952-226355974 AGGAAGGGAAGGAGGGAGGAAGG + Intergenic
947301998 2:228698033-228698055 CTGAAGACAAAGCAGGAGGAAGG + Intergenic
947537309 2:230948299-230948321 CAGGAGATGGGGAGGGAGGAAGG - Intronic
947541830 2:230985184-230985206 ATGAAGGGAGGGAGGGAGGAGGG + Intergenic
948091917 2:235302138-235302160 AGGAAGAAGAGGAGGGAGGAGGG - Intergenic
948132207 2:235609008-235609030 AAGAAGCTAAGGAGGGAGGAAGG + Intronic
948338254 2:237228336-237228358 CAGGAGAAAAGGAGGGAGTATGG + Intergenic
948807306 2:240458628-240458650 CTGAGGATGGGGAAGGAGGAAGG - Intronic
948995475 2:241576158-241576180 CTGCAGGGAAGGAGGGTGGAGGG - Intergenic
1168754892 20:309660-309682 CTGTGGGTAAGGAGGCAGGAGGG - Intergenic
1168764571 20:373005-373027 CTGAGGATAAAGGGGGAGGTGGG - Intronic
1168790451 20:572555-572577 ATGAAGGTAAGAAGGAAGGATGG - Intergenic
1168974418 20:1953296-1953318 AGGAAGAGAGGGAGGGAGGAAGG + Intergenic
1169178340 20:3539534-3539556 CTGAGCATAAGCAGGGAGGTGGG + Intronic
1169950435 20:11037653-11037675 GTTAAGAGAAGGAGGGAGGGAGG + Intergenic
1170142513 20:13139090-13139112 AGGAGGAGAAGGAGGGAGGATGG - Intronic
1170155438 20:13264876-13264898 CTGATGAGAATGAGGAAGGAGGG + Intronic
1170501836 20:16982510-16982532 AAGAAGAAAAGAAGGGAGGAAGG - Intergenic
1170633915 20:18088464-18088486 AAGGAGAGAAGGAGGGAGGAAGG - Intergenic
1170689144 20:18596441-18596463 GTGAACAGAAGAAGGGAGGAGGG - Intronic
1170957568 20:20995349-20995371 CAGAAGAGAAGGAGGGGGTATGG + Intergenic
1171036986 20:21721956-21721978 CTGAGGTCAAGGTGGGAGGATGG - Intergenic
1171369807 20:24654612-24654634 AGGAAGAGAGGGAGGGAGGAAGG + Intronic
1171456659 20:25276289-25276311 CAGAGGGTAAGGAGGGAGGTGGG + Intronic
1171982799 20:31639114-31639136 CTGGAGTTAGGCAGGGAGGAAGG - Intronic
1172221263 20:33276644-33276666 CTGAAGCTCAGGAGGGAGCTGGG - Intronic
1172813603 20:37669422-37669444 AGGAAGAAAAGGAGGGAGAAAGG - Intergenic
1172974549 20:38896127-38896149 AAGAAGGAAAGGAGGGAGGAAGG - Intronic
1173197167 20:40925110-40925132 CTGGAGAGCAGGAGGGAGGTGGG + Intergenic
1173266225 20:41484839-41484861 CAGAAGATAAAAAGGGAGAAAGG + Intronic
1173614661 20:44394903-44394925 CTAAGGACAGGGAGGGAGGAAGG + Intronic
1173656950 20:44705986-44706008 CTGAAGAGAGGCAGGGAGGGAGG - Intergenic
1173785417 20:45789594-45789616 CTGCAGATAACGAGAGAGAAAGG + Intronic
1174087493 20:48019531-48019553 CTGAGGTTGAGGAGGGAAGAGGG + Intergenic
1174098584 20:48109037-48109059 AGGAAGAGAAGGAGGGAGGGAGG + Intergenic
1174103101 20:48142201-48142223 CTGTGTATGAGGAGGGAGGAGGG - Intergenic
1174140841 20:48412590-48412612 AGGAAGAAAGGGAGGGAGGAAGG - Intergenic
1174346300 20:49932602-49932624 AGGAAGGGAAGGAGGGAGGAAGG + Intergenic
1174354926 20:49991135-49991157 GGGAAGGAAAGGAGGGAGGATGG + Intergenic
1174516853 20:51099138-51099160 CTGCAGAAGGGGAGGGAGGAGGG + Intergenic
1174797693 20:53536157-53536179 CTGCAGAGAAGGACGGAAGAAGG - Intergenic
1174808248 20:53623460-53623482 CTGAGGAGAAGGACGGAGGGTGG + Intergenic
1175100252 20:56574348-56574370 AGGAAGAAAGGGAGGGAGGAAGG - Intergenic
1175238077 20:57526578-57526600 GAAAGGATAAGGAGGGAGGAGGG + Intergenic
1175303749 20:57961474-57961496 TTGGAGATCAGCAGGGAGGAGGG - Intergenic
1175499856 20:59442082-59442104 AGGAAGAGAAGGAGGGAGGGAGG - Intergenic
1175921512 20:62452530-62452552 CTGAGGAGAAGGACTGAGGAGGG - Intergenic
1176087251 20:63303800-63303822 CTGGAGGGAGGGAGGGAGGAAGG - Intronic
1176186406 20:63782321-63782343 CAGCAGAGAAGGAGGCAGGAGGG + Intronic
1176292169 21:5052254-5052276 ATGAAGGGAAGGAGGGAGGGAGG - Intergenic
1176719575 21:10382174-10382196 CAGAAGAGAGGGAGGGAGGGAGG + Intergenic
1176742578 21:10617440-10617462 AGGAAGAAAAGGAGGGAGGAAGG + Intergenic
1176998751 21:15585967-15585989 AAGAAGATAAGAAGGAAGGAAGG + Intergenic
1177670175 21:24214575-24214597 CAAAAGAAAGGGAGGGAGGAAGG + Intergenic
1178083476 21:29089868-29089890 GGGAAGAGAGGGAGGGAGGAAGG + Intronic
1178100537 21:29264054-29264076 CTGAAGAGAGGGAGAGAGGTGGG + Intronic
1178429249 21:32504603-32504625 CTTAAGATAAGCAGAGAGGGTGG - Intronic
1178531817 21:33382268-33382290 AAGAAGAAAGGGAGGGAGGAAGG + Intergenic
1178946063 21:36948622-36948644 GGGAAGATTAGGTGGGAGGATGG + Intronic
1179072885 21:38089482-38089504 TTGAAGATGAAGATGGAGGAAGG + Intronic
1179109457 21:38433899-38433921 CAGAGGATTAGGAAGGAGGATGG - Intronic
1179232299 21:39515776-39515798 ATGATGGTAAGGAGGGATGATGG + Intergenic
1179261659 21:39763437-39763459 GAGATGAAAAGGAGGGAGGAGGG - Intronic
1179276540 21:39897068-39897090 ATGAAGAAAATGAGGGAGGTAGG - Intronic
1179336554 21:40462084-40462106 AGGAAGATAAGGAGGCAGTAGGG + Intronic
1179409730 21:41153491-41153513 AGGAAGAGAGGGAGGGAGGAAGG + Intergenic
1179483242 21:41691893-41691915 CTGAAGAAGAGGATGGATGAGGG + Intergenic
1179563796 21:42234160-42234182 CAGAAGGGAAGGAGGGTGGAGGG + Intronic
1179865090 21:44211400-44211422 ATGAAGGGAAGGAGGGAGGGAGG + Intergenic
1179923088 21:44517763-44517785 CTGGATATCAGGAGGTAGGAGGG - Exonic
1180049308 21:45324120-45324142 CTGAGGGTTGGGAGGGAGGAGGG - Intergenic
1180280444 22:10688669-10688691 CTTACAATAGGGAGGGAGGAAGG + Intergenic
1180300812 22:11035148-11035170 CAGAAGAGAGGGAGGGAGGGAGG + Intergenic
1181681959 22:24501593-24501615 AGGAAGATTAGGTGGGAGGAGGG + Intronic
1181824894 22:25507149-25507171 ATGAATAAAAGGATGGAGGATGG - Intergenic
1181953648 22:26572549-26572571 CCCAAGATAAGGTGGGAAGAGGG - Intronic
1182026553 22:27123707-27123729 CTGAAGAAAGGGAGGCAGAAAGG + Intergenic
1182027576 22:27132593-27132615 AAGAAGAGAAGGAGGGAGGGAGG + Intergenic
1182179514 22:28331709-28331731 TTGAAGGCAAGAAGGGAGGAAGG - Intronic
1182232502 22:28849459-28849481 GGGAAGGGAAGGAGGGAGGAAGG - Intergenic
1182492598 22:30683343-30683365 AGGAAGAGAGGGAGGGAGGAAGG - Intergenic
1182630058 22:31678199-31678221 CTGTGGATAAGGAAGGAGGAGGG + Intronic
1182785920 22:32907553-32907575 CTGAATCTAAGGTGGGAGTAGGG + Intronic
1183194500 22:36344147-36344169 CTGAGGCTCAGGTGGGAGGAAGG + Intronic
1183209726 22:36443396-36443418 GTGAAGGGAGGGAGGGAGGAAGG - Intergenic
1183358236 22:37370611-37370633 GTGGAGAGAGGGAGGGAGGAAGG + Exonic
1183924005 22:41192689-41192711 GGGAAGCTAAGGTGGGAGGATGG + Intergenic
1183924164 22:41193847-41193869 CTCAAAAAAGGGAGGGAGGAAGG + Intergenic
1184276044 22:43410438-43410460 CTAAAGACAAGGAAGCAGGAGGG + Intergenic
1184364360 22:44040486-44040508 CTTATGAGAAGGAGGCAGGAGGG + Intronic
1184730283 22:46367903-46367925 GTGCAGAGAGGGAGGGAGGAAGG - Intronic
1185037054 22:48484871-48484893 AGGAAGAGAAGGAGGGAGGGAGG - Intergenic
1203290053 22_KI270735v1_random:28005-28027 AGGAAGAAAAGGAGGGAGGGAGG - Intergenic
949930833 3:9077230-9077252 CTGAAGCAAAGGAGGGAGGAGGG - Intronic
950018889 3:9772477-9772499 ATCAAGACAAGGAGAGAGGAGGG - Intronic
950167736 3:10814544-10814566 CTGAATTTAAGGAGAGAGAAAGG + Intergenic
950329016 3:12141217-12141239 ATGAAGCAAAGGATGGAGGAAGG - Intronic
950630115 3:14276673-14276695 CTGGAGGTGAGGAAGGAGGAAGG + Intergenic
950635538 3:14311758-14311780 ATGAAGGAAGGGAGGGAGGAAGG - Intergenic
950686918 3:14625133-14625155 AGGAAGAGAGGGAGGGAGGAAGG + Intergenic
950801508 3:15555351-15555373 CTGCAAATATGGAGGGACGAGGG + Intergenic
950875405 3:16266884-16266906 CTGAAGATTAGAAAGCAGGAAGG + Intronic
950944501 3:16930694-16930716 CTTGAGATTAGGAGGGATGATGG - Intronic
951525285 3:23647400-23647422 ATGAAGAAAAGAGGGGAGGAAGG + Intergenic
951615584 3:24539996-24540018 CTGAAGAAAAGGAGGGAAGAGGG - Intergenic
951623438 3:24632877-24632899 ATGAAGCTGAGGTGGGAGGATGG - Intergenic
951778051 3:26332136-26332158 CTGGAGATACTGAGAGAGGAGGG + Intergenic
951909620 3:27736397-27736419 CAGAAGCTAAGGTGGGAAGATGG - Intergenic
952003670 3:28815799-28815821 CTGAAGAGAAGGAGAGAGAGGGG + Intergenic
952089253 3:29864864-29864886 GGGAAGAGAAGGAGGGAGGGAGG + Intronic
952132862 3:30384808-30384830 CTTGAGATGAGGAGGGAGGAGGG - Intergenic
952767284 3:36965260-36965282 GGGAGGACAAGGAGGGAGGATGG + Intergenic
953029149 3:39166135-39166157 CTGAAGAAAAAAAGGGTGGAAGG + Intergenic
953321377 3:41975219-41975241 CTGAAGACAAGGAAGAAAGAGGG - Intergenic
953459593 3:43072010-43072032 ATGAATATAAGAAGGAAGGAAGG - Intergenic
953771317 3:45780296-45780318 CAGAAGGTGAGGAGGGAGGTTGG - Intronic
953903678 3:46857625-46857647 AGGGAGAAAAGGAGGGAGGAAGG + Intergenic
953936494 3:47048690-47048712 CTGGCGAGGAGGAGGGAGGAGGG - Intronic
954365239 3:50142452-50142474 AGGAAGAGAGGGAGGGAGGAAGG - Intergenic
955369131 3:58335903-58335925 GTGAAGAGATGGAGGGAGGAAGG - Intronic
955817424 3:62860388-62860410 CTGCAGATACTGAGGGATGATGG - Intronic
955984266 3:64556749-64556771 AGGAAGAAAGGGAGGGAGGAAGG - Intronic
956695237 3:71913130-71913152 CAGGAGAGAGGGAGGGAGGAAGG + Intergenic
957143583 3:76393611-76393633 CTGTAGATAATGAGGAAGGAAGG + Intronic
957221588 3:77389654-77389676 ATGAAGGAAAGAAGGGAGGAAGG - Intronic
957416935 3:79917465-79917487 GGGAAGAGAAGGAGGGAGGAAGG + Intergenic
957442783 3:80272132-80272154 CTGAAGGAAGGGAGGGAGGGAGG + Intergenic
957502487 3:81075175-81075197 CTGATAACAAGGAGGGATGATGG - Intergenic
958477695 3:94605633-94605655 CAGAGGTTAAGAAGGGAGGAAGG - Intergenic
959841389 3:110980583-110980605 CTGAAGATAGGTTAGGAGGATGG + Intergenic
960650779 3:119946670-119946692 CTGAAGAGAAAGAGGTTGGAAGG + Intronic
960664025 3:120093462-120093484 AGGAAGAAAAGGAGGAAGGAAGG - Exonic
960708505 3:120504593-120504615 CTGAAGGGCAGGAGAGAGGAGGG - Intergenic
960883233 3:122367138-122367160 ATGAAGAGAAGGAGAGAGGGAGG + Intronic
960883238 3:122367161-122367183 GTGAAGAGAAGGAGAGAGGGAGG + Intronic
961205348 3:125077022-125077044 CTGGAGAGAAGGAAGGATGATGG + Intergenic
961254207 3:125533215-125533237 CAGAAGAGAAAGAGGGAGGGAGG - Intronic
961455912 3:127023834-127023856 CTGAAGACCAGGCGGGGGGAGGG + Intronic
961472763 3:127126766-127126788 CTGCAGATAAGAAGGGACTATGG + Intergenic
961879051 3:130047531-130047553 CTTAAGATAAGCAGAGAGGGGGG + Intergenic
962502115 3:136005934-136005956 CAGAAGATAATGGGGGAAGAGGG - Intronic
962767373 3:138578126-138578148 CTGCAGATAAGGAGGGCCAACGG - Intronic
962769691 3:138600905-138600927 AGGAGGAGAAGGAGGGAGGAGGG + Intergenic
962769701 3:138600930-138600952 AGGAGGAGAAGGAGGGAGGAGGG + Intergenic
962912402 3:139864967-139864989 CTGGAGATGAGTAGGCAGGAGGG - Intergenic
963444246 3:145383345-145383367 AAGGAGAAAAGGAGGGAGGAAGG + Intergenic
964429455 3:156589472-156589494 TAGAAGTTAAGAAGGGAGGAAGG + Intergenic
964873616 3:161340709-161340731 AAGAAGAGAAGGAGGGAGGGGGG + Intergenic
965051175 3:163649636-163649658 CTGAAGCCCAGGAGGCAGGAAGG - Intergenic
965211649 3:165797324-165797346 CTGGAGGGAGGGAGGGAGGAAGG - Intronic
965272093 3:166630161-166630183 ATGAAGGTGAGGAGGGAGGGAGG - Intergenic
965857479 3:173105764-173105786 ATGAAGACAGGGAGGGAGGGAGG - Intronic
966024777 3:175263747-175263769 ATGAAGAAAAGAAGGGAGGAAGG + Intronic
966270323 3:178097026-178097048 ATGAAGGGAAGGAGAGAGGAAGG + Intergenic
966317517 3:178664724-178664746 AGGGAGAGAAGGAGGGAGGAAGG + Intronic
966472039 3:180300507-180300529 TAAAAGATAAGGAGAGAGGAGGG + Intergenic
966646605 3:182252512-182252534 CTGGAGAGGTGGAGGGAGGAAGG + Intergenic
966687716 3:182714098-182714120 AGGAAGAGAGGGAGGGAGGAAGG + Intergenic
966695663 3:182788092-182788114 CTTAAAATAAGGAAGAAGGAAGG + Intergenic
966964629 3:184978379-184978401 AAGAAGAGAAGGAGGGAGGGAGG - Intronic
967223738 3:187271819-187271841 GGGAAGACAAGGGGGGAGGAGGG - Intronic
967277981 3:187795318-187795340 AAGAAGAGAAGGAGGGAGGGAGG + Intergenic
967503392 3:190225431-190225453 ATGAAGGGAGGGAGGGAGGAAGG - Intergenic
967568494 3:190999701-190999723 GTGAAGGGAGGGAGGGAGGAAGG + Intergenic
967789451 3:193531341-193531363 AGGAAGAGAGGGAGGGAGGAGGG + Intronic
967800597 3:193654389-193654411 GGGAGGATAAGGTGGGAGGATGG + Intronic
967970693 3:194996930-194996952 CTGAATAAATGAAGGGAGGACGG + Intergenic
968441703 4:627696-627718 TGGCAGAAAAGGAGGGAGGAGGG - Intronic
968543135 4:1178400-1178422 CTGAAGATGAGGGAGGGGGAGGG - Intronic
968686109 4:1959963-1959985 GGGAAGCTAAGGTGGGAGGATGG - Intronic
969032133 4:4223977-4223999 GTGGAGAGAAGGATGGAGGAAGG + Intronic
969051359 4:4375496-4375518 GGGAAGGGAAGGAGGGAGGAAGG - Intronic
969230447 4:5826781-5826803 CTGCAGAGAAGGAGGGAGCCAGG - Intronic
969436500 4:7192301-7192323 CTGGAGAGAGGGAGGGAGGACGG + Intergenic
969449785 4:7266405-7266427 CTGAAAGAAAGAAGGGAGGAGGG - Intronic
969492548 4:7508234-7508256 ATGAAGGTCAGGAGGGAGGGAGG + Intronic
969512311 4:7625744-7625766 AGGAAGAGAAGGAGGGAGGGAGG + Intronic
970123806 4:12787147-12787169 CAGAGGGTAAGGAGGGAGGATGG - Intergenic
970191529 4:13523372-13523394 GTGAAGCTAAAGAGGGATGAGGG - Intergenic
970297135 4:14642126-14642148 CTGGAGATAGGAAGGAAGGAAGG + Intergenic
970689943 4:18611510-18611532 AGGAAGAAAATGAGGGAGGAAGG + Intergenic
970689990 4:18611668-18611690 AGGAAGGGAAGGAGGGAGGAAGG + Intergenic
970690068 4:18611890-18611912 AGGAAGGGAAGGAGGGAGGAAGG + Intergenic
970690154 4:18612128-18612150 AGGAAGGGAAGGAGGGAGGAAGG + Intergenic
970690240 4:18612366-18612388 AGGAAGGGAAGGAGGGAGGAAGG + Intergenic
970728496 4:19075422-19075444 AGGAAGGAAAGGAGGGAGGAGGG + Intergenic
971563103 4:28106268-28106290 GGGAAGGGAAGGAGGGAGGAAGG + Intergenic
971709681 4:30094377-30094399 AGGAAGAAAATGAGGGAGGAAGG + Intergenic
972185574 4:36523876-36523898 AGGAAGAAAGGGAGGGAGGAAGG - Intergenic
972369450 4:38408883-38408905 AGGAAGAAAAGGAGGGAGGGAGG + Intergenic
972383714 4:38543340-38543362 CTGAGGAGAAGGAGGGAGATGGG + Intergenic
972617529 4:40714532-40714554 GTGAGCATAAGGTGGGAGGAGGG + Intergenic
972721964 4:41708807-41708829 CAGGAGCTAAGGAGGAAGGATGG - Intergenic
972734071 4:41823220-41823242 CTGAAGGTAAGGAGGAAAAAAGG + Intergenic
972874621 4:43343445-43343467 ATGAAGGAAAGGAAGGAGGAAGG - Intergenic
972977471 4:44654446-44654468 ATGAAGGTAAGGAGAGAGGGGGG - Intronic
973133210 4:46673966-46673988 CTGAAGAAAACGAGGTAGGCAGG - Intergenic
973754999 4:54065459-54065481 AGGAAGAAAAGGAGGCAGGAAGG + Intronic
974017806 4:56664844-56664866 CAGAAGATGAGTAGTGAGGAAGG + Intronic
974020520 4:56688229-56688251 AGGGAGAGAAGGAGGGAGGAAGG + Intergenic
974333583 4:60510496-60510518 GGGAAGGAAAGGAGGGAGGAAGG + Intergenic
974333598 4:60510539-60510561 GGGAAGGAAAGGAGGGAGGAAGG + Intergenic
975524987 4:75339243-75339265 TGGAAGAAAAGGAGAGAGGAGGG - Intergenic
975682508 4:76890516-76890538 CAGAAGCTGAGGTGGGAGGATGG + Intergenic
975905323 4:79204522-79204544 AGGAAGGGAAGGAGGGAGGAAGG - Intergenic
976085992 4:81407682-81407704 CTGAAGAAAGGGATGGAGGATGG + Intergenic
976284623 4:83359544-83359566 CTTTAGATAAGCAGTGAGGAGGG + Intergenic
976380497 4:84393132-84393154 AAGAAGAGAAGGAGGGAGGAAGG + Intergenic
976909555 4:90284596-90284618 CAGAAGCTAAGATGGGAGGATGG - Intronic
977271828 4:94926124-94926146 AGGAAGAAAAGGAGGGAGGCAGG - Intronic
977427751 4:96890729-96890751 ATGAAGAGAAGGAGAGAGAAAGG - Intergenic
977609874 4:99020613-99020635 CTGAAGCAAGGGATGGAGGAGGG - Intronic
978099801 4:104824198-104824220 CAGAGGGTAGGGAGGGAGGAGGG + Intergenic
978234575 4:106443265-106443287 GAGAAGAGAAGGAGGGAGGGAGG - Intergenic
978718782 4:111879217-111879239 CTGAAGAAAGGAAGGAAGGAAGG - Intergenic
979687257 4:123524529-123524551 AGGAAGGAAAGGAGGGAGGAAGG - Intergenic
979979535 4:127237557-127237579 AGAAAGAAAAGGAGGGAGGAAGG + Intergenic
980221135 4:129917444-129917466 AAGAATATAAGGAGGGAGGATGG + Intergenic
980315682 4:131196778-131196800 CCGAATATAAGCAGAGAGGAAGG - Intergenic
980896495 4:138865595-138865617 ATAAAGAGAAGGAGGAAGGAAGG + Intergenic
981044637 4:140253466-140253488 GTGGGGATAAGGAGGAAGGAGGG + Intergenic
981205908 4:142040117-142040139 GGGAAGAAGAGGAGGGAGGAAGG + Intronic
981352813 4:143752344-143752366 CTGAAGCCAAGGAGGCTGGACGG + Intergenic
981409377 4:144410835-144410857 CTGAAGTTTTGGAGGGAAGAGGG - Intergenic
981413373 4:144458875-144458897 AAGAAGGGAAGGAGGGAGGAAGG + Intergenic
981543337 4:145868794-145868816 CTGACCATAAGGAGGGAGACAGG + Intronic
981732160 4:147910995-147911017 AGGAAGAGGAGGAGGGAGGAAGG - Intronic
981912259 4:149995422-149995444 CGGAAGGAAGGGAGGGAGGAAGG + Intergenic
981950482 4:150400612-150400634 GGGAGGACAAGGAGGGAGGATGG + Intronic
982181732 4:152754028-152754050 GAGAAGCTAAGGTGGGAGGATGG + Intronic
982352689 4:154433223-154433245 CACAAGCCAAGGAGGGAGGAAGG + Intronic
982452604 4:155570796-155570818 CTGGAGGTGGGGAGGGAGGATGG + Intergenic
982460201 4:155660448-155660470 TTGTAGAAAAGGAGGGAAGAAGG - Intergenic
982821476 4:159945208-159945230 CTGAAGATAAGGTAGAAGAAAGG + Intergenic
983594228 4:169448511-169448533 ATGAAGATATGAAGGAAGGAAGG + Intronic
983868169 4:172792845-172792867 ATATAGATAAAGAGGGAGGAAGG - Intronic
983953949 4:173675329-173675351 GAAAAGAAAAGGAGGGAGGAAGG - Intergenic
984215746 4:176910960-176910982 CTGGAGCTAAGGAGGCTGGATGG + Intergenic
984648119 4:182241370-182241392 CTGAACAGAAGAAGGGATGAAGG - Intronic
984687364 4:182685213-182685235 AAGAAGAGAAGGAGGAAGGAAGG - Intronic
984907961 4:184648103-184648125 CTAAAGATAAGGAGGGGTGGGGG + Intronic
984908781 4:184652853-184652875 AAAAAGAAAAGGAGGGAGGAAGG + Intronic
985384085 4:189426809-189426831 CTGAAGATAAGGAAAGTTGAAGG + Intergenic
985773925 5:1830739-1830761 AGGAAGAGAAGGAGGGATGAGGG - Intergenic
986054216 5:4119805-4119827 AGGAAGAAAGGGAGGGAGGAAGG - Intergenic
986398134 5:7351070-7351092 ATTGAGAGAAGGAGGGAGGAGGG - Intergenic
986636008 5:9823438-9823460 AGGAAGAGAGGGAGGGAGGAAGG + Intergenic
986738644 5:10686211-10686233 CTGAAGAGAAGGAGAGAGACAGG - Intronic
987163826 5:15173313-15173335 AGGAAGAGAATGAGGGAGGAAGG + Intergenic
987376831 5:17243454-17243476 CTGAAGTTAAGAAGGTTGGAGGG - Intronic
987445379 5:18011260-18011282 GTGAAGAGAAGAAGGGTGGATGG - Intergenic
988346416 5:30042655-30042677 GTGAAGAGAAGGAGAGAAGAGGG + Intergenic
988699966 5:33663431-33663453 AAGAAAAAAAGGAGGGAGGAAGG + Intronic
988999239 5:36743975-36743997 CTGAAGAATAGCAGGGAGGTTGG - Intergenic
989108203 5:37883130-37883152 ATGAAGAGAGGGAGGAAGGAAGG + Intergenic
989164170 5:38418379-38418401 CAGAACATCAGGAGGGAGGTGGG + Intronic
989437304 5:41429707-41429729 AATATGATAAGGAGGGAGGATGG + Intronic
989440984 5:41471986-41472008 AGGAAGAAAGGGAGGGAGGAAGG - Intronic
990334110 5:54755658-54755680 AGGAAGGGAAGGAGGGAGGAAGG - Intergenic
991379776 5:66007858-66007880 CAGCAGCTAAGGAGGGAGGTGGG + Intronic
991437239 5:66609492-66609514 GTGAGGCTAAGGTGGGAGGATGG - Intronic
991509511 5:67361230-67361252 CTCAAGAGAAGGAGTGAGGATGG - Intergenic
991971247 5:72143789-72143811 GGGAGGCTAAGGAGGGAGGATGG - Intronic
992162648 5:74017651-74017673 CTGAAGATGAGGAGGGGACAAGG - Intergenic
992431263 5:76714053-76714075 AGGAAGAGAGGGAGGGAGGAAGG + Intergenic
992873193 5:81026147-81026169 AGGAAGAGAGGGAGGGAGGAAGG - Intronic
992949548 5:81844811-81844833 AGGAAGAAAAGGAGGGAGGGAGG + Intergenic
993281252 5:85927643-85927665 ATGAAGGTAAGGAGGGAGGGAGG - Intergenic
993322629 5:86492114-86492136 AGGAAGGAAAGGAGGGAGGACGG - Intergenic
993532707 5:89043873-89043895 CTGATGATAAGGAAGGAGGCAGG - Intergenic
993726381 5:91372077-91372099 CTGAAGATAAAGAAGGTGGGAGG - Intronic
994501402 5:100583187-100583209 CTGAAGAGAAGGAGGAAGGAGGG + Intronic
994673669 5:102794231-102794253 CTGAGGTGAAGGAGGGAGGCTGG + Intronic
994737729 5:103576366-103576388 ATGAAGAAAGGAAGGGAGGAAGG + Intergenic
995114249 5:108461232-108461254 CTGGAGAAAAGCAGGTAGGAGGG - Intergenic
995324518 5:110875315-110875337 AGGAAGGAAAGGAGGGAGGAAGG - Intergenic
995499561 5:112789962-112789984 GGGAAGCTGAGGAGGGAGGATGG - Intronic
996188350 5:120507953-120507975 CTGATGTTAAGGAAGAAGGAGGG - Intronic
996486961 5:124047092-124047114 GTGAAGAGAAAGAGAGAGGAGGG + Intergenic
996763834 5:127015361-127015383 GGGAAGATGAGCAGGGAGGAGGG + Intronic
996777794 5:127151681-127151703 CAGAGGATAAGGAGGAAGAAAGG - Intergenic
997577654 5:134994986-134995008 ATGAAGGAAGGGAGGGAGGAAGG - Intronic
998383780 5:141744216-141744238 CAGAAGAGAGGGAGGTAGGATGG + Intergenic
998498732 5:142613892-142613914 CTGTAGTCAAGGTGGGAGGAAGG - Intronic
998985921 5:147756639-147756661 GAGAAGAAAAGGAGGGTGGATGG + Intronic
998989085 5:147795252-147795274 CTGAAGGTGTGGATGGAGGAGGG - Intergenic
999090444 5:148931654-148931676 AGGAAGAGAAGGAGGGAGGGAGG - Intronic
999184757 5:149698825-149698847 AGGAAGGAAAGGAGGGAGGAAGG + Intergenic
999322042 5:150621496-150621518 CTGGAGATCAGGAGGGAAGAAGG + Intronic
1000009882 5:157220961-157220983 CGGAGGCTGAGGAGGGAGGATGG - Intronic
1000132196 5:158310252-158310274 AGCAAGAAAAGGAGGGAGGAAGG - Intergenic
1000145948 5:158453473-158453495 CTGAGGCTTAGGAGGGTGGAGGG + Intergenic
1000920683 5:167133186-167133208 GTTAAGATAAGGAGGGAAGGAGG + Intergenic
1001201350 5:169720449-169720471 AGGAAGAAAGGGAGGGAGGAAGG - Intronic
1001234217 5:170015809-170015831 AAGAAGAAAAGGAGGGAGGGAGG - Intronic
1001234224 5:170015834-170015856 AAGAAGAAAAGGAGGGAGGGAGG - Intronic
1001582027 5:172805436-172805458 AAGAAGATACGGAGGGAGGGAGG + Intergenic
1001690917 5:173631690-173631712 AGGAAGATGAGGTGGGAGGAAGG - Intergenic
1001855568 5:175007605-175007627 AGGAAGAAAAGGAGGGAAGAAGG - Intergenic
1001972474 5:175967781-175967803 GTGGAGATGAGGAGGGAGTAGGG - Intronic
1002244965 5:177875999-177876021 GTGGAGATGAGGAGGGAGTAGGG + Intergenic
1002255420 5:177954751-177954773 AAGAAGAAAGGGAGGGAGGAGGG + Intergenic
1002273191 5:178086389-178086411 CTGGAGATGAGGAGGTAGGCGGG + Intergenic
1002700746 5:181122753-181122775 GGGAGGCTAAGGAGGGAGGACGG - Intergenic
1002850340 6:989559-989581 CAGAAGGCAAGGAGGGAGCAAGG + Intergenic
1003087828 6:3075330-3075352 TGGAAGAAAAGAAGGGAGGAAGG + Intronic
1003476079 6:6484393-6484415 AAGAAGAAAGGGAGGGAGGAAGG + Intergenic
1003550472 6:7098387-7098409 CTGAAGATGTGGAAGGAGGCAGG - Intergenic
1003550529 6:7098684-7098706 CTGAGGGTAAGGAGAGAAGAAGG - Intergenic
1003560500 6:7176020-7176042 CTGGAGCTGAGGTGGGAGGATGG - Intronic
1004163057 6:13231297-13231319 CGAAAGAGAAGGAGGGAGGGAGG + Intronic
1004163074 6:13231426-13231448 CGAAAGAGAAGGAGGGAGGGAGG + Intronic
1004545426 6:16593573-16593595 CTGGAGAGAAGGCAGGAGGATGG - Intronic
1004703200 6:18098373-18098395 CGGAAGCTGAGGTGGGAGGATGG + Intergenic
1004751301 6:18565463-18565485 ATGAAAAAAGGGAGGGAGGATGG - Intergenic
1004761119 6:18667655-18667677 AGGAAGGTAGGGAGGGAGGAAGG - Intergenic
1004761407 6:18670782-18670804 AGGAAGAGAAGGAGGGAGGAAGG - Intergenic
1005735837 6:28745000-28745022 CTGAAGAAATGAATGGAGGAGGG + Intergenic
1005845441 6:29773373-29773395 GGGAAGAGAAGGAGGGAGGGAGG - Intergenic
1006151602 6:31992955-31992977 GGGAAGATAAGGAAGGAGGAAGG + Intronic
1006157903 6:32025693-32025715 GGGAAGATAAGGAAGGAGGAAGG + Intronic
1006187325 6:32188860-32188882 CTGAGAACAAGGAGGGAGGAGGG + Intronic
1006822305 6:36907041-36907063 AGGAAAAGAAGGAGGGAGGAAGG - Intronic
1007226834 6:40321057-40321079 GGGAAGAGAGGGAGGGAGGAGGG + Intergenic
1007377473 6:41466660-41466682 AGGAAGAGAAGGGGGGAGGAAGG + Intergenic
1007730114 6:43940461-43940483 CTGAAGTTAACCAGGGAGGGAGG + Intergenic
1007825413 6:44596191-44596213 CTAAGGATATGGAGGGAGGAAGG - Intergenic
1007915132 6:45554321-45554343 CTGAAGGGAGGGAAGGAGGAGGG + Intronic
1008288421 6:49682839-49682861 AGGAAGAAAAGAAGGGAGGAAGG - Intergenic
1009641541 6:66343427-66343449 CTGCAGATAAGGAAGAAGTAAGG + Intergenic
1010390852 6:75335505-75335527 ATGAAGGGAAGGAGGGAGGGAGG - Intronic
1010725387 6:79327117-79327139 CTGAAAATAAGGAAGTAGCACGG - Intergenic
1010806017 6:80238039-80238061 AGGAAGCGAAGGAGGGAGGAAGG - Intronic
1010917634 6:81640787-81640809 AGGGAGATAAGGATGGAGGAAGG - Intronic
1011001015 6:82588711-82588733 CAGAGGCTAAGGTGGGAGGATGG + Intergenic
1011841196 6:91501085-91501107 AGGAAGGGAAGGAGGGAGGAAGG - Intergenic
1011868473 6:91861837-91861859 CAGAGGCTAAGGGGGGAGGACGG + Intergenic
1011967385 6:93176026-93176048 AGGAAGAGAGGGAGGGAGGAAGG - Intergenic
1012284463 6:97372169-97372191 CTGAAGAGAAGGAGAGAGATGGG - Intergenic
1013271115 6:108546208-108546230 AGGAAGAGAGGGAGGGAGGAAGG - Intergenic
1013308326 6:108870613-108870635 AAGAAGAGAGGGAGGGAGGAAGG + Intronic
1013493842 6:110677952-110677974 CTGAAGCTAAGGCAGGAGGATGG - Intronic
1014226046 6:118848228-118848250 GTGAAGAGAAGAAGGGAGAAAGG + Intronic
1014820393 6:125982791-125982813 CTGAGGAAAAGGAGGATGGATGG - Intergenic
1014821331 6:125991353-125991375 AGGAAGCTAAGGTGGGAGGATGG - Intronic
1015178959 6:130341152-130341174 AGGAAGAGAGGGAGGGAGGAAGG + Intronic
1015349767 6:132203913-132203935 CAGAAGTTAGAGAGGGAGGAAGG - Intergenic
1015364610 6:132384190-132384212 AGGAAGAGAGGGAGGGAGGAAGG - Intronic
1015364620 6:132384225-132384247 AGGAAGAGAGGGAGGGAGGAAGG - Intronic
1015385101 6:132613369-132613391 ATGAGGAAAAGCAGGGAGGAAGG - Intergenic
1015475321 6:133653896-133653918 CTGAAAAAAAGGTAGGAGGAAGG - Intergenic
1015805809 6:137107270-137107292 AGGAAGGAAAGGAGGGAGGAAGG - Intergenic
1015877227 6:137834881-137834903 CGGAAGAGAGGGAGGGAGGGAGG + Intergenic
1016063656 6:139656128-139656150 GGGAAGAAAAGGAGAGAGGAAGG - Intergenic
1016142864 6:140634456-140634478 TGGAAGATAAGAAGGAAGGAAGG - Intergenic
1016547362 6:145239128-145239150 CAGAAAAGAAGGAGGGAGGTAGG - Intergenic
1016827424 6:148401147-148401169 CGGAGGTTAAGGTGGGAGGATGG + Intronic
1017039323 6:150295117-150295139 CTGAAGAGACAAAGGGAGGAAGG + Intergenic
1017059897 6:150472738-150472760 CTAAAGATAAGAAGGTGGGAGGG - Intergenic
1017111027 6:150932801-150932823 AGGAAGAGAGGGAGGGAGGAAGG + Intronic
1017644826 6:156529213-156529235 ATGAAGAAAAGAAGGAAGGATGG + Intergenic
1017698821 6:157047547-157047569 GTGAAGATAAGGTGAGTGGAGGG + Intronic
1017929302 6:158938494-158938516 CAGGTGAAAAGGAGGGAGGAAGG + Intergenic
1017994875 6:159523221-159523243 AGGAAGGAAAGGAGGGAGGAAGG + Intergenic
1018342957 6:162870879-162870901 AACAAGAGAAGGAGGGAGGAAGG - Intronic
1018751444 6:166810073-166810095 CTGAAGACAAGGTGGCAGGATGG + Intronic
1019196627 6:170286973-170286995 GTGAAGAGAGGCAGGGAGGAAGG + Intronic
1019517500 7:1446374-1446396 AGGAAGAGAAGGGGGGAGGAGGG + Intronic
1019684301 7:2372260-2372282 ATGGAGAAAAGGAGGAAGGAAGG + Intronic
1019918933 7:4150636-4150658 CTGAATGTAGGGAGGGAGGCAGG + Intronic
1019928360 7:4207795-4207817 TTGAAGATAAGTTGTGAGGACGG - Intronic
1020050330 7:5077052-5077074 AGGAAGAAAAGGAAGGAGGAAGG - Intergenic
1020065742 7:5187279-5187301 CAGAGGCTAAGGCGGGAGGATGG - Intergenic
1020128913 7:5548785-5548807 AGGAAGGGAAGGAGGGAGGAGGG + Intronic
1020173823 7:5866430-5866452 GGGAAGACAAGGAGGGAAGAAGG + Intergenic
1020314108 7:6892462-6892484 CTTAAGATAAGAAGAGAGGGTGG + Intergenic
1020990082 7:15184795-15184817 AGGAAGAGAGGGAGGGAGGAAGG + Intergenic
1021112428 7:16710584-16710606 CTGAAGGAAAGAAGGAAGGAAGG + Intergenic
1021234451 7:18125095-18125117 TTGATGATGAGGAGGGAGAAAGG + Intronic
1021280259 7:18708282-18708304 ATGGAGAAAAAGAGGGAGGAAGG + Intronic
1021298589 7:18941236-18941258 CTGGAGAGAGGGAGGGAGAAAGG - Intronic
1021324987 7:19255633-19255655 AGGAAGAAAAAGAGGGAGGAAGG - Intergenic
1021352280 7:19609903-19609925 AGGAAGGTCAGGAGGGAGGAAGG - Intergenic
1021626778 7:22601399-22601421 TGGAAGATGGGGAGGGAGGATGG + Intronic
1021818129 7:24468091-24468113 CAGAAGTTAAGGATGGAGGAAGG - Intergenic
1022324388 7:29317877-29317899 CGGAGGCTGAGGAGGGAGGATGG + Intronic
1023288602 7:38645269-38645291 AGGAAGAAAAGGAGGGAGGGAGG - Intergenic
1023353993 7:39349310-39349332 GTGAAGAAAAGGAAGGAAGAAGG - Intronic
1023624643 7:42103759-42103781 CCCAAGATAAGGAGTCAGGATGG + Intronic
1023724906 7:43132799-43132821 AAGAAGAAAAGAAGGGAGGAAGG - Intronic
1024294090 7:47829027-47829049 AGGAAGAAAGGGAGGGAGGAAGG + Intronic
1024633479 7:51268069-51268091 CTGCAGGGCAGGAGGGAGGAAGG - Intronic
1024777396 7:52803509-52803531 CTGAGGATAAGGAAAGGGGATGG - Intergenic
1024805237 7:53131941-53131963 AGGAAGAAAAGGAGGGAGGGAGG - Intergenic
1024859274 7:53818745-53818767 CTGAAGAGGAGGAGGGAGAGGGG - Intergenic
1025307744 7:57879335-57879357 AGGAAGAAAAGGAGGGAGGGTGG - Intergenic
1025321609 7:58100280-58100302 AGGAAGGGAAGGAGGGAGGAAGG + Intergenic
1025607103 7:63047354-63047376 CTGAAGATGGTGAGGGAGGTTGG - Intergenic
1025800433 7:64781785-64781807 CTGAAGAAAATAATGGAGGATGG + Intergenic
1025872668 7:65449359-65449381 CAGAAGAAAGGGAGGGAAGAAGG - Intergenic
1025948593 7:66124519-66124541 AGGAAGGGAAGGAGGGAGGAAGG - Intronic
1026078930 7:67199930-67199952 GAGAAGAGAGGGAGGGAGGATGG + Intronic
1026133124 7:67636739-67636761 AGGGAGATAGGGAGGGAGGAAGG - Intergenic
1026229205 7:68468720-68468742 AAGAAGAGAGGGAGGGAGGAAGG + Intergenic
1026288553 7:68985503-68985525 GGGAAGTCAAGGAGGGAGGATGG - Intergenic
1026588906 7:71679940-71679962 AGGAAGAGAGGGAGGGAGGAAGG - Intronic
1026588959 7:71680095-71680117 AGGAAGAGAGGGAGGGAGGAAGG - Intronic
1026680224 7:72461027-72461049 ATGGAGAGAAGGAAGGAGGAAGG - Intergenic
1026697890 7:72612009-72612031 GAGAAGAGAGGGAGGGAGGATGG - Intronic
1026931038 7:74223119-74223141 CTGGAGAGAGGGAGGGAGGCAGG - Intronic
1026962830 7:74420050-74420072 AAGAAGAGAAGGAGGGAGGGAGG - Intergenic
1027971705 7:85091184-85091206 AGGAAGAGAAGGAGGGAGGGAGG + Intronic
1028051537 7:86193946-86193968 GTGAAGAGAAGGAGGGAGGAAGG + Intergenic
1028285189 7:88987969-88987991 GAGAAGAAAAGGAAGGAGGAGGG - Intronic
1028403206 7:90446780-90446802 CTAAAGTTAAGAAGGAAGGAAGG - Intronic
1028420424 7:90626698-90626720 CAGAGGCTAAGGTGGGAGGATGG + Intronic
1028698311 7:93744214-93744236 GTGAAGATCAGGAGGAAGGAAGG + Intronic
1028714518 7:93948988-93949010 AGGGAGATAAGGAGGGAGGGAGG + Intergenic
1028924740 7:96345572-96345594 AAGAAGAGAGGGAGGGAGGAAGG + Intergenic
1029084929 7:98004012-98004034 GGGAAGAGAAGGAGGGAAGAAGG - Intergenic
1029188456 7:98755579-98755601 CTGTAGTTCAGGAGGAAGGAGGG + Intergenic
1029453352 7:100655176-100655198 AGGAAGAAAAGGAGGGAGAAAGG + Intronic
1029459112 7:100685327-100685349 CCGAAGGTAGGAAGGGAGGATGG - Exonic
1029600620 7:101561248-101561270 ATGAAGGAAAGGAGGAAGGAAGG - Intergenic
1030014200 7:105201975-105201997 ATGAAGAGTAAGAGGGAGGATGG + Intronic
1030235994 7:107262715-107262737 CTGAGAATAAGGAGGAGGGAAGG - Intronic
1030497255 7:110315468-110315490 AGGAAGAGAAGGAGGGAGGAAGG + Intergenic
1030552285 7:110977676-110977698 AGGAAGAAAAGGAGGGAGGGAGG - Intronic
1030826996 7:114170301-114170323 CTGAAGAGAAGGAGAGAGACAGG - Intronic
1031419212 7:121529622-121529644 AAGAAGAGAGGGAGGGAGGAAGG - Intergenic
1031630166 7:124034298-124034320 AAGGAGATAAAGAGGGAGGAAGG - Intergenic
1031890340 7:127287002-127287024 CTTAAGAGAAGGGGGAAGGAAGG - Intergenic
1031989282 7:128186447-128186469 AGGAAGAGAAGAAGGGAGGAAGG - Intergenic
1032034944 7:128514768-128514790 AGGAAGAGAAGGAGGGAGGGAGG - Intergenic
1032284271 7:130528947-130528969 ATGAAGGACAGGAGGGAGGATGG + Intronic
1032345331 7:131110846-131110868 CTGAAGATGAGGAGAGAAGCGGG - Intronic
1032449556 7:132018121-132018143 CAGAAGTAAAGGAGGGAGGGAGG - Intergenic
1033250176 7:139751962-139751984 AAGAAGAAAAGGAGGGAGGAAGG + Intronic
1033386184 7:140878588-140878610 GGGAAGAAAAGGAGGGAGAAAGG + Intronic
1033609851 7:142954544-142954566 CTGGAGAGAAGCAGGGAGCATGG + Intronic
1033789386 7:144773271-144773293 CTGAAGAAAGGGATGGAGGGAGG + Intronic
1033845932 7:145432151-145432173 CTGAGGAGAAGGAGAGATGAGGG + Intergenic
1034194054 7:149232496-149232518 CGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1034855783 7:154545424-154545446 ATGAAGAAAAGGAGGGAGGGAGG - Intronic
1035225034 7:157428156-157428178 CTGCAGTTGAGGAGGGAGGAGGG + Intergenic
1035917325 8:3638816-3638838 CTGGAGACAAGGTGTGAGGAAGG - Intronic
1035985118 8:4420904-4420926 CAAAAGACAGGGAGGGAGGAGGG - Intronic
1036028087 8:4933185-4933207 CAGAAGAGAGGGAGGGAGCAAGG - Intronic
1037018073 8:13933194-13933216 CAGAAGATGTGGTGGGAGGAAGG - Intergenic
1037045709 8:14300361-14300383 AGGAAGAGAGGGAGGGAGGAAGG + Intronic
1037247773 8:16856255-16856277 CAGGAGATCAGGAGGGAGAAGGG + Intergenic
1037506828 8:19538933-19538955 CAGAAGAGAAGGAGCCAGGAGGG - Intronic
1037586569 8:20280773-20280795 CTGGATCTAAGGAGGAAGGATGG - Intronic
1037715128 8:21391218-21391240 CTGAATATGAGCAGAGAGGAGGG - Intergenic
1037804813 8:22053397-22053419 CTGAAGAAAAGGAAGGATGAGGG - Intronic
1037837964 8:22225378-22225400 AGGAAGCTGAGGAGGGAGGATGG + Intronic
1038001591 8:23396376-23396398 GGGAAGGGAAGGAGGGAGGAAGG + Intronic
1038047248 8:23775893-23775915 CTCAAAATAAGGATGGAGGTGGG + Intergenic
1038047573 8:23778998-23779020 CTTCAGATAAAGAGGGACGACGG + Intergenic
1038284697 8:26196501-26196523 CTGGAGATGGGGCGGGAGGAGGG - Intergenic
1038476935 8:27875202-27875224 GTGAAGAGAGGGAGGGAGGGAGG - Intronic
1038666802 8:29544468-29544490 AAGAAGATAAGGATGGAGGCAGG - Intergenic
1039261857 8:35780455-35780477 CCGAGGAAAAGGATGGAGGAAGG + Intronic
1039737542 8:40348642-40348664 GTGATGAGAAAGAGGGAGGAAGG - Intergenic
1040641543 8:49340195-49340217 CTTAAGATAATAAGGGAGTAAGG - Intergenic
1040931369 8:52738655-52738677 AGGAAGAAAGGGAGGGAGGAAGG - Intronic
1041506305 8:58601857-58601879 CTGCAGTTTAGGAAGGAGGAGGG - Intronic
1041802317 8:61813488-61813510 AAGAAGGGAAGGAGGGAGGAAGG - Intergenic
1041807258 8:61865544-61865566 CTGAAGACCAGAAGGGAGAAGGG + Intergenic
1041935140 8:63324931-63324953 CTGAAGCTAAATAGGAAGGATGG - Intergenic
1042086869 8:65119099-65119121 CTGAAGGTAAGAATGAAGGAGGG + Intergenic
1042117890 8:65452123-65452145 TAGAATAAAAGGAGGGAGGAAGG - Intergenic
1042820052 8:72920536-72920558 CTGAGGCTGAGGTGGGAGGATGG + Intronic
1043014178 8:74917906-74917928 AAGAAGAGAGGGAGGGAGGAAGG + Intergenic
1043655386 8:82658819-82658841 ATGAAGAAAAAGAGGGAGAATGG - Intergenic
1043667436 8:82833709-82833731 GGGAGGCTAAGGAGGGAGGATGG + Intergenic
1044253199 8:90028688-90028710 AGGAAGGGAAGGAGGGAGGAAGG - Intronic
1044586029 8:93869807-93869829 CTGAAGGGAAGAAGGGAGAAGGG - Intronic
1045369255 8:101505186-101505208 ATGAAGAAAAGGATGGGGGAGGG - Intronic
1045467404 8:102483254-102483276 AAGAAGAAAAGGAGGGAGGGAGG - Intergenic
1045663752 8:104465311-104465333 ATGGAGAGAAGGAGGGAGGGAGG + Intronic
1046657572 8:116912325-116912347 GTGAAGTAAAGAAGGGAGGAGGG + Intergenic
1046719966 8:117608388-117608410 AGGAAGAGAGGGAGGGAGGAAGG - Intergenic
1046958172 8:120083036-120083058 CTTAGGAAAGGGAGGGAGGAAGG + Intronic
1047130124 8:122009413-122009435 AGGAAGGTAAGGAGGGAGGGAGG - Intergenic
1047192812 8:122693676-122693698 CTGAACATAGAGAGGCAGGAAGG + Intergenic
1047487646 8:125346331-125346353 CTCAAGATAAAGATGGAGAATGG + Intronic
1047629494 8:126691729-126691751 CTGAAGAAAGGTAGGGAGCAAGG - Intergenic
1047797871 8:128276623-128276645 AGGAAGATAAGAAGGGAGGGAGG - Intergenic
1048147873 8:131863125-131863147 ATCAAGATCAGGAGGTAGGAAGG - Intergenic
1048151251 8:131896967-131896989 AGGAAGAGAGGGAGGGAGGAAGG - Intergenic
1048192724 8:132304944-132304966 CTGAAGGAAAGGAGGAAGGAAGG + Intronic
1048619080 8:136111682-136111704 TAGAAGATGAGGTGGGAGGAGGG + Intergenic
1048690358 8:136955876-136955898 GGGAAGAAAGGGAGGGAGGAAGG - Intergenic
1048761937 8:137804902-137804924 CTGAAGGAAAGGAGGAAGGAAGG + Intergenic
1048904108 8:139070724-139070746 AGGAAGGAAAGGAGGGAGGAAGG - Intergenic
1048989605 8:139753431-139753453 GTGAATAAAGGGAGGGAGGAAGG - Intronic
1049012898 8:139899455-139899477 GTGAAGATAAGGATGAAGGATGG - Intronic
1049169214 8:141148234-141148256 CTGGTGGAAAGGAGGGAGGAGGG + Intronic
1049406731 8:142454962-142454984 ATGCAGGGAAGGAGGGAGGAGGG - Intronic
1049467588 8:142759121-142759143 CTGAATTCCAGGAGGGAGGAGGG - Intergenic
1049488685 8:142879635-142879657 CTGCAGATCTGGAGGGAGCAGGG - Exonic
1049493584 8:142917662-142917684 CTGCAGATCTGGAGGGAGCAGGG - Exonic
1049807108 8:144546074-144546096 CTGAGGGTGAGGCGGGAGGAAGG + Intronic
1050008876 9:1164322-1164344 ATGAAAAAAGGGAGGGAGGAAGG - Intergenic
1050043261 9:1517565-1517587 CTCAACTTAATGAGGGAGGAAGG - Intergenic
1050204017 9:3178607-3178629 GGGAAGCTGAGGAGGGAGGATGG + Intergenic
1050396643 9:5204886-5204908 CGGAAGATATGCAGGGAAGACGG + Intergenic
1050437704 9:5628181-5628203 CTGAATAGAAGGAGGGTTGAGGG - Intergenic
1050827013 9:9959586-9959608 CTGAAGAGAATGAGGTAGAAAGG + Intronic
1051165046 9:14252940-14252962 AGGAAGGAAAGGAGGGAGGAAGG + Intronic
1051328558 9:15999320-15999342 AAGAAAAGAAGGAGGGAGGAAGG + Intronic
1053027720 9:34744207-34744229 CTGAAGATAACGATGGACCATGG + Intergenic
1053184985 9:36008493-36008515 CAGAGGCTGAGGAGGGAGGATGG - Intergenic
1053417054 9:37953475-37953497 CTGATGGTAATGATGGAGGAAGG + Intronic
1053568762 9:39281847-39281869 GTGAAGATAAGGAATGGGGAGGG - Intronic
1053834731 9:42122878-42122900 GTGAAGATAAGGAATGGGGAGGG - Intronic
1054090397 9:60840812-60840834 GTGAAGATAAGGAATGGGGAGGG - Intergenic
1054111808 9:61116369-61116391 GTGAAGATAAGGAATGGGGAGGG - Intergenic
1054128382 9:61337160-61337182 GTGAAGATAAGGAATGGGGAGGG + Intergenic
1054406563 9:64768036-64768058 CTTATAATAGGGAGGGAGGAAGG + Intergenic
1054440193 9:65253509-65253531 CTTATAATAGGGAGGGAGGAAGG + Intergenic
1054490212 9:65768430-65768452 CTTATAATAGGGAGGGAGGAAGG - Intergenic
1054595808 9:67064650-67064672 GTGAAGATAAGGAATGGGGAGGG + Intergenic
1054851307 9:69849308-69849330 ATGAAGTAAGGGAGGGAGGAAGG + Intronic
1054924424 9:70575182-70575204 TTTAAAATGAGGAGGGAGGATGG - Intronic
1055103883 9:72492854-72492876 AGGAAGGTAGGGAGGGAGGAAGG - Intergenic
1055356993 9:75447936-75447958 GAGAAGAGAAGGAGGGAGGATGG - Intergenic
1056086458 9:83154407-83154429 CTGAAAATAAGGACTGTGGATGG - Intergenic
1056120169 9:83479618-83479640 CTGAAGAAAGGAAGGAAGGAAGG + Intronic
1056245909 9:84695125-84695147 CTATCTATAAGGAGGGAGGATGG + Intronic
1056507592 9:87271614-87271636 CTGAAGACACGGAGTGAAGAAGG - Intergenic
1056684527 9:88748639-88748661 CTGAAGGCAAAGAGGGAGGCTGG + Intergenic
1056998444 9:91485466-91485488 CTGAGGAGAAGGAAGGAGTATGG - Intergenic
1057108749 9:92446887-92446909 ATGAAGAAAAGGAGGGAAAAAGG + Intronic
1057138227 9:92710130-92710152 CAGAAGATGAGGATGGGGGAGGG + Intergenic
1057519769 9:95751741-95751763 CGGGAGGTAGGGAGGGAGGAAGG + Intergenic
1057752357 9:97803243-97803265 CGGAAGAGAAGGAGGGAGGGAGG + Intergenic
1057848389 9:98544025-98544047 AAGAAGAGAAGGAGGGAGGGAGG - Intronic
1058022132 9:100099899-100099921 CTGAAGCAAAGGCGGGAGCAGGG - Intronic
1058268952 9:102944981-102945003 CTTAAGAAAAGGAAGGAGGTGGG - Intergenic
1058412147 9:104745979-104746001 CTGAGGCTGAGGAGGGAAGAAGG - Intergenic
1058643311 9:107107854-107107876 CAAAAGCAAAGGAGGGAGGAAGG + Intergenic
1058732324 9:107862163-107862185 CTAGAGATTGGGAGGGAGGAGGG - Intergenic
1058793198 9:108471536-108471558 CTGAGGCTAAGGCAGGAGGATGG + Intergenic
1058909334 9:109506547-109506569 AGGAAGGAAAGGAGGGAGGAAGG - Intergenic
1059108410 9:111531784-111531806 ATGAGGCTGAGGAGGGAGGATGG - Intronic
1059174405 9:112155930-112155952 AGGAAGAGAAGGAGGAAGGATGG + Intronic
1059351103 9:113665654-113665676 CTGAAGAAAAAGAGAGAGGATGG - Intergenic
1059507526 9:114813347-114813369 CTGAAGATAATGAGGGGCGTGGG + Intergenic
1059638196 9:116191019-116191041 AGGAAGGGAAGGAGGGAGGAAGG + Intronic
1059675819 9:116538173-116538195 AAGAAGAAAGGGAGGGAGGAAGG + Intronic
1059873416 9:118603502-118603524 CAGAAGATAAAGACAGAGGATGG - Intergenic
1059994022 9:119892346-119892368 AGGAAGAGAGGGAGGGAGGAAGG + Intergenic
1060273405 9:122164188-122164210 TGGAAGAGAAGGAGGGAGAAAGG + Intronic
1060446138 9:123690027-123690049 GGGAAGAAAAGGAGGGAAGAAGG + Intronic
1060454195 9:123775393-123775415 CTGAAAGGAAGGGGGGAGGAGGG + Intronic
1060679885 9:125553119-125553141 TGGAAGATGAGGAGTGAGGAGGG - Intronic
1060860309 9:126948631-126948653 CTGAAGCTGAGGAGGCAGAAGGG - Intronic
1061313244 9:129777616-129777638 GGGAAGAGGAGGAGGGAGGAGGG - Intergenic
1061416542 9:130450364-130450386 ATGGAGGGAAGGAGGGAGGAAGG - Intronic
1061808639 9:133149776-133149798 GGGAAGACAAGGAGGGAGGTGGG - Intergenic
1061980421 9:134100087-134100109 TTGAAGATATGGATGGAGGAAGG - Intergenic
1062143959 9:134978790-134978812 AAGGAGAGAAGGAGGGAGGAAGG + Intergenic
1062143966 9:134978817-134978839 AAGGAGAGAAGGAGGGAGGAAGG + Intergenic
1062144003 9:134978929-134978951 AAGGAGAGAAGGAGGGAGGAAGG + Intergenic
1062453000 9:136623348-136623370 CTGGAGAGAAGGAAGGAGAAAGG - Intergenic
1062469776 9:136697167-136697189 GTTGAGATAAGGATGGAGGAAGG - Intergenic
1062670276 9:137704804-137704826 AGGAAGAAAAGGAGGGAGGGAGG - Intronic
1203581748 Un_KI270746v1:13153-13175 AGGAAGAAAAGGAGGGAGGGAGG + Intergenic
1185593066 X:1291427-1291449 ATGAAGAAAAAGAGGAAGGAAGG - Intronic
1185700791 X:2228382-2228404 ATGAAGGGAGGGAGGGAGGAAGG + Intronic
1185827033 X:3261343-3261365 CTGCAGACCAGGAAGGAGGAAGG + Intergenic
1185843694 X:3417197-3417219 AGGAAGAGATGGAGGGAGGAAGG - Intergenic
1186145651 X:6621680-6621702 GTGAAGAAAAGAAGGAAGGAGGG + Intergenic
1186303421 X:8227137-8227159 ATGAAGGAGAGGAGGGAGGAAGG - Intergenic
1186833536 X:13415080-13415102 CAGAAGATAACGAAGGAGGCTGG - Intergenic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1187452671 X:19412585-19412607 CTGAAGAGAAAGAGGAAGGGAGG + Intronic
1187472616 X:19582445-19582467 CTGAAGATACCGAGGAAGGAGGG - Intronic
1187552955 X:20324201-20324223 GAGAAGAGAAGGAGGGAGGGAGG - Intergenic
1187724929 X:22192548-22192570 CGGAACAGAAGGAGGGAGGAAGG - Intronic
1187731942 X:22264282-22264304 CTGGAGAATGGGAGGGAGGATGG - Intergenic
1188705699 X:33326856-33326878 CAGGAGATATGGAGGGGGGATGG + Intronic
1188894025 X:35644150-35644172 TTGAAGAAAAGGAGGTTGGAAGG - Intergenic
1189110798 X:38286734-38286756 AAGAAGAGAAGGAGGGAGAAGGG - Exonic
1189378734 X:40486281-40486303 CTGAAGAAAAAGAGGAAAGAAGG - Intergenic
1189504298 X:41595495-41595517 CTCAAGATGGGGAGGTAGGAGGG + Intronic
1189652419 X:43204164-43204186 ATGAAGAAAAGCAGGGAGCAGGG - Intergenic
1190217558 X:48490050-48490072 CTGAGGAAAAGGAGGGAGCCGGG + Intergenic
1190534175 X:51409101-51409123 CTGGAGAAAAGGAGGGGTGATGG + Intergenic
1190780555 X:53590595-53590617 CTCAAGCTAAAGAGAGAGGAAGG + Intronic
1191054984 X:56232309-56232331 CTGAGAAGGAGGAGGGAGGAAGG - Intergenic
1192183153 X:68928929-68928951 CAGGAGGAAAGGAGGGAGGAAGG + Intergenic
1192424999 X:71067800-71067822 CTGAAGGAAGGGAGGGAGGATGG - Intronic
1192799903 X:74455976-74455998 CTGAAGAGAAGGAAGAAGCAAGG + Intronic
1192806104 X:74510810-74510832 GGGAGGCTAAGGAGGGAGGACGG + Intronic
1192908611 X:75579247-75579269 CTGAAGTTATGGAGGGGTGATGG + Intergenic
1193217976 X:78887024-78887046 CTGAAAAAAAGGTGGGGGGAGGG + Intergenic
1193396129 X:80985672-80985694 CTGAGGAGAGGGAGGGAGAAGGG + Intergenic
1193516985 X:82478261-82478283 CTGAGGATCTGGAGGGAGGCAGG - Intergenic
1194100497 X:89697336-89697358 CTGAAAAGAGGGAGGGAGAAGGG + Intergenic
1194256234 X:91638293-91638315 ATGAAAATAAGGGGGGAGGGAGG - Intergenic
1194536258 X:95108532-95108554 CTGATGATGAGGAGGAAGGAGGG - Intergenic
1195196877 X:102506525-102506547 AAGAAGAAAAGGAGGAAGGAAGG - Intergenic
1195255114 X:103082485-103082507 TTGAAGAAAAAGGGGGAGGAGGG - Intronic
1195428955 X:104766426-104766448 AAGAAGAGAGGGAGGGAGGAAGG - Intronic
1195534154 X:105992057-105992079 AGGAAGGAAAGGAGGGAGGAAGG - Intergenic
1195684084 X:107570162-107570184 AGGAAGGGAAGGAGGGAGGAAGG + Intronic
1196322403 X:114356704-114356726 CAGAAGAAAAGGAGGGAAAAAGG + Intergenic
1196830091 X:119768971-119768993 ATGAAGGGAAGGAGGGAAGATGG - Intergenic
1196929146 X:120663617-120663639 TAGAAGAAAAGGAGGGAGGGAGG - Intergenic
1197098394 X:122622427-122622449 CTGAAGGTGAGGAGGGAGGCGGG + Intergenic
1197507524 X:127325497-127325519 AGGAAGGAAAGGAGGGAGGAAGG + Intergenic
1197734370 X:129839868-129839890 TTGAAGATAGGGCTGGAGGAGGG - Intronic
1198041741 X:132859699-132859721 ATGAAGAAAAGAAGGCAGGAAGG + Intronic
1198080133 X:133231869-133231891 AAAAAGAGAAGGAGGGAGGAAGG + Intergenic
1198112062 X:133510366-133510388 AGGGAGAAAAGGAGGGAGGAAGG - Intergenic
1198321584 X:135522370-135522392 CAGGAGAAAAGTAGGGAGGACGG + Intronic
1199084381 X:143611843-143611865 ATGAAGATAGTGAGGGAGAAAGG - Intergenic
1199193840 X:145003745-145003767 CTGAAGATGGAGAAGGAGGAGGG + Intergenic
1199871718 X:151904388-151904410 CTGATGGTGGGGAGGGAGGAAGG - Intergenic
1200453452 Y:3358398-3358420 CTGAAAAGAGGGAGGGAGAAGGG + Intergenic
1200574963 Y:4877577-4877599 ATGAAAATAAGGGGGGAGGGAGG - Intergenic
1200953689 Y:8924914-8924936 AGGAAGAGAAGGAGGGAGGGAGG - Intergenic
1201194323 Y:11476740-11476762 CTTAAAATAGGGAGGGAGGAAGG + Intergenic
1201256398 Y:12112259-12112281 AGGAAGAGAGGGAGGGAGGAAGG - Intergenic
1201438682 Y:13985729-13985751 CTGATGGTGAGGAGGGAGGGAGG - Intergenic
1201445891 Y:14056979-14057001 CTGATGGTGAGGAGGGAGGGAGG + Intergenic
1201469983 Y:14322535-14322557 AGGAAGAGAGGGAGGGAGGAAGG - Intergenic
1201509591 Y:14744245-14744267 CAGAAGATAAAGAGTGAGGATGG + Intronic
1201517636 Y:14835316-14835338 AAGAAGGGAAGGAGGGAGGAAGG + Intronic
1201550124 Y:15210478-15210500 AGGAAGAAAAGAAGGGAGGAAGG + Intergenic
1201628208 Y:16038933-16038955 CGGAAGAAAAAGAGGGAGCAGGG + Intergenic
1202196286 Y:22301102-22301124 CAGAAGAAAAGAAGGAAGGATGG + Intergenic
1202234150 Y:22690710-22690732 AGGAAGAAAGGGAGGGAGGAAGG + Intergenic
1202309008 Y:23505456-23505478 AGGAAGAAAGGGAGGGAGGAAGG - Intergenic
1202561792 Y:26165132-26165154 AGGAAGAAAGGGAGGGAGGAAGG + Intergenic