ID: 1085069955

View in Genome Browser
Species Human (GRCh38)
Location 11:73534980-73535002
Sequence GTTGGAGGCCTGGCTGCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 434
Summary {0: 1, 1: 0, 2: 4, 3: 41, 4: 388}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085069955_1085069964 30 Left 1085069955 11:73534980-73535002 CCACAGGCAGCCAGGCCTCCAAC 0: 1
1: 0
2: 4
3: 41
4: 388
Right 1085069964 11:73535033-73535055 GAGAATCTGACCAGCCCTAGTGG 0: 1
1: 0
2: 1
3: 19
4: 141
1085069955_1085069961 -2 Left 1085069955 11:73534980-73535002 CCACAGGCAGCCAGGCCTCCAAC 0: 1
1: 0
2: 4
3: 41
4: 388
Right 1085069961 11:73535001-73535023 ACTTGTAGGAAGGAGACTAGAGG 0: 1
1: 0
2: 0
3: 7
4: 137
1085069955_1085069962 8 Left 1085069955 11:73534980-73535002 CCACAGGCAGCCAGGCCTCCAAC 0: 1
1: 0
2: 4
3: 41
4: 388
Right 1085069962 11:73535011-73535033 AGGAGACTAGAGGATTCTTCCGG 0: 1
1: 0
2: 1
3: 12
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085069955 Original CRISPR GTTGGAGGCCTGGCTGCCTG TGG (reversed) Intronic