ID: 1085072448

View in Genome Browser
Species Human (GRCh38)
Location 11:73559709-73559731
Sequence AGATGGTTGTTGCACAACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 124}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085072448 Original CRISPR AGATGGTTGTTGCACAACAC TGG Intronic
901855321 1:12040902-12040924 AGCTGTGTGTTGCAGAACACTGG + Intergenic
904720760 1:32506707-32506729 TGATGATTGTTGCTCAAGACTGG - Intronic
904950317 1:34232942-34232964 AGCTGGTTCTAGCACATCACTGG + Intergenic
911572941 1:99539819-99539841 AGTTGATTGTTGAACAACATGGG - Intergenic
915893541 1:159793336-159793358 AGATGTTTGTTGCAGCACATTGG + Intergenic
916400348 1:164440930-164440952 AGAAGGCTGTTGCAGAAAACTGG - Intergenic
921299714 1:213739035-213739057 AGTTGACTGTTGAACAACACGGG + Intergenic
922825558 1:228515159-228515181 AGGTGGTGGTTGCAAAACATTGG + Intergenic
923961247 1:239085857-239085879 GGATGGTTGTTGGACAGCAATGG - Intergenic
1067542957 10:47169700-47169722 AGATGTTGGTTTCACAATACTGG + Intergenic
1067954628 10:50778156-50778178 AGACTGTTGTTCAACAACACTGG + Intronic
1068779031 10:60899626-60899648 AGATGGTTGATGAATAATACTGG - Intronic
1081548740 11:44092924-44092946 AGTTGATTCTTGAACAACACAGG - Intergenic
1085072448 11:73559709-73559731 AGATGGTTGTTGCACAACACTGG + Intronic
1086619114 11:88863825-88863847 AGCTGGTTCCAGCACAACACTGG + Intronic
1086964518 11:93014002-93014024 AGGTGGTGGTTGTACAACATTGG - Intergenic
1088903200 11:114134049-114134071 AGCTGGTTGTGTCTCAACACTGG + Intronic
1090063508 11:123484139-123484161 AGATGTTTGGTGCACAGCACAGG - Intergenic
1090228307 11:125084745-125084767 AGATGGTTGTTGCAGACCTCAGG + Intronic
1091071032 11:132563526-132563548 AGGTGGTGGTTGCCCAACACTGG + Intronic
1091384115 12:81415-81437 AGAAGGTTGTTACACAGCCCAGG + Intronic
1093709109 12:22309294-22309316 AGATGGATGTTGGACATCAGTGG - Intronic
1097885101 12:64721143-64721165 AGGTGGTTTTTGGCCAACACAGG - Intronic
1099331313 12:81292341-81292363 AGGTGGCTCTTGAACAACACAGG + Intronic
1099519908 12:83647991-83648013 AGTTGGCTCTTGAACAACACAGG + Intergenic
1099949699 12:89288097-89288119 AAATTGCTGTTGCACATCACAGG + Intergenic
1105066615 12:133206189-133206211 AAATGGTTGTTTCCCAAGACAGG + Intergenic
1108058090 13:46505178-46505200 AGCTGCGTGTTGCACTACACCGG + Intergenic
1109557621 13:64000793-64000815 AGGTGGTTATTACACAACCCCGG + Intergenic
1109644947 13:65241756-65241778 AGATGGGTGCAGCACATCACAGG + Intergenic
1116537658 14:46055326-46055348 AGTTGATTTTTGAACAACACAGG - Intergenic
1117546912 14:56800701-56800723 AAATGGTTCTAGCACAACATTGG - Exonic
1117833999 14:59783165-59783187 AGAGGGGTGTAGCACAACATAGG - Intronic
1122716439 14:103699362-103699384 ACCTGGTTGATGCACAGCACAGG + Exonic
1124403475 15:29372116-29372138 AGTTGGTTCTTGAACAACACAGG + Intronic
1125008691 15:34846705-34846727 AGATGATGGTTGCACAACATCGG - Intergenic
1130746863 15:86663576-86663598 AGGCTGTTGTTGCACAATACTGG + Intronic
1132102049 15:99030790-99030812 AGAACGTTGCTGTACAACACTGG + Intergenic
1134859164 16:17545694-17545716 AGGGGGTAGCTGCACAACACTGG - Intergenic
1141329440 16:83095629-83095651 ATATGGTAGATGCTCAACACAGG + Intronic
1142004800 16:87684589-87684611 AGAAGGTTCTAGAACAACACTGG - Intronic
1146501467 17:33368512-33368534 AGATGGTTGTCTTACACCACTGG + Intronic
1150189492 17:63223181-63223203 AGGTGATGGTTGCACAACATTGG + Intronic
1150813614 17:68376027-68376049 ATGTGGTCGTTGCACAACATTGG - Intronic
1152666939 17:81576300-81576322 AGTTGGCCGTTGCACAACGCGGG + Intronic
1162067262 19:8133368-8133390 TGGTGGTTTTTGCACAACATTGG + Intronic
1162236986 19:9317171-9317193 AGAGGGTTGTTCCATAACAAGGG + Intergenic
1163279771 19:16308546-16308568 AGGTAGTGGCTGCACAACACTGG + Intergenic
1166616972 19:44258679-44258701 AGTTGGCTCTTGAACAACACAGG + Intronic
928236985 2:29551926-29551948 TGATGATAGTTGCACAACATTGG - Intronic
931917649 2:66975711-66975733 AGGTGGTAGTTGTACAACACTGG + Intergenic
932099757 2:68887723-68887745 TGATGATGGTTGCACAACCCTGG + Intergenic
939280273 2:140055105-140055127 AGTTGATTGTTGAACAACGCAGG + Intergenic
948247620 2:236499614-236499636 AGATGGGGGTTTCACCACACTGG + Intronic
1169712629 20:8581903-8581925 AATTGGTTCTCGCACAACACTGG - Intronic
1171430589 20:25081376-25081398 AGATGGTTGTTGAAGACCCCAGG + Intronic
1172311759 20:33923808-33923830 AGCTGACTCTTGCACAACACAGG + Intergenic
1172411599 20:34727909-34727931 AGATGGGGGTTTCACCACACTGG + Intronic
1173050471 20:39554950-39554972 TGATGATTGTGGTACAACACTGG + Intergenic
1173053325 20:39586631-39586653 AGATGTTTGTTCTAAAACACTGG - Intergenic
1173688796 20:44942894-44942916 ACATGGTTGTTGCACCAGAAAGG - Exonic
1174096718 20:48095717-48095739 TGGTGGTGGTTGCACAACAATGG + Intergenic
1174943182 20:54955169-54955191 AGATGACTCTTGAACAACACAGG - Intergenic
1175528528 20:59655356-59655378 TGATGATAGTTGCACAACTCTGG - Intronic
1175634702 20:60570663-60570685 ACATGATCGTTGCACAACAATGG + Intergenic
1177499098 21:21927833-21927855 AGTTGGCCCTTGCACAACACAGG + Intergenic
1178677058 21:34639969-34639991 TGATGATGGTTACACAACACTGG - Intergenic
1179263823 21:39784413-39784435 CGATGGTTGTTGGCCCACACAGG + Intronic
1179801185 21:43812177-43812199 AGGTGGTGGTTGCAACACACCGG - Intergenic
1183768022 22:39897467-39897489 AGATGGTTGTGGCTTAAAACAGG - Intergenic
1184230644 22:43156619-43156641 AGAGGGTGGTTGCACAACATTGG + Intronic
949343563 3:3054764-3054786 TGGTGCTGGTTGCACAACACTGG + Intronic
950357442 3:12423757-12423779 AGAGGGTTTTTGGACAAGACAGG + Intronic
952726668 3:36593813-36593835 AGAAGATGGGTGCACAACACAGG + Intergenic
954186083 3:48918229-48918251 AGATTGTTGCTGCACCACAATGG - Exonic
961020818 3:123505335-123505357 TGATGATGGTTGCACAACAATGG + Intronic
961659548 3:128461512-128461534 AGATGGTTGTTTCACCACGTTGG + Intergenic
962771118 3:138610985-138611007 AGATGATTATAGCACAACAGTGG - Exonic
967429314 3:189363314-189363336 AGTTGGTCATTGAACAACACAGG + Intergenic
968353956 3:198086478-198086500 AGATGCTGGTTGTACAACACTGG + Intergenic
978869516 4:113558097-113558119 AGATTATTGTTGCCCAACTCTGG - Intronic
979564174 4:122135614-122135636 AGTTGTTTCTTGAACAACACAGG + Intergenic
981744851 4:148042823-148042845 AGATGCTTGTGGCTCAAAACGGG + Intronic
982546785 4:156743778-156743800 AGTTGATTCTTGCACAGCACAGG - Intergenic
983741887 4:171145208-171145230 ACTTGGCTGTTGAACAACACAGG + Intergenic
986415019 5:7519714-7519736 AGGTGTTGGTTGCACAACATTGG - Intronic
992838028 5:80659313-80659335 TGATGATGGTTGCACAACTCTGG - Intronic
993453795 5:88104348-88104370 GGAGGGTTGTTGCACTACCCAGG + Intergenic
994815764 5:104585702-104585724 AGATGGTAGTTGTACTACAGTGG + Intergenic
995324455 5:110874709-110874731 AGATTGCTGTTACACAACAAGGG + Intergenic
997058507 5:130473200-130473222 TGATGGTTGTTGTACAGCAGTGG + Intergenic
1003161810 6:3642486-3642508 ACATGGTTGTTGCAAATGACGGG - Intergenic
1006830917 6:36967733-36967755 AAATGGTTTTTGCCCAGCACTGG - Intergenic
1008319823 6:50096845-50096867 AGATAGCTGTTACACAAGACAGG - Intergenic
1009919393 6:70038779-70038801 TACTGGTTGTTGCACTACACTGG + Intronic
1012565502 6:100644634-100644656 AGATGCTTGCTGAACAAGACTGG - Intronic
1012586946 6:100934880-100934902 AGAGGCCTGTTGCACAACAGTGG - Intergenic
1013788038 6:113804535-113804557 AGTTGGTCCTTGAACAACACAGG - Intergenic
1014280236 6:119434497-119434519 AGAGAGCTGTTGCACAACAATGG + Intergenic
1017230475 6:152068208-152068230 TGATGGACGTTGCAGAACACTGG - Intronic
1017961045 6:159220908-159220930 AGCTGGTCCTTGAACAACACAGG - Intronic
1018817206 6:167342592-167342614 AGGTGATGGTTGCACAACACGGG + Intronic
1019912424 7:4108739-4108761 ATGTGGTGGTTGCACAGCACTGG - Intronic
1021943022 7:25698270-25698292 GTATGGTTGTATCACAACACAGG - Intergenic
1024808041 7:53170669-53170691 AGTTGGCCGTTGCACAACAGGGG - Intergenic
1032917219 7:136505574-136505596 AGATGTGTGTAGCATAACACGGG + Intergenic
1032942297 7:136809121-136809143 AGATGGTTGGGGGAAAACACAGG + Intergenic
1033041444 7:137922609-137922631 AGTTGGTCCTTGAACAACACGGG + Intronic
1036437516 8:8748841-8748863 AAAGGGTTGTTGCACTACAAGGG - Intergenic
1044906661 8:97011481-97011503 AGATGGAGGTTGCACAGTACTGG + Intronic
1046330750 8:112712131-112712153 AGATGAGAGTGGCACAACACTGG - Intronic
1047142323 8:122155109-122155131 GCATGTTTTTTGCACAACACTGG + Intergenic
1047180921 8:122586951-122586973 AGGTGGTGGTTGCACAACACTGG + Intergenic
1048761546 8:137801073-137801095 ACATGGTTGTGGGAAAACACGGG + Intergenic
1049079543 8:140431008-140431030 AGTTGGTTGTTGAAGAAAACAGG + Intronic
1050045131 9:1535154-1535176 AGGTGACGGTTGCACAACACTGG - Intergenic
1050114013 9:2244411-2244433 AGGAGGTGGTTGCACAACCCTGG - Intergenic
1052235498 9:26209250-26209272 AGATGGGTGTTACACAAGAGGGG + Intergenic
1055005963 9:71507057-71507079 AGTAGTTTGTTGCACAACAATGG + Intergenic
1057685151 9:97226372-97226394 AGATGCTGGTTGTACAAAACTGG + Intergenic
1058278999 9:103087239-103087261 AGAAGTATGTTGCACAACATTGG + Intergenic
1186749741 X:12609294-12609316 AGTTGGCTCTTGAACAACACAGG - Intronic
1187450232 X:19389479-19389501 AGCTGGTTGGTGCAGAACTCTGG - Intronic
1190894305 X:54601278-54601300 TGATGGTGGTTGCACAATCCTGG + Intergenic
1192413613 X:70957204-70957226 TGATGATGGTTGCACAACAATGG + Intergenic
1192458534 X:71298029-71298051 AAAGGGTTATTTCACAACACGGG - Intronic
1193524140 X:82567752-82567774 AAAAGGTTTCTGCACAACACAGG - Intergenic
1194554812 X:95343033-95343055 TGGTGATTGTTGCACAACAATGG + Intergenic
1199785894 X:151104550-151104572 AGATGGTGGTTTCTCAACCCGGG - Intergenic
1201731093 Y:17204052-17204074 AGGTGATTGTTGCACAACACTGG + Intergenic
1202073286 Y:21014781-21014803 AGAATGTTGTTGCAAACCACAGG - Intergenic
1202077986 Y:21056635-21056657 AGAATGTTGTTGCAAACCACAGG - Intergenic
1202160451 Y:21929266-21929288 AGTTAGCTGCTGCACAACACAGG + Intergenic
1202230905 Y:22657109-22657131 AGTTAGCTGCTGCACAACACAGG - Intergenic
1202312253 Y:23539056-23539078 AGTTAGCTGCTGCACAACACAGG + Intergenic
1202558550 Y:26131538-26131560 AGTTAGCTGCTGCACAACACAGG - Intergenic