ID: 1085081010

View in Genome Browser
Species Human (GRCh38)
Location 11:73634220-73634242
Sequence GGTTGTACACACAGGAAGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085081010_1085081014 -2 Left 1085081010 11:73634220-73634242 CCCAACTTCCTGTGTGTACAACC No data
Right 1085081014 11:73634241-73634263 CCAAAAGCCCTGCTTGATACAGG No data
1085081010_1085081017 26 Left 1085081010 11:73634220-73634242 CCCAACTTCCTGTGTGTACAACC No data
Right 1085081017 11:73634269-73634291 TCTGAGAGTTCCTCCTGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085081010 Original CRISPR GGTTGTACACACAGGAAGTT GGG (reversed) Intergenic
No off target data available for this crispr