ID: 1085082846

View in Genome Browser
Species Human (GRCh38)
Location 11:73648245-73648267
Sequence CTGGCTTCAAACCGTTATGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 80}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085082846_1085082852 -1 Left 1085082846 11:73648245-73648267 CCGGCATAACGGTTTGAAGCCAG 0: 1
1: 0
2: 1
3: 7
4: 80
Right 1085082852 11:73648267-73648289 GGACTGCTGGGTGTGAGTCTGGG 0: 1
1: 0
2: 2
3: 18
4: 237
1085082846_1085082853 23 Left 1085082846 11:73648245-73648267 CCGGCATAACGGTTTGAAGCCAG 0: 1
1: 0
2: 1
3: 7
4: 80
Right 1085082853 11:73648291-73648313 TCCATTGCTTACTAATCAAGTGG 0: 1
1: 0
2: 0
3: 10
4: 99
1085082846_1085082851 -2 Left 1085082846 11:73648245-73648267 CCGGCATAACGGTTTGAAGCCAG 0: 1
1: 0
2: 1
3: 7
4: 80
Right 1085082851 11:73648266-73648288 AGGACTGCTGGGTGTGAGTCTGG 0: 1
1: 0
2: 1
3: 31
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085082846 Original CRISPR CTGGCTTCAAACCGTTATGC CGG (reversed) Intronic
900939442 1:5788661-5788683 CTGCCTTGAAACCGTTAAGTTGG - Intergenic
912663682 1:111559802-111559824 GTGGCTTCAAATCTTAATGCTGG + Intronic
916737719 1:167622826-167622848 CTGACTTGAAACTGTTGTGCAGG + Intergenic
924417730 1:243876020-243876042 CTGGCTTCACACAGTTATGTAGG - Intergenic
1074906643 10:117869965-117869987 ATTTCTTCAAACCGTTTTGCTGG - Intergenic
1080121275 11:28680663-28680685 GTGGCTTCAGACCGATTTGCAGG + Intergenic
1080713390 11:34772316-34772338 CTGGTTTTAAACAGTTATTCTGG - Intergenic
1085082846 11:73648245-73648267 CTGGCTTCAAACCGTTATGCCGG - Intronic
1087200470 11:95339580-95339602 CTAGTTTCAAACTGTTTTGCTGG + Intergenic
1087627206 11:100608763-100608785 CTGACTTCAAACTATAATGCAGG + Intergenic
1089564898 11:119365554-119365576 CTGGCTTGAAAGCGTTTGGCTGG - Intronic
1090185333 11:124735528-124735550 CTTGCTTCAAACCATCATCCAGG + Intergenic
1090620730 11:128558725-128558747 TTGGCTTCAAACCATTTTGCTGG + Intronic
1102963946 12:117112042-117112064 CTGGCTTCTTACCTTCATGCAGG + Intergenic
1103326088 12:120121700-120121722 CTGACTCCAAACCGTTTAGCAGG + Intergenic
1103351540 12:120287145-120287167 CTGGCTTCAAAGCTTCATGGGGG + Intergenic
1104322774 12:127767510-127767532 CTGGCTTCAAACCCATATGGGGG - Intergenic
1117850091 14:59958602-59958624 CTGGCTTCAGTCCGCTTTGCAGG + Intronic
1120620360 14:86755758-86755780 CTGCCTTCTACCCCTTATGCTGG - Intergenic
1120867175 14:89305249-89305271 CTGACTTCAGACGTTTATGCTGG + Intronic
1121263045 14:92580583-92580605 CTGGCTTTAAGCCATCATGCTGG - Intronic
1122607165 14:102954499-102954521 CTCGCTGCAAACTGTTATGCAGG + Intronic
1128857540 15:71031971-71031993 CTGGCTTCAGACCGCTTTCCAGG + Intronic
1135537634 16:23306334-23306356 CTTGCCTCAAACGGTTATGTTGG + Intronic
1138125935 16:54438356-54438378 CTGGCCTCCAACCTTTAAGCTGG - Intergenic
1144431451 17:15195893-15195915 CTGGCTTCAAGCAATTATCCTGG - Intergenic
1145714297 17:27005282-27005304 CTGGCTTCAAACTGTATTACAGG - Intergenic
1149819748 17:59764550-59764572 CTGGCTTCAAGCAGTCATCCTGG + Intronic
1153872359 18:9333431-9333453 CTAGTGTCAAACCCTTATGCTGG - Intergenic
1157771604 18:50352641-50352663 CTGGCTTAATGCCTTTATGCTGG + Intergenic
1159690613 18:71482986-71483008 CTGGCTTCAGCCCGTTTTCCAGG + Intergenic
1162781857 19:13010801-13010823 CTGGCTTCAAAGCGGCATTCAGG + Intronic
1164800900 19:31075808-31075830 CTAGCTTCAATCCGTTCTGAGGG - Intergenic
1166942201 19:46373915-46373937 CTGGCTCCAGGCCTTTATGCAGG - Intronic
928812084 2:35240161-35240183 CTGACTTCAAACCATTCTACAGG + Intergenic
935961470 2:108429607-108429629 CTGGCTTCAACCCTTTTTCCAGG - Intergenic
938021234 2:127907380-127907402 CTGGATTCAAATCGTTACTCTGG + Intergenic
938041467 2:128079524-128079546 CTGCCTTCAAACCCTAATGCAGG - Intergenic
939047576 2:137267971-137267993 CTGGCTTCAAACCATGATATTGG + Intronic
939956681 2:148533273-148533295 CTGGATTAAACCCGTGATGCAGG + Intergenic
942044598 2:172092764-172092786 CTGGCTTTAAATCTTTATCCTGG + Intergenic
943543914 2:189250998-189251020 CAGACTTCATACCGTTAAGCAGG - Intergenic
946685546 2:222265943-222265965 CTGCCTTCAAACCCTTCTACAGG - Intronic
946758924 2:222973900-222973922 ATGGCTTCAAAAAGTGATGCTGG - Intergenic
948953195 2:241268476-241268498 CTGGCTACTGACCGTTTTGCTGG - Exonic
1175866287 20:62178910-62178932 CTGGCATCAGAGCCTTATGCTGG - Intronic
1177129665 21:17240738-17240760 TTGACTTCAAACTGTTGTGCTGG - Intergenic
1183947300 22:41333835-41333857 CTGGTTTCAAACTGTGATGAGGG + Intronic
1185366629 22:50439836-50439858 CTGACTTCCAACCTTTCTGCTGG + Exonic
949217455 3:1586890-1586912 CTGACTTCAAACTGTTCTACAGG + Intergenic
951263567 3:20540537-20540559 CTTGCTTCTAACCTTTAAGCTGG - Intergenic
956207728 3:66771696-66771718 TTGACTTCAAACTGCTATGCTGG + Intergenic
957292382 3:78294360-78294382 CTTGCTTTAAACCATTAAGCTGG - Intergenic
958807585 3:98830641-98830663 CTGACTTCAAACTGTACTGCAGG - Intronic
959038127 3:101388210-101388232 CAGGCTTCTAACAGTTGTGCTGG - Intronic
961863154 3:129934073-129934095 CTGACTTCAAATAGTGATGCTGG + Intergenic
962913196 3:139873929-139873951 CTGACTTCAAACTGTACTGCAGG + Intergenic
963894085 3:150666875-150666897 CTGGCTTTGAACCGTTATATTGG - Exonic
974326308 4:60419234-60419256 TTGACTTCAAACTGCTATGCTGG + Intergenic
986682172 5:10243897-10243919 CTGGCATCAAACAGTTAGCCAGG - Intronic
990897598 5:60715788-60715810 TTGGCTTCAGACTGCTATGCTGG + Intergenic
998404922 5:141868879-141868901 CTGGCTTCAGACCGTGATGCTGG - Exonic
999008491 5:148008300-148008322 CTGTGTTCAAACCATTATGTCGG + Intergenic
1001310966 5:170610524-170610546 CTGGCTTCTAACAGCAATGCTGG - Intronic
1004882842 6:20025742-20025764 GTGGCTTCAAACCCTTTTCCAGG + Intergenic
1006731589 6:36240117-36240139 CTGGCTTCAAACAGTTGCCCAGG - Intergenic
1008205288 6:48648591-48648613 CTGACTTCAAACCGTACTACAGG + Intergenic
1009607449 6:65891598-65891620 ATGTCTTCAAACCTTTATGATGG + Intergenic
1010668329 6:78655804-78655826 CTGGCTTCAACCCCTTTTCCAGG + Intergenic
1010765383 6:79772655-79772677 GTGGCTTTATACCTTTATGCAGG - Intergenic
1011246764 6:85327634-85327656 CTGGCATCAGCCGGTTATGCAGG - Intergenic
1011816168 6:91193601-91193623 CAGGCTTCAATCTGTTATTCTGG - Intergenic
1023186878 7:37541528-37541550 ATGGCTTAAAACAGTTATGAAGG + Intergenic
1026114073 7:67481497-67481519 CTGGTTTCAAAAAGTTAGGCTGG - Intergenic
1026414791 7:70168246-70168268 CTGTCTACAAACATTTATGCAGG + Intronic
1029003056 7:97176375-97176397 TTGGTTTCAAACTGTTATGCTGG - Intronic
1038993772 8:32898991-32899013 CTGGCTTCAGACCATGATCCTGG + Intergenic
1042854150 8:73248344-73248366 CTGACTTCAAACCGTGGTACAGG - Intronic
1051606720 9:18923930-18923952 CTGGCTTCAAGCTCTTGTGCCGG - Intergenic
1052249439 9:26380185-26380207 CTGGCTACAAACTGTTTTGCAGG - Intergenic
1060709271 9:125840848-125840870 CTGGGTTCAAACCCTTACCCTGG - Intronic
1186376027 X:9002594-9002616 GTGGCTTCAGACAGTGATGCAGG + Intergenic
1190995707 X:55606470-55606492 CTGGCTTCAAACCCCTTTCCAGG + Intergenic
1191127575 X:56974240-56974262 CTTGCTTCTAACCTTTAAGCTGG + Intergenic
1192056054 X:67774808-67774830 CTGACTTCAAACTCTTCTGCAGG + Intergenic
1192707404 X:73541155-73541177 TTGGCTTCAGACTGCTATGCTGG - Intergenic
1195557244 X:106241067-106241089 CTGGGTCCAAACTGGTATGCAGG + Intergenic
1196194375 X:112824588-112824610 CTGGCTTCCAACTGTTGCGCTGG + Intronic
1199096560 X:143748567-143748589 GTGGCCTCAAACTGTCATGCTGG + Intergenic