ID: 1085083623

View in Genome Browser
Species Human (GRCh38)
Location 11:73652549-73652571
Sequence CGGGACAATGGGGCCTTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 81}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085083623_1085083631 -1 Left 1085083623 11:73652549-73652571 CCAACAAAGGCCCCATTGTCCCG 0: 1
1: 0
2: 0
3: 10
4: 81
Right 1085083631 11:73652571-73652593 GTGTCTGCTGGGCCTTCCTGAGG 0: 1
1: 0
2: 6
3: 43
4: 346
1085083623_1085083639 21 Left 1085083623 11:73652549-73652571 CCAACAAAGGCCCCATTGTCCCG 0: 1
1: 0
2: 0
3: 10
4: 81
Right 1085083639 11:73652593-73652615 GCTCTGGGGTCAGAGCTTTGGGG 0: 1
1: 0
2: 5
3: 22
4: 315
1085083623_1085083633 6 Left 1085083623 11:73652549-73652571 CCAACAAAGGCCCCATTGTCCCG 0: 1
1: 0
2: 0
3: 10
4: 81
Right 1085083633 11:73652578-73652600 CTGGGCCTTCCTGAGGCTCTGGG 0: 1
1: 0
2: 3
3: 53
4: 462
1085083623_1085083634 7 Left 1085083623 11:73652549-73652571 CCAACAAAGGCCCCATTGTCCCG 0: 1
1: 0
2: 0
3: 10
4: 81
Right 1085083634 11:73652579-73652601 TGGGCCTTCCTGAGGCTCTGGGG 0: 1
1: 2
2: 8
3: 61
4: 479
1085083623_1085083637 19 Left 1085083623 11:73652549-73652571 CCAACAAAGGCCCCATTGTCCCG 0: 1
1: 0
2: 0
3: 10
4: 81
Right 1085083637 11:73652591-73652613 AGGCTCTGGGGTCAGAGCTTTGG 0: 1
1: 0
2: 6
3: 37
4: 390
1085083623_1085083638 20 Left 1085083623 11:73652549-73652571 CCAACAAAGGCCCCATTGTCCCG 0: 1
1: 0
2: 0
3: 10
4: 81
Right 1085083638 11:73652592-73652614 GGCTCTGGGGTCAGAGCTTTGGG 0: 1
1: 0
2: 0
3: 44
4: 410
1085083623_1085083632 5 Left 1085083623 11:73652549-73652571 CCAACAAAGGCCCCATTGTCCCG 0: 1
1: 0
2: 0
3: 10
4: 81
Right 1085083632 11:73652577-73652599 GCTGGGCCTTCCTGAGGCTCTGG 0: 1
1: 0
2: 4
3: 43
4: 389

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085083623 Original CRISPR CGGGACAATGGGGCCTTTGT TGG (reversed) Intronic
900186870 1:1336866-1336888 GGGGACAGTGGGGCCTTGGGTGG - Intronic
900525410 1:3126140-3126162 GGGGAGAAAGGGGCCATTGTGGG + Intronic
902816189 1:18918030-18918052 CGGGACAATGGGTACAGTGTGGG + Intronic
909109734 1:71459615-71459637 TGGGACAAGGAGGCCATTGTAGG - Intronic
909496018 1:76279520-76279542 CGGGAAAGAGGAGCCTTTGTGGG + Intronic
915512268 1:156392761-156392783 TGGGACAATGGGGCGGTTGGGGG + Intergenic
917633072 1:176908943-176908965 CTGGCCAATGGAGCCTTGGTGGG - Intronic
920350026 1:205331762-205331784 CTGAACAAAGGGGCCTTTGGGGG - Intergenic
920366652 1:205451394-205451416 AGGAAGAATGGGGCCTCTGTTGG - Intronic
921815978 1:219563876-219563898 AGGGATAATGGGATCTTTGTAGG - Intergenic
922764416 1:228149853-228149875 GGGAACAATGGGGCCCTTGAGGG + Exonic
1072357326 10:94624382-94624404 CTTGAGAATGGGGCCTTTGCTGG - Intergenic
1075576197 10:123579424-123579446 TGTGACAAAGGGGGCTTTGTAGG - Intergenic
1079339717 11:19601986-19602008 CAGGACCATGGGGCCCTGGTGGG - Intronic
1080631003 11:34075601-34075623 TGGGACAAAGGGGCCCTTGTGGG + Intronic
1082739098 11:56890634-56890656 GGGGACAATGGGAGCATTGTAGG + Intergenic
1085083623 11:73652549-73652571 CGGGACAATGGGGCCTTTGTTGG - Intronic
1089497332 11:118914296-118914318 GGGAACAATGGGGCCATTGTGGG + Intronic
1089981194 11:122773957-122773979 TGGAACAATGGGTCCTTTTTTGG + Intronic
1093651554 12:21651438-21651460 CTGTACAAAGGGGCCTTAGTGGG + Intronic
1096432260 12:51556506-51556528 AGGGACTATGGGGACTATGTGGG - Intergenic
1108676228 13:52739666-52739688 CAGGGCAATGGGAACTTTGTCGG + Exonic
1112925551 13:104670476-104670498 AGGGACAATGAGGCCGTTGTGGG + Intergenic
1115641618 14:35339008-35339030 GGGTACAATGAGGCCTGTGTCGG - Intergenic
1118389910 14:65287395-65287417 CGGGACAGCCGGGCCTTTCTAGG + Intergenic
1122356691 14:101126953-101126975 CGGGGCAAGGGGGCCTTGGCTGG - Intergenic
1124334352 15:28846021-28846043 TGGGACAGTGGGGCCATTCTGGG - Intergenic
1126360776 15:47843578-47843600 GGAGACAAGGGGGCATTTGTTGG - Intergenic
1128112211 15:65083731-65083753 AGGGAAAATGGGCCTTTTGTTGG + Intergenic
1129288200 15:74541959-74541981 CGGGAAAATGGGCTCTTTGGGGG + Intronic
1130888223 15:88111391-88111413 CGGGTTAATGGGGCCTTTTTTGG - Intronic
1132146989 15:99435021-99435043 TGGGAGAAGGGGGCGTTTGTGGG - Intergenic
1132854075 16:2037052-2037074 AGGGAGAAGGGGGCCTCTGTCGG - Intronic
1135281570 16:21157858-21157880 CGGGACGATGGGGCCTTCCAGGG + Intronic
1136239949 16:28937522-28937544 CGGTAACTTGGGGCCTTTGTGGG + Exonic
1140981477 16:80113621-80113643 GGGGAGGATGGGGCCTTTTTGGG + Intergenic
1142886218 17:2913768-2913790 CAGGACAATGGGAACTTTCTGGG - Intronic
1147185303 17:38710187-38710209 CGGGAGAATGGGGTGTTTGGTGG + Intronic
1155226535 18:23734283-23734305 CGGGACCATGGGGCCTGCTTTGG + Intronic
1159923432 18:74246848-74246870 CGGGACAATGGGGAGATAGTGGG - Intergenic
1163303389 19:16462182-16462204 AGGGACAATGGCACCATTGTTGG + Intronic
1163883921 19:19949634-19949656 CCAGTCAGTGGGGCCTTTGTGGG - Intergenic
1167507305 19:49877696-49877718 CGGGGCAGTGGGGCCTTCGGCGG + Exonic
1167512536 19:49903369-49903391 CGGGACAAGGGCGCCCATGTGGG + Intronic
928285526 2:29986866-29986888 GAGAACAATGTGGCCTTTGTGGG + Intergenic
938990231 2:136620555-136620577 ACAGACAATGGGGCCTTTTTGGG + Intergenic
939255658 2:139742179-139742201 TGGGACAAGGCTGCCTTTGTAGG + Intergenic
1168913196 20:1466584-1466606 CGGGACCATGAGGCCTGGGTCGG + Intronic
1175065018 20:56277128-56277150 GGGAACAATGGGGCCTTCCTGGG - Intergenic
1176044232 20:63084097-63084119 TGGGACAATTGGCCCTCTGTTGG - Intergenic
1176308987 21:5139903-5139925 CGGGAGACTGGGGTCTTCGTTGG - Intronic
1177587163 21:23111838-23111860 CAGGAAAATGGGGCCTTTAGAGG - Intergenic
1179848074 21:44122130-44122152 CGGGAGACTGGGGTCTTCGTTGG + Intronic
1181048645 22:20228343-20228365 TGGGACTCTGGGGCCTTTGGGGG + Intergenic
1182281356 22:29219364-29219386 GGGGACAATGGGACCTATGAGGG - Intronic
1182300694 22:29335343-29335365 AGAGACAGTGGGACCTTTGTTGG - Intronic
957844563 3:85715240-85715262 CATGACAATGAGACCTTTGTTGG + Intronic
960910869 3:122648181-122648203 CAGGAAAGTGGGGGCTTTGTTGG + Intergenic
961364183 3:126389139-126389161 AGGGACACTGGGGCCTGTGGAGG + Intergenic
961450316 3:126999591-126999613 CCGGAGAATGGGCCCTTTGTTGG + Intronic
986993001 5:13575642-13575664 CTGGACAATGAGTCCTGTGTGGG + Intergenic
988566011 5:32320538-32320560 CGGGAAAAGGGGGCCTTCTTGGG + Intergenic
990353105 5:54938672-54938694 CTGGACATGGGGGCCTTTGTAGG - Intergenic
992227081 5:74629441-74629463 CTGAACAATGGGGACTTTGTTGG - Exonic
995882969 5:116863255-116863277 ATGGACAACTGGGCCTTTGTGGG - Intergenic
998337094 5:141383014-141383036 ACGGACAAAGGGTCCTTTGTGGG + Exonic
999165866 5:149549112-149549134 AGAGAAATTGGGGCCTTTGTTGG - Intronic
999743515 5:154574655-154574677 TGAGAAAATGGGGCCTTTGGGGG + Intergenic
1001426156 5:171623952-171623974 CGGGGGAAGGGGGCCTTTGATGG + Intergenic
1001586242 5:172835078-172835100 CACCACAATGGGTCCTTTGTGGG + Intronic
1006621414 6:35367221-35367243 TGGGAACATGGGGCATTTGTTGG + Intronic
1010733312 6:79413310-79413332 CTCGAGAATGGGGCCTTTGCCGG + Intergenic
1020991250 7:15198964-15198986 GGGGACAAGGCTGCCTTTGTGGG - Intergenic
1022302360 7:29113437-29113459 TAGGACAATGGGGCAGTTGTGGG + Intronic
1025811459 7:64878318-64878340 TAGGACAATGGGGCCTTGGGAGG - Intronic
1030661476 7:112223671-112223693 CTGGACAAAAGCGCCTTTGTGGG - Intronic
1034392042 7:150794366-150794388 TGGGACAATGGGACCTCTGAAGG - Intronic
1035381665 7:158444824-158444846 GGGGACACTGGGGGCTTTCTTGG - Intronic
1039436234 8:37561249-37561271 AGGGACAATGGGGCCTTGATGGG + Intergenic
1041551762 8:59110781-59110803 TGGGAAAATGGGGTCTCTGTAGG - Intronic
1042381489 8:68119513-68119535 AGGTACAATCGGGCATTTGTGGG + Exonic
1049938927 9:526060-526082 GAGGAGAATGGGGCCTTTCTTGG + Intronic
1051263418 9:15288234-15288256 CCTGAGAATGGGGCCTTTGCTGG - Intronic
1060230165 9:121820076-121820098 CGGGACAGAGGGGCCATGGTGGG + Intergenic
1061193638 9:129095911-129095933 TGGGTCAGTGGGGCCTGTGTAGG + Intronic
1061204021 9:129152706-129152728 AGGGACACCGGGGTCTTTGTTGG + Intergenic
1061221194 9:129253251-129253273 CTGGACAAAGGGGCCTTTGGAGG + Intergenic
1192447701 X:71223164-71223186 CTGCACAATGAGACCTTTGTGGG - Intronic
1194128609 X:90051156-90051178 AGGGAGAATGGGGCCTTTTGGGG - Intergenic
1194912143 X:99658903-99658925 CGTGAGAATATGGCCTTTGTTGG - Intergenic
1197033533 X:121847864-121847886 GGGGACAATGGGGCATCTGTAGG + Intergenic
1198159190 X:133990022-133990044 AGGGGCAATGAGGCCTTTTTTGG + Intergenic