ID: 1085083839

View in Genome Browser
Species Human (GRCh38)
Location 11:73653798-73653820
Sequence GAGTGGGTAAGGAGGGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2286
Summary {0: 1, 1: 0, 2: 16, 3: 254, 4: 2015}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085083839 Original CRISPR GAGTGGGTAAGGAGGGAAGG AGG Intronic
Too many off-targets to display for this crispr