ID: 1085084111

View in Genome Browser
Species Human (GRCh38)
Location 11:73655481-73655503
Sequence CAGGTGGGCTAGAGGACAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 299}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085084100_1085084111 18 Left 1085084100 11:73655440-73655462 CCTGGGGGCACAGCTAGGGACGA 0: 1
1: 0
2: 0
3: 8
4: 100
Right 1085084111 11:73655481-73655503 CAGGTGGGCTAGAGGACAGAAGG 0: 1
1: 0
2: 3
3: 22
4: 299

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085084111 Original CRISPR CAGGTGGGCTAGAGGACAGA AGG Intronic
900482372 1:2905418-2905440 CTGGGGGGCTGGAGCACAGAGGG - Intergenic
900951141 1:5858854-5858876 CCTGTGGGCTGGAGGACACAGGG - Intergenic
901007639 1:6179667-6179689 CAGGCGGGCCAGAGGACCGCGGG - Intronic
901584045 1:10272085-10272107 CAAGTGGAAAAGAGGACAGATGG + Intronic
902121882 1:14173288-14173310 CAGATGGGCTAAAGAAAAGAAGG + Intergenic
902687546 1:18088434-18088456 CAGCTGAGCTAGAGCAGAGACGG + Intergenic
902878461 1:19355040-19355062 CAGAGGGGCTGGAGGCCAGAAGG - Intronic
903934944 1:26889189-26889211 AATGAGGGCTTGAGGACAGAGGG + Intronic
905274651 1:36809383-36809405 TAGGTGGGTAAGAGAACAGACGG - Intronic
906527436 1:46503089-46503111 CAGGGTGGCTGGAGCACAGATGG - Intergenic
907074664 1:51567390-51567412 TAGGTTGGCTAGAGGATAGTAGG - Intergenic
907398722 1:54210876-54210898 GAGGTGGGCATGAAGACAGATGG - Intronic
907463741 1:54621695-54621717 CTGGAGGGCTGGAGGGCAGAGGG + Intronic
907629859 1:56069598-56069620 CTGGTGGGCTTGATGAGAGATGG + Intergenic
908987027 1:70036722-70036744 CAAGTGGCATAGAAGACAGAAGG + Intronic
910108652 1:83658645-83658667 AAGGGAGTCTAGAGGACAGATGG - Intergenic
912159806 1:106967887-106967909 GATGTGGGCTTGGGGACAGAAGG + Intergenic
912250718 1:108010036-108010058 AAGGTGGGCCAGAGGACAAATGG - Intergenic
912466410 1:109877752-109877774 CGGGTGTGCTGGAGGACAGGCGG + Intergenic
912488492 1:110047894-110047916 CAGGTGGGGCAGAAGATAGATGG + Intronic
915604112 1:156940084-156940106 CTGGTGTGCTTGAGGAGAGATGG - Intronic
915622183 1:157092584-157092606 GCGGTGGGCAAGAGGAGAGATGG + Exonic
917531486 1:175839934-175839956 CAGGTTGGGTAGAGGAAAAAAGG + Intergenic
917666579 1:177230874-177230896 CAAGGGGGCAAGTGGACAGAGGG - Intronic
919935669 1:202248944-202248966 CAGTTGGGAAAGAGGAGAGAAGG + Intronic
920694219 1:208169554-208169576 CTGGTGGGCAAGTGGACAAAGGG + Intronic
920736761 1:208539897-208539919 CAGGTGGGCAAGAGAAGTGAGGG + Intergenic
921221422 1:212976763-212976785 CAGATGGGCAGGAGGGCAGAGGG - Intronic
921677926 1:217997464-217997486 CAGGTGGCCTAGAAAACAGAAGG + Intergenic
924559172 1:245143414-245143436 CAGATGGGGGAGTGGACAGATGG - Intergenic
1063201222 10:3786074-3786096 CTGGTGGCCCGGAGGACAGAGGG - Intergenic
1063523503 10:6761801-6761823 CATTTGGGCTAGAGGAGAGAAGG - Intergenic
1065100520 10:22326122-22326144 CTGCTGGGCTGGAGGACAAATGG + Intronic
1065821568 10:29530364-29530386 CAGGTGGGCCAGAGGCAGGAGGG + Intronic
1066391394 10:34979808-34979830 CCGCTGGGTTAGAGTACAGAGGG + Intergenic
1067141256 10:43659046-43659068 CAGGTGGGAAAGTGGACGGAGGG + Intergenic
1067141886 10:43664922-43664944 CAGGTGGGAAATTGGACAGAGGG - Intergenic
1067559864 10:47297635-47297657 AAGGAGGCCTAGAGGACTGAGGG + Intergenic
1067949728 10:50721589-50721611 CAAGTGGGAAAGATGACAGAAGG + Intergenic
1069694057 10:70373990-70374012 CAAGTGGGCCAGTGGACAGGTGG - Intronic
1070699177 10:78586845-78586867 CACGTGGGCTATTGGACTGAAGG + Intergenic
1070793761 10:79205038-79205060 CAGATGGACTGGTGGACAGATGG + Intronic
1070885035 10:79886622-79886644 CAAGTGGGAAAGATGACAGAAGG + Intergenic
1071553447 10:86584946-86584968 CATGTGGACTTGAGGCCAGAAGG + Intergenic
1072199155 10:93143249-93143271 CAGCAGGGCTAGAGCAGAGAGGG - Intergenic
1072583547 10:96761368-96761390 AAGGTGGGCAAAAGGACAGGAGG - Intergenic
1072758730 10:98038539-98038561 CAGGGAGGCCAGAGGTCAGAGGG + Intergenic
1074826954 10:117221539-117221561 CAGGTGGGGCAGAGAACACAGGG - Intergenic
1075840133 10:125494357-125494379 GAGGTGGGCCAGCAGACAGATGG - Intergenic
1076121352 10:127939535-127939557 CAGGTGTGCTGGAGGATACATGG + Intronic
1076307205 10:129473881-129473903 CAGTGGGGCCAGAGGAAAGATGG + Intronic
1077340185 11:2022971-2022993 CTGGTGGTCTCGAGGACAAATGG + Intergenic
1077828325 11:5835063-5835085 CAGTGGGGCTGGAGGAAAGAGGG - Intronic
1078084297 11:8224562-8224584 CAGGTGGGCAGGCGGGCAGATGG + Exonic
1078915068 11:15771122-15771144 CAGGTGGGCTAGAGAAACAAGGG + Intergenic
1079117901 11:17652227-17652249 CTGGGGGGCTAGAGGCCAAAGGG - Intergenic
1082114247 11:48310563-48310585 AAGGTAGGCTAGAGGTGAGAAGG + Intergenic
1084209516 11:67614576-67614598 GAGGTGGAAGAGAGGACAGATGG - Intergenic
1085084111 11:73655481-73655503 CAGGTGGGCTAGAGGACAGAAGG + Intronic
1085314672 11:75537287-75537309 CAGTGGGGCTAGAGGGCAGTGGG + Intergenic
1086206504 11:84264483-84264505 GCTGTGGGCTAGAGGAGAGATGG + Intronic
1086325771 11:85697605-85697627 CAGGTGGGACAAAGGAGAGAAGG + Intronic
1089175399 11:116545283-116545305 CAGGTAGGGGAGAGGAAAGATGG + Intergenic
1089492951 11:118895077-118895099 CAGGTGGGCAGGAGGAGAGAGGG - Exonic
1089825016 11:121266963-121266985 CAGGTAGACTTGTGGACAGAAGG + Intergenic
1090362014 11:126179794-126179816 GGGGTTGCCTAGAGGACAGAGGG - Intergenic
1090746407 11:129709194-129709216 CACGTAGGCTGGAGGACAGTGGG + Intergenic
1202823170 11_KI270721v1_random:78160-78182 CTGGTGGTCTCGAGGACAAATGG + Intergenic
1091552512 12:1547314-1547336 AAGGTGCACCAGAGGACAGAGGG - Intronic
1091553482 12:1554366-1554388 CAGGTGGGGCAGAGGAGCGAAGG + Intronic
1092006494 12:5074569-5074591 CAGGTGGGAGTAAGGACAGATGG + Intergenic
1092810068 12:12264514-12264536 CAACAGGGCTACAGGACAGAAGG + Intronic
1092992330 12:13914911-13914933 CAGGAAGGGTAGAGGAAAGAGGG + Intronic
1093946958 12:25120267-25120289 CAGGTGTGTTAGGGGAGAGAGGG + Intronic
1095872120 12:47040168-47040190 GAAGTGGACTAGATGACAGAAGG - Intergenic
1096425327 12:51496684-51496706 CAGGAAGGCTACAGGACAGCAGG - Intronic
1097194574 12:57236413-57236435 CAGGTGGGCTGGAGGGGATACGG + Intronic
1097907686 12:64937290-64937312 CAGGTGGCCTGGAGAACATAAGG - Intergenic
1102692752 12:114774262-114774284 CGGCTGGGTGAGAGGACAGAGGG + Intergenic
1103725546 12:122995812-122995834 CTGGTGGGTGGGAGGACAGAAGG - Intronic
1103814635 12:123644323-123644345 AAGGTGAGCTCGAGGAAAGAAGG + Intronic
1104827688 12:131725353-131725375 CCGGTGGACAAGAGGACAAATGG + Intronic
1104877284 12:132044328-132044350 CAGGGGGGCAAGAGGGCAGGAGG - Intronic
1105546151 13:21352436-21352458 GAGGTGGGATTGAGCACAGAAGG + Intergenic
1106533013 13:30612290-30612312 GAGTAGGGGTAGAGGACAGAGGG + Intronic
1107191829 13:37597275-37597297 CATTTGGGCTGGAGGATAGAGGG + Exonic
1108593046 13:51927539-51927561 CAGGTGGGCTGAATGACATAAGG + Intergenic
1110184333 13:72655883-72655905 TAGGTGGGACAGAGAACAGAAGG + Intergenic
1110533672 13:76626706-76626728 CAGTGTGGCTAGAGTACAGAGGG - Intergenic
1115307207 14:31945221-31945243 CAAGTGTGCCTGAGGACAGAGGG + Intronic
1117525581 14:56599227-56599249 CAGGAGGGCAAAAGGACAGAAGG - Intronic
1118974538 14:70665404-70665426 CAGGTGAGGAAGGGGACAGAAGG + Intronic
1120330740 14:83090322-83090344 CAGCAGGTCTAAAGGACAGAGGG + Intergenic
1120666868 14:87316696-87316718 AAGGTTGGCTAAAGGGCAGAAGG - Intergenic
1121560835 14:94874051-94874073 CAGGTGGCCTGGACCACAGAGGG - Intergenic
1124899540 15:33809486-33809508 CAGGTGGGCTCAAGGAAACAAGG - Intronic
1128460026 15:67859930-67859952 CAGAAGGGCTTGAGCACAGAGGG + Intergenic
1129364637 15:75046828-75046850 TTAGTGGGCTAGAGGACAGAGGG - Intronic
1129515702 15:76155977-76155999 CTGGTGGGTTAGCGGACAGTCGG - Intronic
1130178183 15:81596814-81596836 CAGGTGGGGAAGATGCCAGAAGG + Intergenic
1131785168 15:95904824-95904846 CAGGAGGGCTTGAGCTCAGAGGG - Intergenic
1132202120 15:99962239-99962261 CCGGTGGGGAAGAGGGCAGAAGG + Intergenic
1133412396 16:5579537-5579559 CAGGTGGACTAGAGGATTGGGGG - Intergenic
1136515012 16:30762722-30762744 CAGTTTGGCCAGAGAACAGAGGG - Intronic
1137024944 16:35464409-35464431 CAGGTGGGGTGGTGGAGAGAAGG + Intergenic
1137498996 16:48996159-48996181 CAGATGGGGCAGGGGACAGATGG + Intergenic
1137750030 16:50854429-50854451 CATGAGGGCAAGAGGACAGAGGG + Intergenic
1138087246 16:54144137-54144159 CAGGTGTTCTAGAGACCAGAGGG + Intergenic
1138347551 16:56329329-56329351 CAGGAGGGCAGGAGGACGGAAGG + Intronic
1138380018 16:56593627-56593649 CAGGAGAGAGAGAGGACAGAGGG - Intergenic
1138543974 16:57705548-57705570 GAGGTGGGTGGGAGGACAGATGG - Intronic
1138615717 16:58164262-58164284 CAGGGGGGCAACAGGAGAGACGG + Intronic
1138627648 16:58265405-58265427 ATTGTGGGCTAGAAGACAGAGGG + Intronic
1139515839 16:67451909-67451931 CAGGTGGGCCAGTGGGCAGTGGG + Intronic
1139516512 16:67455366-67455388 CAGGCGAGCTAAAGGAGAGATGG + Intronic
1140257035 16:73346324-73346346 CATGGTGGCGAGAGGACAGACGG - Intergenic
1141851706 16:86650584-86650606 CAGGTGGGCTTGAGGTTGGAAGG - Intergenic
1142031937 16:87842876-87842898 CAGATGGGAGAGAGGCCAGAGGG - Intronic
1142153357 16:88522329-88522351 AGGGTGGGCTGGAGGAAAGACGG + Intronic
1142730535 17:1852525-1852547 CAGGAAGGCCAGAGGGCAGAGGG + Intronic
1143040679 17:4033967-4033989 AAGGTGGGATAGAGGGCAGGTGG + Intronic
1143445326 17:7005928-7005950 CAGGTCGTCAGGAGGACAGAGGG - Exonic
1144092667 17:11871962-11871984 CAGGTGGCCTGGAGGGCAGTGGG - Intronic
1146306376 17:31732876-31732898 CAGGTGGGGTAGGGGGCAGGGGG - Intergenic
1147793817 17:43028810-43028832 CAGGGGAGCTGGAGGGCAGAAGG + Exonic
1148105980 17:45119106-45119128 CAGATGTGGTAGATGACAGATGG - Intronic
1148721561 17:49757181-49757203 CTGGGGGGGTGGAGGACAGATGG - Intronic
1149457690 17:56801635-56801657 CAGCTGGGGTAGAGGGCAGATGG + Intronic
1149578806 17:57733076-57733098 CAGGTGCTGGAGAGGACAGAGGG - Intergenic
1151319873 17:73346586-73346608 GTGATGGGCTAGAGGAGAGAGGG - Intronic
1151542800 17:74773380-74773402 TGGGTGGGGAAGAGGACAGAAGG + Intronic
1152009260 17:77700874-77700896 CACGTGAGGCAGAGGACAGATGG - Intergenic
1152144350 17:78559343-78559365 CAGGTGGGGCAGAGGCCACAGGG - Intronic
1152746154 17:82040248-82040270 AAGCTGGGCAAGAGGGCAGAGGG - Intergenic
1153918004 18:9762809-9762831 GAGCTGGGCTAGAGGAGACATGG + Intronic
1155110671 18:22711174-22711196 GAGGTGGGCCTGAGGACACAGGG - Intergenic
1155235687 18:23816743-23816765 CAGGTGGGCAAGACGAGAGCTGG + Intronic
1155556751 18:27028431-27028453 CAGGCGGGCTAGAGGGCATCCGG + Intronic
1156452298 18:37273828-37273850 TAGGTGGGCCAGAGGCCTGAGGG + Intronic
1158321129 18:56265834-56265856 CAGGTGGGCTGGAAGAAAGTAGG + Intergenic
1160396425 18:78575694-78575716 CAGCTGGGCTAGAGGGGAGGGGG - Intergenic
1160717136 19:581597-581619 CATGTGGGCAGGAGGGCAGACGG - Intronic
1160752550 19:741354-741376 CAGCTGGGCTGGAGGGCTGAGGG + Intronic
1161162300 19:2768175-2768197 CAGGTGGGCCAGCAGAGAGAGGG - Intronic
1162727936 19:12701081-12701103 CAGGAGGGCAAGTGGACGGATGG + Exonic
1164274242 19:23702740-23702762 CAGGTGGGCTAGAGGAAGAAAGG - Intergenic
1164574983 19:29400717-29400739 CAGGTGGGCTGGAGGATGCATGG + Intergenic
1166081057 19:40444330-40444352 CTGGTGGGCCAGAGGCCAGACGG - Exonic
1166283038 19:41807848-41807870 CAGGTGGGTTAGAGGCCATGTGG - Intronic
1166378805 19:42343928-42343950 CAGGGAGGCAAGGGGACAGAGGG - Intronic
1166822215 19:45587586-45587608 CTGGAGGGCTAGAGAAGAGAGGG - Intronic
1167103701 19:47418957-47418979 GAGGTGGTGTAGAGGACGGATGG + Intronic
1167776231 19:51559304-51559326 CTTCTAGGCTAGAGGACAGAGGG + Intergenic
1168106970 19:54171772-54171794 CAGGAGCGGCAGAGGACAGAGGG + Intronic
1168130619 19:54316277-54316299 CAAGTTGGAGAGAGGACAGATGG - Intergenic
925820904 2:7799273-7799295 CAGGTGGGACAGTGCACAGAAGG + Intergenic
926156233 2:10455476-10455498 CAGGAAGGCTTGTGGACAGAGGG + Intergenic
928214155 2:29347333-29347355 CAGGTGGGCTACTGGGCTGATGG + Intronic
928330459 2:30354275-30354297 CAGCTGTGCTAGAAGACAGTTGG - Intergenic
929762145 2:44815419-44815441 CTGGTGGCCTATGGGACAGAAGG + Intergenic
929772011 2:44900351-44900373 CAGCTGGGGTAGAGGACTCAGGG + Intergenic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
931729418 2:65139988-65140010 CTGGTGGGAAAGAGTACAGAAGG - Intergenic
932451409 2:71813000-71813022 CAGGTGGGCCAGAGGGAGGAGGG - Intergenic
934055272 2:88246305-88246327 AAGGTGGGGTAGGGGAGAGAAGG + Intergenic
934522614 2:95029261-95029283 CAGGTGGCCCTGAGGACGGAGGG - Intronic
935464600 2:103381488-103381510 CTTATGGGCTAGAGGACAAATGG + Intergenic
937010144 2:118555542-118555564 CAGGTGGGCAAGAGGAAAGAAGG + Intergenic
937348403 2:121142730-121142752 CTGGTGGACAAGGGGACAGATGG - Intergenic
938415447 2:131100259-131100281 CAGGTGGGCTGGAGGAGAAAGGG + Intergenic
940420644 2:153477046-153477068 CAGGTAGGCGAGACGACAGAAGG - Intergenic
941685301 2:168441714-168441736 CATGTGGGCTTGGGGACAGCAGG - Intergenic
942986476 2:182148709-182148731 CAGGTGAGCCAAAGGAGAGACGG - Intronic
944147223 2:196518781-196518803 CAGGTGGGCAAGAGGGCAGCAGG - Intronic
946481952 2:220065873-220065895 CAGGTGGGGAAGAGGAGGGATGG + Intergenic
946543031 2:220706840-220706862 CAGGGCTGGTAGAGGACAGAGGG - Intergenic
947922666 2:233891692-233891714 CAGGGGAGGTAGAGGGCAGAAGG + Intergenic
948342511 2:237266112-237266134 CAGCTGGGCCAGAGGACATGTGG - Intergenic
948381645 2:237554370-237554392 CCAGTGGGGCAGAGGACAGAGGG + Exonic
948737121 2:240016443-240016465 CATGTTGGCTAAAGGACAGGTGG - Intronic
1168856293 20:1011605-1011627 CTGGTGGGCTGGGGGACAGCAGG + Intergenic
1168911011 20:1446719-1446741 CAGGTGGTTTGGAGGAGAGAAGG - Intronic
1169194578 20:3676275-3676297 CAGGAGGGCCAGATCACAGAAGG - Intronic
1169215702 20:3793484-3793506 GAGGTGGGCAAGACCACAGAGGG - Intronic
1170441861 20:16387207-16387229 CCGGTGGGCAAGAGAACTGATGG + Intronic
1171150448 20:22822540-22822562 CAGGTGGGCTAGGGGAGACCAGG + Intergenic
1171338094 20:24405860-24405882 CAGGTGGGCTGGTGGTAAGAAGG - Intergenic
1173427808 20:42958181-42958203 GAGGTGGGGTGGGGGACAGAAGG + Intronic
1173534000 20:43794962-43794984 GAAGTGGGGAAGAGGACAGAGGG - Intergenic
1173650307 20:44659554-44659576 CAGGTAGGGCAGAAGACAGAAGG - Intergenic
1175414430 20:58792588-58792610 CGGGTGGGCTAGGGCACACAAGG - Intergenic
1175582414 20:60110931-60110953 GAGGAGGGGTAGAGGCCAGAGGG + Intergenic
1175984243 20:62755979-62756001 CACGTGAGCAAGTGGACAGATGG - Intronic
1176171295 20:63697520-63697542 CAGGTGAGCCAGAGGCCTGAGGG + Exonic
1177926742 21:27226362-27226384 CAGCTGGGCAAGAGAGCAGAGGG - Intergenic
1178795234 21:35737970-35737992 CATGGGGTCAAGAGGACAGATGG + Intronic
1179913637 21:44462863-44462885 CAGGTGGTCAGGAGGACAGCAGG - Intergenic
1180086035 21:45508312-45508334 CAGGTGGGTGAGTGGATAGATGG + Intronic
1180799175 22:18623855-18623877 CAGGTGGGGTTGAGGAGGGAAGG - Intergenic
1181222543 22:21371411-21371433 CAGGTGGGGTTGAGGAGGGAAGG + Intergenic
1181401359 22:22651882-22651904 CAGATGGGCGAATGGACAGACGG - Intergenic
1181443646 22:22951932-22951954 CCAGTGGGCTTGTGGACAGAGGG + Intergenic
1181638305 22:24184400-24184422 CAGGTGGGGTTGAGGAGGGAAGG + Intronic
1183761774 22:39826761-39826783 TAGGAGGGGTAGAGGACATAAGG + Intronic
1184109237 22:42385352-42385374 GAGGTGGGCTTGGAGACAGAGGG - Intronic
1184536731 22:45092661-45092683 CGGGTGGGTTTTAGGACAGAGGG + Intergenic
1184549699 22:45197941-45197963 CAGATCGGCTGGAGGAAAGAAGG + Exonic
1184655924 22:45942038-45942060 CAGGTGGGGTAGGGGGCAGATGG - Intronic
1184900778 22:47445229-47445251 CAGGTGGACAGGAGGACAGGTGG - Intergenic
1184900840 22:47445531-47445553 CAGGTGGACAGGAGGACAGGTGG - Intergenic
949733696 3:7145704-7145726 CATGTGGGGTAGAGGTCAGAGGG + Intronic
950140862 3:10614080-10614102 CAGCTGGGTGAGAGGAGAGAGGG - Intronic
950644407 3:14368432-14368454 TGGGTGTGCTAGAGGAGAGAAGG - Intergenic
952960961 3:38588862-38588884 GAGGTGGGCTGGAGGGCAGCGGG + Intronic
953448582 3:42988137-42988159 CAGCTGGGCTGGAGGCCAGAAGG - Intronic
953675264 3:44996140-44996162 CAGATGGGCAAGGGGTCAGAAGG + Intronic
954439044 3:50511581-50511603 CAGGTGGGCTAGCTGAGGGAGGG + Intergenic
954583302 3:51715181-51715203 AAGGTGGGCTACTGGGCAGAAGG + Exonic
954675337 3:52312287-52312309 CAGGTTGGGAAGAGAACAGACGG + Intergenic
955059027 3:55481311-55481333 CAGGTTGGGGAGAGGACGGAGGG - Intronic
955080035 3:55649930-55649952 CAGGTGGGCCAGGAGGCAGAGGG + Intronic
957011425 3:75010033-75010055 CAGATGGGCTAGAGTACAGAAGG - Intergenic
959674683 3:109021040-109021062 CAGGTGGGCTGGTGCCCAGAGGG + Intronic
960084259 3:113573703-113573725 CATGTGGTGTAAAGGACAGAGGG - Intronic
960564782 3:119121879-119121901 CATGGGGGCCAGAAGACAGAGGG + Intronic
960736279 3:120784621-120784643 CAGGTGGTGTAGAGGACAGATGG - Intergenic
961091695 3:124118241-124118263 CAGCTGGGGGACAGGACAGAGGG + Intronic
967148484 3:186626762-186626784 CATGTGGTCTGGAGGACAGAAGG - Intergenic
967200536 3:187068897-187068919 CAGGGAGGCCTGAGGACAGAGGG - Intronic
968133985 3:196208639-196208661 CAGGTGGCCTAGAAGGCAGGGGG - Intronic
968226564 3:196976059-196976081 CAGCTGGGCCAGAGAAAAGAAGG - Intergenic
969502521 4:7561775-7561797 CAGATGGGCAAATGGACAGATGG - Intronic
969696513 4:8738135-8738157 CAGGTGGGGTAGGGGGCAGGGGG - Intergenic
970386315 4:15560411-15560433 CAGTTGGGCTGGAGGACTGGGGG + Intronic
973607212 4:52599837-52599859 CAGATGGGCTGGAGCTCAGAGGG - Intronic
973971686 4:56219224-56219246 CTGGTGGGCTAGACCACAGTAGG + Intronic
975158196 4:71095297-71095319 GAGGGAGGCTAAAGGACAGATGG + Intergenic
976143059 4:82013114-82013136 CAGGTGGGAGAGAAGCCAGATGG + Intronic
977183846 4:93911614-93911636 CAGGAGGAATAGAGGAAAGAGGG - Intergenic
979325134 4:119370454-119370476 CATGTGGGTTACAGGAAAGAAGG + Intergenic
981634242 4:146857400-146857422 GAGGTGGGCCACAGGACAAAAGG + Intronic
982742290 4:159070090-159070112 CAGATGGGGAAAAGGACAGATGG + Intergenic
985784252 5:1885943-1885965 CAGGTGGGCCAGAAGTCAGCCGG + Intronic
990681802 5:58253224-58253246 AGGATGGGCAAGAGGACAGAGGG + Intergenic
992208942 5:74458532-74458554 CAGGTGGGATAGGTGACAGGGGG + Intergenic
992791615 5:80219223-80219245 GGGGTGGGCTAGAGGAGTGAGGG - Intronic
995278573 5:110307253-110307275 CAGGGGGGCTAGAGTACCAAGGG - Intronic
996624140 5:125549583-125549605 CAGAAAGGTTAGAGGACAGAGGG - Intergenic
997031814 5:130138512-130138534 GAGGTGGGCTACAGGCAAGAAGG + Intronic
997036563 5:130199577-130199599 CAGGTGAGCTAATGGAAAGAAGG + Intergenic
1001573096 5:172743682-172743704 CAGGTGGTCCAGAGGAAGGAGGG + Intergenic
1004399013 6:15271235-15271257 CAGGAGGGCTTGAGGCCAGTGGG + Intronic
1005143909 6:22665480-22665502 TAGGTAGGGTATAGGACAGAGGG - Intergenic
1005168642 6:22955828-22955850 CAGGTGGGCTAGCTGAAAGCAGG - Intergenic
1005870354 6:29970791-29970813 CAGGTTCACTAGAGGACACAGGG + Intergenic
1006042445 6:31267612-31267634 CAGGTGGGCTTGAGGGGAGTGGG - Intergenic
1006052033 6:31352701-31352723 CAGGTGGGCTTGAGGGGAGTGGG - Intronic
1006303021 6:33204107-33204129 CAGGTGGGGTAGGGGACACCAGG - Exonic
1006672265 6:35736910-35736932 CAGGAGTGCTCGAGAACAGATGG - Intergenic
1007383978 6:41508303-41508325 GAAGTGGGCTAGAGGACACGGGG - Intergenic
1007778781 6:44239083-44239105 CTGGTGGGCATGATGACAGAAGG + Intergenic
1009593814 6:65708969-65708991 GAGGGGGGGGAGAGGACAGAAGG - Intergenic
1013327064 6:109056924-109056946 CAGGGGAGGGAGAGGACAGATGG - Intronic
1014029848 6:116687954-116687976 AAGGTAGGTTAGAGGACATATGG - Intronic
1014257959 6:119183131-119183153 CATCAGGGCTGGAGGACAGAAGG + Intronic
1014715006 6:124853834-124853856 CAGCTGTGCTAGAGGAAAGGCGG - Intergenic
1016046294 6:139484014-139484036 TGGGTGGGCAAGAGGAGAGAGGG - Intergenic
1016998272 6:149976454-149976476 CAGCTGGGCTAGATGAGAGCAGG + Intergenic
1017010263 6:150058493-150058515 CAGCGGGGCTAGAGGAGAGCAGG - Intergenic
1017704362 6:157107387-157107409 GAGGTGGGCTAAAGGATATAAGG + Intronic
1018940959 6:168308633-168308655 CAGGGTGGCTGGAGTACAGACGG - Exonic
1019442718 7:1055578-1055600 CAGGTGGGAGAGAGGACGCAGGG + Intronic
1021439168 7:20658836-20658858 GAAGTGGTTTAGAGGACAGAAGG + Intronic
1022055023 7:26721611-26721633 CAAGTGGACTGGAGGAGAGAGGG - Intronic
1022083965 7:27048689-27048711 TGGGTGGGCAAGAGGACAGCCGG - Intergenic
1022172831 7:27845888-27845910 AGGGTGGGGTAGAGGAGAGAGGG - Intronic
1022201658 7:28123106-28123128 CAGTGTGGCTAGAGGAGAGAGGG - Intronic
1023111665 7:36818918-36818940 CAGGTGGGAGAGAAGGCAGACGG - Intergenic
1023812701 7:43924726-43924748 CAGGTGGGCTGGAGGTAGGAAGG + Intronic
1023881448 7:44323837-44323859 CTGGAGGCCAAGAGGACAGACGG + Intronic
1024167204 7:46746844-46746866 CAGGGAGGCTAGGAGACAGAAGG - Intronic
1025236950 7:57240906-57240928 CAGGTGGTGCAGAGGACAGCTGG - Intergenic
1027203739 7:76080609-76080631 ATGGTGGGCAAGGGGACAGATGG - Intergenic
1032453135 7:132051888-132051910 CAGGGAGGCAAGAGGACAGACGG + Intergenic
1034225346 7:149477070-149477092 CCGGTGGGTTAGGGGACGGACGG + Intronic
1035009587 7:155702084-155702106 CAGGAGGGCAGGAGGACACAGGG + Intronic
1035860812 8:3026191-3026213 CTGGTGGGGTGGGGGACAGAGGG + Intronic
1036638185 8:10565511-10565533 CAGGTGGGCCAGAAGACAGGAGG - Intergenic
1037583577 8:20261409-20261431 CAGGTGGGCTAGTGGAGGGGAGG - Intronic
1037897503 8:22667814-22667836 CAGGTGGGGGAGGGGACAGATGG + Intronic
1039838939 8:41279997-41280019 CAGGAAGGCTTGAAGACAGAGGG + Intronic
1039887505 8:41663599-41663621 CAGGTGGGCTAGAAGCTAAAAGG - Intronic
1041192235 8:55365834-55365856 CTGTAGGGCTAGAGGACTGAAGG + Intronic
1041256371 8:55982844-55982866 CAGGAGGGTGAGTGGACAGAAGG - Intronic
1041393903 8:57373037-57373059 AAGGAGGGCTAGAGGACCCAGGG - Intergenic
1041914391 8:63125445-63125467 CAGTAGGGGTAGAGCACAGAGGG - Intergenic
1042540555 8:69903558-69903580 CTGGTGGGGAAGAGGACGGATGG + Intergenic
1042699648 8:71598243-71598265 CAGGTGGGGTTGAGGGTAGAGGG + Intergenic
1045656379 8:104391466-104391488 CATGTGGGATTGAGGACACAGGG + Intronic
1046872077 8:119214970-119214992 CAGCATGGTTAGAGGACAGATGG + Intronic
1047641165 8:126823199-126823221 TATGTGGGCTAGAAGACACAGGG - Intergenic
1048089044 8:131218718-131218740 CAGGTAGGCAAGAGAAAAGAAGG + Intergenic
1048676618 8:136790896-136790918 GAGGTGGGGTAGAGGAGGGATGG - Intergenic
1048934195 8:139341804-139341826 CAGGTGGGCTGGAGGCTAGAGGG - Intergenic
1050028136 9:1356914-1356936 CAGGTGGGGAGCAGGACAGATGG - Intergenic
1050431670 9:5568635-5568657 AAGGTGGGCTTCAGGACATAGGG - Intronic
1052892412 9:33715510-33715532 CATGTAGGCTGGAGGACAGTGGG - Intergenic
1055976419 9:81959503-81959525 CAGTTGGGCTAGATGATAGGGGG + Intergenic
1056814488 9:89791708-89791730 CAGGTGAGCGAGAGGCCAAAGGG + Intergenic
1058843608 9:108934254-108934276 CAGATGGGCAAGAGGGCAGAGGG - Exonic
1061436408 9:130565540-130565562 CAGGTTGGCCACAGGAAAGAAGG + Intergenic
1061763953 9:132869728-132869750 CAGGTGGCATTGAGGACACATGG + Intronic
1061802113 9:133118382-133118404 CAGGTGGGCTGGAGTGAAGAGGG - Intronic
1061826356 9:133260716-133260738 CACGTTGGCTGGAGCACAGAGGG + Intronic
1061919134 9:133772532-133772554 AAGGGGGCCTTGAGGACAGAAGG - Intronic
1062390338 9:136331304-136331326 CAGGTGAGGGAGAGCACAGAGGG + Intronic
1062445384 9:136591719-136591741 CTTGTGTGCCAGAGGACAGACGG + Intergenic
1062721123 9:138044696-138044718 CAGGTGGACGGGAGGGCAGAGGG + Intronic
1185644208 X:1605556-1605578 AAGCTGGGCGAGAGGAGAGAAGG - Intergenic
1185833844 X:3327200-3327222 CAGGAGGGCAAAAGGAAAGATGG - Intronic
1186749553 X:12607217-12607239 CAGGTGGGCAGGAGATCAGACGG - Intronic
1187899363 X:24012813-24012835 AAGGTAGGTTAGGGGACAGAAGG - Intronic
1188988105 X:36785952-36785974 CAGCTGGGCAAGAGGAGAGGTGG + Intergenic
1193118148 X:77795454-77795476 TAGGTGGGGAAGAGGACAGGAGG + Intergenic
1201311068 Y:12598512-12598534 CTGGAGGCCTAGAGGCCAGAGGG + Intergenic